ID: 1120996548

View in Genome Browser
Species Human (GRCh38)
Location 14:90422306-90422328
Sequence GCAAACACAGTGTCTGAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120996536_1120996548 29 Left 1120996536 14:90422254-90422276 CCCCTTGAGCGAAGACAGAATAT No data
Right 1120996548 14:90422306-90422328 GCAAACACAGTGTCTGAGCACGG No data
1120996539_1120996548 2 Left 1120996539 14:90422281-90422303 CCCCACCCTCTGCCCATCCTCTG No data
Right 1120996548 14:90422306-90422328 GCAAACACAGTGTCTGAGCACGG No data
1120996545_1120996548 -10 Left 1120996545 14:90422293-90422315 CCCATCCTCTGGTGCAAACACAG No data
Right 1120996548 14:90422306-90422328 GCAAACACAGTGTCTGAGCACGG No data
1120996542_1120996548 0 Left 1120996542 14:90422283-90422305 CCACCCTCTGCCCATCCTCTGGT No data
Right 1120996548 14:90422306-90422328 GCAAACACAGTGTCTGAGCACGG No data
1120996544_1120996548 -4 Left 1120996544 14:90422287-90422309 CCTCTGCCCATCCTCTGGTGCAA No data
Right 1120996548 14:90422306-90422328 GCAAACACAGTGTCTGAGCACGG No data
1120996540_1120996548 1 Left 1120996540 14:90422282-90422304 CCCACCCTCTGCCCATCCTCTGG No data
Right 1120996548 14:90422306-90422328 GCAAACACAGTGTCTGAGCACGG No data
1120996538_1120996548 27 Left 1120996538 14:90422256-90422278 CCTTGAGCGAAGACAGAATATTC No data
Right 1120996548 14:90422306-90422328 GCAAACACAGTGTCTGAGCACGG No data
1120996543_1120996548 -3 Left 1120996543 14:90422286-90422308 CCCTCTGCCCATCCTCTGGTGCA No data
Right 1120996548 14:90422306-90422328 GCAAACACAGTGTCTGAGCACGG No data
1120996537_1120996548 28 Left 1120996537 14:90422255-90422277 CCCTTGAGCGAAGACAGAATATT No data
Right 1120996548 14:90422306-90422328 GCAAACACAGTGTCTGAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120996548 Original CRISPR GCAAACACAGTGTCTGAGCA CGG Intergenic