ID: 1121001831

View in Genome Browser
Species Human (GRCh38)
Location 14:90456648-90456670
Sequence CTGTGCAGTGGGGAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1904
Summary {0: 1, 1: 0, 2: 8, 3: 159, 4: 1736}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121001831_1121001845 29 Left 1121001831 14:90456648-90456670 CCTCCCACCTCCCCACTGCACAG 0: 1
1: 0
2: 8
3: 159
4: 1736
Right 1121001845 14:90456700-90456722 AGAAGGATGCAGCTCTGAGGAGG 0: 1
1: 0
2: 2
3: 28
4: 269
1121001831_1121001843 26 Left 1121001831 14:90456648-90456670 CCTCCCACCTCCCCACTGCACAG 0: 1
1: 0
2: 8
3: 159
4: 1736
Right 1121001843 14:90456697-90456719 TCCAGAAGGATGCAGCTCTGAGG 0: 1
1: 0
2: 2
3: 19
4: 268
1121001831_1121001840 12 Left 1121001831 14:90456648-90456670 CCTCCCACCTCCCCACTGCACAG 0: 1
1: 0
2: 8
3: 159
4: 1736
Right 1121001840 14:90456683-90456705 TGTCCCTGAGCTGCTCCAGAAGG 0: 1
1: 0
2: 2
3: 20
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121001831 Original CRISPR CTGTGCAGTGGGGAGGTGGG AGG (reversed) Intergenic
900211182 1:1456578-1456600 CAGGGCAGAAGGGAGGTGGGTGG + Intronic
900217007 1:1486897-1486919 CAGGGCAGAAGGGAGGTGGGTGG + Intronic
900224090 1:1524626-1524648 CAGGGCAGAAGGGAGGTGGGTGG + Intronic
900300208 1:1973338-1973360 CAGTGCTGTGGGGAGGGAGGAGG + Intronic
900337112 1:2169742-2169764 GTGCGCAGAGGGGAGGTGGCTGG + Intronic
900365795 1:2311485-2311507 CAGTGCAGTGGGGAGGAGTTGGG + Intergenic
900507536 1:3037202-3037224 CTGTGCTGGGGAGGGGTGGGTGG - Intergenic
900581228 1:3410637-3410659 GTGCGGAGAGGGGAGGTGGGAGG + Intronic
900608740 1:3535586-3535608 GAGGGCAGAGGGGAGGTGGGCGG - Intronic
900767149 1:4513186-4513208 CCCTGCAGAGGGGAGGAGGGTGG + Intergenic
900817065 1:4856363-4856385 CTGTCCAGTGGGAAAGCGGGAGG + Intergenic
901012587 1:6209961-6209983 CTGTGCAGAGGTGAGTTGGGGGG + Exonic
901053224 1:6436122-6436144 CTGTGCGGTGGGAGGGAGGGAGG + Intronic
901100366 1:6715140-6715162 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
901510591 1:9716422-9716444 CTCTCCTGTGGGGAGGAGGGAGG - Exonic
901836964 1:11930426-11930448 TTGTGGAGACGGGAGGTGGGTGG + Intergenic
902018786 1:13328736-13328758 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
902075296 1:13780013-13780035 CTGTGCTGTGGAGAACTGGGAGG - Exonic
902135179 1:14298984-14299006 CTGTGCCGTTAGGAGGTGGCAGG + Intergenic
902234222 1:15047430-15047452 ACGTGCAGTGGGGAGGTGGAGGG + Intronic
902481028 1:16711965-16711987 CTGTGCAGTGGGAGGGAGGGAGG - Intergenic
902509980 1:16961150-16961172 CAGGGAAGGGGGGAGGTGGGCGG + Intronic
903081433 1:20815762-20815784 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
903148251 1:21388290-21388312 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
903375281 1:22861987-22862009 TTGTGCAATGGGTAAGTGGGTGG - Intronic
903637846 1:24833713-24833735 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
903923798 1:26818504-26818526 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
903993294 1:27289086-27289108 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
904074352 1:27829132-27829154 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
904077401 1:27853051-27853073 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
904077503 1:27853277-27853299 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
904077579 1:27853454-27853476 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
904077742 1:27853827-27853849 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
904077833 1:27854025-27854047 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
904373277 1:30064392-30064414 CTCTGCAGTGTGTGGGTGGGAGG + Intergenic
904475825 1:30764085-30764107 CTGGGCAGTGGGGAGGCTGGAGG - Intergenic
904698848 1:32346335-32346357 CGTGGGAGTGGGGAGGTGGGAGG + Intergenic
904760961 1:32804374-32804396 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
904784709 1:32974897-32974919 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
904795220 1:33052421-33052443 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
904818038 1:33220185-33220207 CTCTGCAGTGGGGGGTTTGGGGG + Intergenic
904842061 1:33379303-33379325 GGGGGCAGTGGGGGGGTGGGGGG - Intronic
904983101 1:34523291-34523313 GGGTGCAGAGGGGATGTGGGAGG - Intergenic
905007112 1:34718681-34718703 CTGTGGAGTGGGGTGGGGAGGGG - Intronic
905009381 1:34736904-34736926 CTGTGCAGTGTGGAGGCGGCAGG - Intronic
905315876 1:37081231-37081253 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
905315977 1:37081485-37081507 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
905374303 1:37508526-37508548 CTTTGGAATGGAGAGGTGGGAGG - Intronic
