ID: 1120996550

View in Genome Browser
Species Human (GRCh38)
Location 14:90422341-90422363
Sequence CTCTACTAAGCGTCCTTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120996546_1120996550 24 Left 1120996546 14:90422294-90422316 CCATCCTCTGGTGCAAACACAGT No data
Right 1120996550 14:90422341-90422363 CTCTACTAAGCGTCCTTCAGTGG No data
1120996547_1120996550 20 Left 1120996547 14:90422298-90422320 CCTCTGGTGCAAACACAGTGTCT No data
Right 1120996550 14:90422341-90422363 CTCTACTAAGCGTCCTTCAGTGG No data
1120996545_1120996550 25 Left 1120996545 14:90422293-90422315 CCCATCCTCTGGTGCAAACACAG No data
Right 1120996550 14:90422341-90422363 CTCTACTAAGCGTCCTTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120996550 Original CRISPR CTCTACTAAGCGTCCTTCAG TGG Intergenic