ID: 1120996544

View in Genome Browser
Species Human (GRCh38)
Location 14:90422287-90422309
Sequence TTGCACCAGAGGATGGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120996544_1120996548 -4 Left 1120996544 14:90422287-90422309 CCTCTGCCCATCCTCTGGTGCAA No data
Right 1120996548 14:90422306-90422328 GCAAACACAGTGTCTGAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120996544 Original CRISPR TTGCACCAGAGGATGGGCAG AGG (reversed) Intergenic