905482093 1:38268644-38268666 CGGTGCAGGGGGGTGGTGGGGGG - Intergenic
905552580 1:38855195-38855217 CAGTCCAGGGGGGAGGTGGAAGG + Intronic
906136282 1:43502320-43502342 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
906253295 1:44328223-44328245 CAGTGCATTGCGGGGGTGGGGGG - Intronic
906367464 1:45223082-45223104 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
906427291 1:45724999-45725021 CCGTCCAGGTGGGAGGTGGGGGG + Intronic
906486957 1:46241357-46241379 CCGTCCGGTAGGGAGGTGGGGGG + Intergenic
906487290 1:46242114-46242136 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
906487369 1:46242292-46242314 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
906637250 1:47417454-47417476 CTGTCCAGTGGCGAGATGGTGGG - Exonic
906661909 1:47589018-47589040 CTTTGCCGGGGGGTGGTGGGGGG - Intergenic
906742152 1:48192988-48193010 CTGTCCTGGAGGGAGGTGGGGGG + Intergenic
906761763 1:48383185-48383207 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
906904502 1:49875298-49875320 GTGTGGAGGGGGGAGGGGGGAGG - Intronic
907453553 1:54562047-54562069 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
907457725 1:54586103-54586125 CTGTGCAGTGGGTGGGTGGGTGG + Intronic
907497210 1:54853132-54853154 CTGTTCCGTGGGGAGGAGTGGGG + Intronic
907611549 1:55876089-55876111 CTTTGGAGTGCTGAGGTGGGCGG + Intergenic
908258600 1:62321795-62321817 GTGTGGGGTGGGGAGGTGGGGGG - Intergenic
908330324 1:63064501-63064523 TTCTGCCTTGGGGAGGTGGGTGG + Intergenic
908370279 1:63473456-63473478 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
908446216 1:64201405-64201427 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
908467988 1:64415352-64415374 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
908905867 1:69007985-69008007 CTTTGCAGGGTCGAGGTGGGTGG + Intergenic
909478888 1:76112249-76112271 CTGTCCAGGAAGGAGGTGGGGGG - Intronic
909481519 1:76132339-76132361 CCCTCCAGTGGGGAGGAGGGGGG + Intronic
909488852 1:76204468-76204490 GTTTGCAGAGGGGAGTTGGGTGG + Intronic
909593827 1:77381977-77381999 CTGTGCAGAGGGTGGGTGGAGGG - Intronic
909640880 1:77869703-77869725 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
909641052 1:77870096-77870118 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
910497587 1:87849603-87849625 GTGTGCAGCGGGGGGGTGGGGGG + Intergenic
911075020 1:93864688-93864710 CTGTTCAATGGGGAGGTTGGGGG + Intergenic
911120099 1:94287645-94287667 TTGTGGGGTGGGGAGCTGGGGGG - Intergenic
911240112 1:95455811-95455833 CTGAGCTCTGGGGAGGTGGTCGG + Intergenic
911392018 1:97256947-97256969 GTGTGAAGTGGGAAGGTGGGTGG - Intronic
911486592 1:98512643-98512665 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
911827894 1:102511170-102511192 TTGTGGGGGGGGGAGGTGGGAGG - Intergenic
912116320 1:106412608-106412630 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
912298325 1:108489561-108489583 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
912316999 1:108675882-108675904 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
912591358 1:110824295-110824317 CTGTGCTGTGGTGGGGTGGGGGG + Intergenic
912751764 1:112293520-112293542 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
912808195 1:112773964-112773986 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
913021130 1:114790646-114790668 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
913089264 1:115465605-115465627 CTGCTCATGGGGGAGGTGGGAGG + Intergenic
913306037 1:117429988-117430010 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
913451755 1:118997554-118997576 CTTTGCTGGGGGCAGGTGGGAGG - Intergenic
913468266 1:119165103-119165125 CTGGGCGGTGGGGTGGGGGGTGG + Intergenic
913591777 1:120336005-120336027 GTGTGCAGGGGTGAGGAGGGGGG - Intergenic
913651579 1:120919141-120919163 GTGTGCAGGGGTGAGGAGGGGGG + Intergenic
913993832 1:143638013-143638035 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
913994135 1:143638688-143638710 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
914002305 1:143703274-143703296 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
914169530 1:145209929-145209951 GTGTGCAGGGGTGAGGAGGGGGG - Intergenic
914420721 1:147526359-147526381 CTCTGCAGCGTGGAGGAGGGAGG + Intergenic
914524642 1:148453891-148453913 GTGTGCAGGGGTGAGGAGGGGGG - Intergenic
914599028 1:149181942-149181964 GTGTGCAGGGGTGAGGAGGGGGG + Intergenic
914641758 1:149613244-149613266 GTGTGCAGGGGTGAGGAGGGGGG + Intergenic
914888097 1:151600610-151600632 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
914888276 1:151601005-151601027 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
