ID: 1120996543 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:90422286-90422308 |
Sequence | TGCACCAGAGGATGGGCAGA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1120996543_1120996548 | -3 | Left | 1120996543 | 14:90422286-90422308 | CCCTCTGCCCATCCTCTGGTGCA | No data | ||
Right | 1120996548 | 14:90422306-90422328 | GCAAACACAGTGTCTGAGCACGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1120996543 | Original CRISPR | TGCACCAGAGGATGGGCAGA GGG (reversed) | Intergenic | ||