ID: 1120996545

View in Genome Browser
Species Human (GRCh38)
Location 14:90422293-90422315
Sequence CTGTGTTTGCACCAGAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120996545_1120996548 -10 Left 1120996545 14:90422293-90422315 CCCATCCTCTGGTGCAAACACAG No data
Right 1120996548 14:90422306-90422328 GCAAACACAGTGTCTGAGCACGG No data
1120996545_1120996550 25 Left 1120996545 14:90422293-90422315 CCCATCCTCTGGTGCAAACACAG No data
Right 1120996550 14:90422341-90422363 CTCTACTAAGCGTCCTTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120996545 Original CRISPR CTGTGTTTGCACCAGAGGAT GGG (reversed) Intergenic