914953870 1:152144728-152144750 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
915353784 1:155243410-155243432 CTATGCAGAGGGGAAGTGGAAGG - Intronic
915410960 1:155700854-155700876 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
915535157 1:156530929-156530951 GTGTGAAGTGGGGAGAGGGGTGG + Intronic
915539709 1:156558228-156558250 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
915598981 1:156910525-156910547 TACTGCAGTGGGAAGGTGGGAGG + Intronic
915599394 1:156913067-156913089 ATGAGGAGTGGGGAGGAGGGAGG + Intronic
915734602 1:158076686-158076708 CTGGGCAGCGGGGAGGAGAGAGG - Intronic
915951889 1:160195178-160195200 GGGTGATGTGGGGAGGTGGGAGG - Intronic
916057841 1:161080244-161080266 CTGAGCAGTTGCAAGGTGGGAGG + Intronic
916091378 1:161310058-161310080 ATGTGCAGTTGAGAGGTGGTGGG + Intergenic
916104864 1:161423257-161423279 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
916105019 1:161423611-161423633 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
916578276 1:166086274-166086296 CTGTGCTGTGGGGATGGTGGGGG - Intronic
917413108 1:174780714-174780736 TTGTGGGGTGGGGGGGTGGGGGG - Intronic
917517690 1:175721841-175721863 CTGGTCAGTGGGGTGGGGGGAGG - Intronic
917582983 1:176396433-176396455 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
917583057 1:176396610-176396632 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
917731180 1:177876622-177876644 CTGGGCAGTGGGGAGGAGGCTGG + Intergenic
917860073 1:179135940-179135962 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
917860124 1:179136068-179136090 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
918255028 1:182741189-182741211 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
918255127 1:182741414-182741436 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
918308362 1:183267598-183267620 CTGTGCCCTGGGGAGTGGGGGGG + Intronic
918958856 1:191244851-191244873 CTGTGGAGCAGGGCGGTGGGAGG - Intergenic
919080156 1:192857520-192857542 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
919163663 1:193864333-193864355 GTGTGCAGTGGGGAGGGGCAAGG - Intergenic
919546001 1:198919599-198919621 CTGTTAACTGGTGAGGTGGGTGG - Intergenic
919625215 1:199904477-199904499 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
919644980 1:200086544-200086566 CTTTGGAGTGCTGAGGTGGGAGG - Intronic
919691273 1:200530661-200530683 CTGCACTGTGGGGAAGTGGGGGG - Intergenic
919800030 1:201348364-201348386 CTGTCCTGGTGGGAGGTGGGCGG + Intergenic
919995004 1:202740364-202740386 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
920207762 1:204305300-204305322 CTGGGCAGTGGGGTAGAGGGAGG + Intronic
920374732 1:205501852-205501874 AAGTGCAGATGGGAGGTGGGAGG - Intergenic
920451710 1:206064636-206064658 CCGTCCCGGGGGGAGGTGGGGGG + Intronic
921095788 1:211886274-211886296 CTGTGCTGTGGGGAGGAAGGTGG - Intergenic
921140224 1:212298932-212298954 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
921142447 1:212320817-212320839 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
921238255 1:213152186-213152208 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
921599895 1:217095522-217095544 CTTGGCAGTGGGGAGGGAGGAGG + Intronic
921638311 1:217523808-217523830 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
921902744 1:220466621-220466643 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
922102663 1:222488248-222488270 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
922203392 1:223425996-223426018 CTATGGAGCGGGAAGGTGGGTGG - Intergenic
922306500 1:224349848-224349870 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
922339650 1:224645218-224645240 CAGGGCAGTGGGGAGGTGGTGGG - Intronic
922531551 1:226349085-226349107 CTGTGTGTTGGGGTGGTGGGGGG + Intergenic
922693128 1:227710940-227710962 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
922706368 1:227792836-227792858 CTGTGCAGTGGGGATGTCAGCGG + Intergenic
923086704 1:230708061-230708083 CTGTCCAGTGAGGAGATCGGGGG - Intronic
923173284 1:231437435-231437457 AAGTGTAGAGGGGAGGTGGGTGG + Intergenic
923519931 1:234727568-234727590 CTGTGCAGATGGGAGGGCGGGGG - Intergenic
923720864 1:236465469-236465491 CTGGGCAGTGGGGACTTGGGAGG - Intronic
923840845 1:237669512-237669534 CCGTGCGGGAGGGAGGTGGGGGG - Intronic
924172663 1:241357505-241357527 CTGTGCGATGGGTGGGTGGGTGG + Intergenic
924515008 1:244758636-244758658 CTCTGCAGGGCTGAGGTGGGAGG - Intergenic
924588519 1:245380896-245380918 CTGGGAGGTGGGGAGGTTGGTGG + Intronic
924824182 1:247522234-247522256 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
924824203 1:247522280-247522302 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1062857639 10:787228-787250 CTGTGCAGAGGGAAGGCGCGAGG + Intergenic
1062925777 10:1314514-1314536 CCGGGCAGTGGGGAGGATGGAGG - Intronic
1062927288 10:1326842-1326864 CTGGGCAGTGGGGAGGCGCTGGG - Intronic
1062927295 10:1326860-1326882 CTGTGCCGTGGGGAGGCGCTGGG - Intronic
1062927305 10:1326896-1326918 CTGGGCAGTGGGGAGGCGCTGGG - Intronic
1062927311 10:1326914-1326936 CTGGGCAGTGGGGAGGCGCTGGG - Intronic
1062927318 10:1326932-1326954 CTGTGCCGTGGGGAGGCGCTGGG - Intronic
1062927336 10:1326986-1327008 CTGGGCAGTGGGGAGGCGCTGGG - Intronic
1062927343 10:1327004-1327026 CTGTGCCGTGGGGAGGCGCTGGG - Intronic
1062927353 10:1327040-1327062 CTGGGCAGTGGGGAGGCGCTGGG - Intronic
1062927359 10:1327058-1327080 CTGTGCAGTGGGGAGGCGCTGGG - Intronic
1062927393 10:1327253-1327275 CTGTGCAGTGAGGAGGCGCTGGG - Intronic
1062927400 10:1327289-1327311 CTGTGCCGTGGGGAGGCGCTGGG - Intronic
1062927414 10:1327361-1327383 CTGTGCCGTGGGGAGGCGCTGGG - Intronic
1062927428 10:1327415-1327437 CTGGGCAGTGGGGAGGCGCTGGG - Intronic
1062927441 10:1327451-1327473 CTGTGCAGTGAGGAGGCGCTGGG - Intronic
1062927463 10:1327559-1327581 CTGTGCAGTGAGGAGGCGCTGGG - Intronic
1062927472 10:1327613-1327635 CTGTGCCGTGGGGAGGCGCTGGG - Intronic
1062927480 10:1327649-1327671 CTGTGCAGTGCGGAGGCGCTGGG - Intronic
1063030095 10:2225789-2225811 CTATGCAGTGAGGAGGAGCGTGG - Intergenic
1063369856 10:5514127-5514149 CTGTGCTGGGGGGTGGTGGGTGG - Intergenic
1063440047 10:6065522-6065544 CTCTGCAGGGCTGAGGTGGGAGG - Intergenic
1063726961 10:8647800-8647822 CTGGGTAGTGGGAATGTGGGAGG + Intergenic
1063744991 10:8869277-8869299 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1063931511 10:11033167-11033189 CTGTCCAGTGGTGAGGTGTGAGG + Intronic
1064026633 10:11853798-11853820 GTGTGCAGTAGGGAGGAGGAAGG - Intronic
1064070665 10:12226312-12226334 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1064108581 10:12519945-12519967 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1064109020 10:12522828-12522850 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1065187742 10:23185418-23185440 CTCAGAAGTGGGGTGGTGGGAGG + Intergenic
1065336035 10:24656549-24656571 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1065594200 10:27296195-27296217 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1065594253 10:27296322-27296344 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1065594374 10:27296596-27296618 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1066022643 10:31319132-31319154 AGGTGCGGTGGGGAGGGGGGAGG + Intronic
1066085460 10:31970173-31970195 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1066093511 10:32050188-32050210 CTTTGAAGTGGGGATGTGGAGGG - Intronic
1066395788 10:35020265-35020287 CTGAGAAGTGGGGAGGTGGAAGG + Intronic
1067026498 10:42847520-42847542 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1067034225 10:42900681-42900703 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1067079829 10:43206568-43206590 GTGTGCAGCGGGGAGCTGGGAGG + Intronic
1067092224 10:43273669-43273691 CTGTGCAAGGGGGCGGTGGGTGG + Intergenic
1067119987 10:43465196-43465218 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1067267098 10:44755978-44756000 GGGGGCAGTGGGGAGGTGAGGGG - Intergenic
1067325274 10:45260258-45260280 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1067339816 10:45391971-45391993 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1067682048 10:48447609-48447631 GGCAGCAGTGGGGAGGTGGGTGG - Intronic
1068005988 10:51392962-51392984 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1068668032 10:59696964-59696986 CCGTCCAGAAGGGAGGTGGGGGG + Intronic
1068668084 10:59697091-59697113 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1068760881 10:60708013-60708035 CTTTGCAGTGGGGAGGAGCCTGG - Intronic
1068969777 10:62948157-62948179 CCGTTCAGGAGGGAGGTGGGGGG + Intergenic
1068969896 10:62948452-62948474 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1069380875 10:67842246-67842268 CAGTGCAGAGGGGAAATGGGAGG + Intergenic
1069554589 10:69389463-69389485 CTCTGGCGGGGGGAGGTGGGGGG + Intronic
1069741190 10:70687467-70687489 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1069741367 10:70687869-70687891 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1070079925 10:73175946-73175968 CTGTGCAGTGGGGTGAGGGATGG + Intronic
1070499134 10:77053977-77053999 CTGTGCAGTGGGCAGCAGGATGG - Intronic
1070526295 10:77298709-77298731 GTGTTCAGTGTGGAAGTGGGAGG - Intronic
1070713443 10:78700288-78700310 TTGTGTACTGGGGGGGTGGGAGG - Intergenic
1070966501 10:80534248-80534270 CTGTCCAGAAGGGAGGTGGGGGG + Intergenic
1070966721 10:80534776-80534798 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1070984225 10:80674208-80674230 TTGTGAAATGTGGAGGTGGGAGG - Intergenic
1071299758 10:84247751-84247773 CTGTGGACTGGGGAGGGGGCTGG - Intronic
1071616504 10:87080830-87080852 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1071616651 10:87081178-87081200 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1071907384 10:90188645-90188667 CTTTGCAGTGGGGAGGAGCCTGG - Intergenic
1072052010 10:91714298-91714320 CTGTGCCTGGGGGAAGTGGGAGG + Intergenic
1072149783 10:92674920-92674942 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1072180376 10:92975508-92975530 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1072291766 10:93970933-93970955 CCGTCCGGGGGGGAGGTGGGGGG + Intergenic
1072602139 10:96941027-96941049 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1072602308 10:96941417-96941439 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1072648832 10:97276990-97277012 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1072684335 10:97528355-97528377 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1072949575 10:99838737-99838759 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1072950722 10:99844590-99844612 CTCTGCCCTGGGGAGGTGTGGGG + Intronic
1072956578 10:99892154-99892176 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1072980576 10:100093904-100093926 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1072999854 10:100277639-100277661 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1073011007 10:100359577-100359599 GTGTGAACTGGGGAGGAGGGGGG - Intronic
1073059363 10:100724309-100724331 CCGCGCAGTGGGCAGGAGGGAGG - Intergenic
1073146147 10:101283136-101283158 GTATGCAGTGGGGAGGAGGGTGG + Intergenic
1073199653 10:101724997-101725019 CTGTGCACTGGGGAGGAGGAGGG - Intergenic
1073594336 10:104785084-104785106 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1073621807 10:105058004-105058026 CTGTCCAGCGGGGAGATGAGAGG - Intronic
1073865629 10:107800892-107800914 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1074152101 10:110767346-110767368 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1074425182 10:113344421-113344443 AAGGGTAGTGGGGAGGTGGGTGG + Intergenic
1074898897 10:117800272-117800294 CTGGGGGGGGGGGAGGTGGGGGG - Intergenic
1074913315 10:117931998-117932020 CTGGGCAGGGGGGATGTTGGAGG + Intergenic
1075050969 10:119182343-119182365 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1075071172 10:119320823-119320845 CTGAGCACGGGGGAGGTGGGAGG + Intronic
1075214588 10:120520883-120520905 GGGGGCAGTGGGGAGTTGGGGGG + Intronic
1075374215 10:121964873-121964895 ATGTTCCCTGGGGAGGTGGGGGG - Intronic
1075684401 10:124353679-124353701 CTGTCCTGTGGTGGGGTGGGGGG - Intergenic
1075925146 10:126245501-126245523 CTGGGCAGTGGGCAGGAGGTCGG + Intronic
1076133820 10:128031007-128031029 TTTGGAAGTGGGGAGGTGGGAGG + Intronic
1076135927 10:128045744-128045766 CTCTGCTGTGGGCAGGTTGGAGG + Intronic
1076450256 10:130552190-130552212 CTGTGGGCTGGGGAGGTGGAGGG + Intergenic
1076617833 10:131768525-131768547 CTGTGCAGTGCTGTGGAGGGAGG - Intergenic
1076674853 10:132142504-132142526 CTGCCCAGTGGGGAGGCCGGGGG - Intronic
1076870267 10:133189477-133189499 CCGTGCAATGGGGAGGCTGGGGG + Intronic
1076931314 10:133533674-133533696 CTGTGGAGCTGGGAGGTGGCTGG + Intronic
1076984255 11:223825-223847 CTGTGCAGGGAGGAGGCTGGAGG - Intronic
1076984276 11:223897-223919 CTGTGCAGGGAGGAGGCTGGAGG - Intronic
1076984318 11:224041-224063 CTGTGCAGGGAGGAGGCTGGAGG - Intronic
1077077747 11:708997-709019 TGGTGCTGTGGGGAGGGGGGTGG - Intronic
1077080307 11:722025-722047 CTGTGCTGAGGGGAGGGTGGAGG + Intronic
1077177463 11:1197228-1197250 CTGTGGAGGTGTGAGGTGGGGGG + Intronic
1077201493 11:1309644-1309666 CTGCGCAGTGGGGCGGTGCCGGG - Intronic
1077232469 11:1464090-1464112 CTGAGCAGTGGGGAGCTGGCAGG - Intergenic
1077333659 11:1994155-1994177 CTGTGCACTGGGAATGGGGGTGG + Intergenic
1077342009 11:2030390-2030412 CTGTGGTGTGGGGCTGTGGGGGG + Intergenic
1077412620 11:2410659-2410681 CAGTGCAGTGGGGAGGGGGCGGG - Intronic
1077668786 11:4138078-4138100 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1077774744 11:5258522-5258544 CTGGGCAGTGGGGGGGTTGGTGG + Intronic
1077916757 11:6616623-6616645 CTGGACAGTGGGGAAGGGGGTGG - Intronic
1078444021 11:11390650-11390672 CTTGTCAGTGGGGAGGTGGAAGG + Intronic
1079018375 11:16888247-16888269 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1079022894 11:16924030-16924052 CTGGGCTCTGGGGAGGTGGGAGG - Intronic
1079039867 11:17050692-17050714 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1079444908 11:20548726-20548748 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1079444983 11:20548894-20548916 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1079479271 11:20863368-20863390 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1079528644 11:21421585-21421607 CTGTGGGGTGGGGACGTGAGGGG - Intronic
1079785603 11:24667557-24667579 CTGTGTAATGGGGAGCTGAGTGG + Intronic
1080098307 11:28431012-28431034 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1080984879 11:37450470-37450492 GGGTGGAGTGGGGAGGTGTGGGG + Intergenic
1081288871 11:41304380-41304402 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1081407181 11:42711224-42711246 ATGTGCAGTGGGTACGTGAGTGG - Intergenic
1081551909 11:44121572-44121594 CTGTGCAGTGTGGGGGCAGGGGG - Intronic
1081556554 11:44167956-44167978 CGGGGGAGTGGGGAGGGGGGAGG - Intronic
1081617177 11:44597814-44597836 CTGTGCTGTGGGGTGGTTGTGGG + Intronic
1081950124 11:47037981-47038003 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1081950279 11:47038333-47038355 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1082233701 11:49798342-49798364 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1082844482 11:57716217-57716239 CCGTCCAGGAGGGAGGTGGGAGG - Intronic
1082844767 11:57716846-57716868 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1083131008 11:60622878-60622900 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1083382498 11:62279187-62279209 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1083382718 11:62279688-62279710 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1083538780 11:63496212-63496234 AAGGGTAGTGGGGAGGTGGGAGG - Intergenic
1083542941 11:63527168-63527190 CTGTGGGGTGGGGAGAAGGGGGG + Intergenic
1083547239 11:63558169-63558191 CAGTGCAGTGGGTTGGGGGGTGG - Intronic
1083624508 11:64065248-64065270 CGGAGCAGTGAGGCGGTGGGTGG + Intronic
1083639975 11:64140219-64140241 CTGTGCAGTGGGGCGTGAGGTGG - Intronic
1083645634 11:64171351-64171373 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1083645908 11:64171982-64172004 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1083662907 11:64260058-64260080 CTGAGCAATGGGGAGGAGGTAGG + Exonic
1083739622 11:64701886-64701908 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1083739647 11:64701936-64701958 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1083777797 11:64902679-64902701 CTCTGCAGGGGCGGGGTGGGGGG + Exonic
1083843256 11:65316344-65316366 CAGGGCTGTGGGGAGCTGGGAGG - Intronic
1083853461 11:65380679-65380701 CTAGGCAGTGGGCAGGTGGAGGG - Intronic
1084043180 11:66554513-66554535 CTGGGTCGGGGGGAGGTGGGAGG - Intronic
1084182545 11:67454131-67454153 CTCTGCAGTGGGATGGTGGTGGG + Intronic
1084313181 11:68328518-68328540 CTCTGCAGTGGGCATGGGGGAGG + Intronic
1084546433 11:69817353-69817375 CTGCGCACTGGGAAGGCGGGAGG - Intronic
1084708477 11:70829601-70829623 CTGTGCAGGGGTGAGGGGCGGGG + Intronic
1084777346 11:71386326-71386348 CTTTGGAGTGAGAAGGTGGGAGG + Intergenic
1085111897 11:73896984-73897006 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1085242185 11:75066940-75066962 CTTTGCAGGGCTGAGGTGGGAGG + Intergenic
1085292480 11:75410171-75410193 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1085360064 11:75877917-75877939 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1085513203 11:77098508-77098530 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1085787987 11:79471799-79471821 TTGTGGAGTGGGGCGCTGGGTGG + Intergenic
1086055330 11:82640043-82640065 CTGAGCAGAAGGGATGTGGGAGG - Intergenic
1086098205 11:83071588-83071610 GTGAGCGGTGGGGAGGTGGGGGG - Intronic
1086104533 11:83133540-83133562 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1086366137 11:86110880-86110902 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1086443634 11:86852013-86852035 GAGTGCAGTGGGCAGATGGGAGG - Intronic
1086455668 11:86956299-86956321 CTGTGCACTGGGGACGAGGAAGG + Intergenic
1086870767 11:92033886-92033908 GGGTGAAGTGGGGAGGTGGGGGG - Intergenic
1087007846 11:93486636-93486658 CTGGGCAGTGTAGGGGTGGGTGG - Intronic
1087057141 11:93946899-93946921 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1087144526 11:94798888-94798910 CAGAGCAGTGGGGAGGTTAGTGG + Intronic
1087191118 11:95255693-95255715 CTGTGGAATGGAGAGGTGGCTGG - Intergenic
1087324900 11:96709831-96709853 AGGTGAGGTGGGGAGGTGGGGGG - Intergenic
1087853370 11:103059741-103059763 CCGAGGAGTGGGGGGGTGGGGGG + Intergenic
1088116207 11:106317314-106317336 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1088332262 11:108666051-108666073 CTGTGGAGTCTGGAGGTTGGGGG - Intronic
1088341247 11:108770487-108770509 TGGTGCAGGGGGGAGGGGGGAGG - Intronic
1088687400 11:112296465-112296487 CTGTGCTGTGGGGTCTTGGGGGG + Intergenic
1089420700 11:118330968-118330990 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1089420801 11:118331193-118331215 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1089420898 11:118331418-118331440 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1089420972 11:118331593-118331615 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1089549096 11:119256715-119256737 CTCAGAAGCGGGGAGGTGGGAGG - Intronic
1089585444 11:119507627-119507649 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1089603595 11:119629066-119629088 CAGAGCAGGAGGGAGGTGGGTGG + Intronic
1089648209 11:119894123-119894145 CTGTAAAATGGGGAGTTGGGGGG + Intergenic
1089818658 11:121200767-121200789 ATTTGCAGTGCTGAGGTGGGAGG + Intergenic
1090323058 11:125863374-125863396 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1090520855 11:127477464-127477486 TTGTGGAATGGGGATGTGGGTGG - Intergenic
1090578239 11:128132262-128132284 TTGAGCAGTGGGAAGGTAGGAGG - Intergenic
1090776331 11:129969039-129969061 CTGTGCAGCGGGGGAGTGTGTGG - Intronic
1090790859 11:130091225-130091247 CCGTGCGGGAGGGAGGTGGGGGG - Intronic
1090790983 11:130091499-130091521 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1091304567 11:134529436-134529458 CTGCACAGTGGGGTGGTGAGCGG - Intergenic
1091322523 11:134662096-134662118 CTGTGGAGTTCGGAGGTGGCTGG + Intergenic
1202816640 11_KI270721v1_random:49337-49359 CTGTGCACTGGGAATGGGGGTGG + Intergenic
1202824995 11_KI270721v1_random:85579-85601 CTGTGGTGTGGGGCTGTGGGGGG + Intergenic
1091388751 12:112279-112301 CTAAGGAGTGGGGAAGTGGGGGG + Intronic
1091446253 12:545752-545774 GTGAGGAGTGGGGAGGTGAGAGG + Intronic
1091446298 12:545901-545923 GTGAGGAGTGGGGAGGTGCGAGG + Intronic
1091446404 12:546254-546276 GTAAGGAGTGGGGAGGTGGGAGG + Intronic
1091583120 12:1800598-1800620 CAGGGCAGGTGGGAGGTGGGGGG - Intronic
1091658037 12:2360160-2360182 GTGTGGGGTGGGGGGGTGGGGGG - Intronic
1091774735 12:3177026-3177048 CGGGGGAGTGGGGAGGTGGTGGG + Intronic
1091775379 12:3181560-3181582 CTGTGCAGAGGGGAGGAGATTGG + Intronic
1091781221 12:3215702-3215724 CTGGGAAGTGTGGGGGTGGGAGG + Intronic
1092348767 12:7738954-7738976 TTGTGGGGTGGGGAGGGGGGAGG - Intronic
1092401953 12:8184584-8184606 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1092402002 12:8184711-8184733 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1092806556 12:12228767-12228789 CTGGGCAGTAGCGGGGTGGGTGG - Intronic
1092827581 12:12414115-12414137 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1092827780 12:12414565-12414587 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1093302822 12:17476291-17476313 CTGGGGTGTGGGGAGGGGGGAGG + Intergenic
1094044177 12:26148908-26148930 GTGTGCCGTGGGGAGGTTGGGGG - Intronic
1094103383 12:26785412-26785434 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1094103436 12:26785538-26785560 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1094153338 12:27310792-27310814 CTTTCCTGTGGGGAGGTGGGGGG + Intronic
1094492988 12:30972798-30972820 CTGCGCAGGGGGGAGGTGGGGGG + Intronic
1095068795 12:37815022-37815044 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1095380550 12:41585744-41585766 TTGGGCAGTGGGGGAGTGGGAGG - Intergenic
1095439516 12:42227779-42227801 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1095439590 12:42227955-42227977 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1095439613 12:42228004-42228026 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1096039286 12:48500359-48500381 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1096048216 12:48583014-48583036 TTGTGGGGTGGGGTGGTGGGAGG - Intergenic
1096082411 12:48842207-48842229 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1096121729 12:49093027-49093049 GTATGGAGTGGGGAGGTGGGGGG - Intronic
1096243193 12:49970305-49970327 TTGTGCAGTGGATAGGTGGCTGG + Intronic
1096325768 12:50659905-50659927 CAGAGATGTGGGGAGGTGGGTGG - Intronic
1096441193 12:51645187-51645209 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1096441244 12:51645314-51645336 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1096503811 12:52080818-52080840 CTGGGGAATGGGGAGGTGTGTGG + Intergenic
1097028486 12:56075791-56075813 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1097126967 12:56783548-56783570 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1097127799 12:56789087-56789109 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1097127919 12:56789363-56789385 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1097149169 12:56963785-56963807 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1097225802 12:57476229-57476251 GTGGGCTGTGAGGAGGTGGGAGG + Intronic
1097230375 12:57507489-57507511 CCATGCAGGAGGGAGGTGGGGGG - Intronic
1097384192 12:58930328-58930350 CTTTGCATTGCCGAGGTGGGAGG + Intergenic
1097396371 12:59079966-59079988 GTGTGCATTTGAGAGGTGGGTGG + Intergenic
1097461661 12:59871138-59871160 CTGTGCTGTGTGGGGTTGGGGGG - Intergenic
1097773364 12:63616524-63616546 CTGATCAGTGTGGAGATGGGAGG + Intronic
1098019061 12:66134988-66135010 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1098019133 12:66135164-66135186 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
1098359801 12:69643240-69643262 GTCTGCAGTGGGAAGGTGGCTGG - Intergenic
1098370868 12:69759613-69759635 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1098385132 12:69910392-69910414 TTGGGCAGTCGGGAGGTGGAGGG + Intronic
1098412756 12:70202275-70202297 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1098449430 12:70602653-70602675 ATGTGCAGTGGGGGAGTGGGTGG + Intronic
1098724953 12:73952149-73952171 TTGTGCAGTGGGGAGGAGCCTGG + Intergenic
1098791800 12:74833574-74833596 CTGAGGAATGGGGGGGTGGGAGG + Intergenic
1098805433 12:75016066-75016088 CTTTGCAGTGGGGAGGGGCCTGG - Intergenic
1098805985 12:75020541-75020563 CTTTGCAGTGGGGAGGAGCCTGG - Intergenic
1098884015 12:75942472-75942494 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1098925215 12:76342006-76342028 CTGAGCAGGTGGGAGGTGGGTGG + Intergenic
1099255225 12:80307443-80307465 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1099303603 12:80927859-80927881 CAGGCCTGTGGGGAGGTGGGGGG - Intronic
1099436502 12:82652575-82652597 CTGTGGGGTGGGGGGGAGGGGGG - Intergenic
1100013031 12:89976545-89976567 CTGTTTAATGGGGAGCTGGGGGG + Intergenic
1100405354 12:94267986-94268008 TTGTGTGCTGGGGAGGTGGGAGG + Intronic
1100570628 12:95841273-95841295 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1100582095 12:95947606-95947628 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1100582260 12:95947971-95947993 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1100582284 12:95948020-95948042 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1100826155 12:98476535-98476557 CTCTGGGGTGGGGAAGTGGGGGG - Intergenic
1100904279 12:99279563-99279585 CTGTGGGGTGGGGTGGGGGGAGG + Intronic
1100995117 12:100294576-100294598 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
1101676085 12:106917846-106917868 CTGGGCAGTGCGGAGGAGGAGGG + Intergenic
1101750763 12:107581038-107581060 CTGGGGAGTCGGGAGATGGGGGG + Intronic
1101764328 12:107684198-107684220 GTGGGCAGTGGGGGAGTGGGTGG + Intergenic
1101998881 12:109544369-109544391 TTGTGAAGTGGGGCGGGGGGCGG + Intergenic
1102018950 12:109668389-109668411 CTTTGCAGGGCCGAGGTGGGAGG - Intergenic
1102034944 12:109765737-109765759 CTGATCAGTGGGGAGGTAGCAGG + Intronic
1102044640 12:109822199-109822221 GTGGGCAGTGGGGAGGTGGGTGG + Intronic
1102089308 12:110172972-110172994 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
1102089382 12:110173148-110173170 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1102174769 12:110867356-110867378 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1102174921 12:110867708-110867730 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1102186184 12:110950676-110950698 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1102197906 12:111037187-111037209 CTGTGATGTGAGGAGGTGCGTGG + Intronic
1102382385 12:112478327-112478349 CTGTGGGGTGTTGAGGTGGGCGG + Intronic
1102544703 12:113646090-113646112 CTTTGCAGAGGGGATGCGGGAGG + Intergenic
1102620585 12:114191553-114191575 CAGAGCAGTGTGGATGTGGGTGG - Intergenic
1102682894 12:114702559-114702581 AAGTGCAGGGGCGAGGTGGGGGG + Intergenic
1103209793 12:119157781-119157803 CTGGGCAGAGGGGAGGGGGCTGG - Exonic
1103223614 12:119267518-119267540 CAGTGCAGTGGGGAAATGTGGGG + Intergenic
1103234404 12:119360170-119360192 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1103234501 12:119360395-119360417 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1103613460 12:122137890-122137912 CTGTGCTGTGGGGAGGAGGCAGG + Intronic
1103921817 12:124403169-124403191 CTGTAAAACGGGGAGGTGGGGGG + Intronic
1103987017 12:124774174-124774196 CTGTAGAGTGGAGGGGTGGGGGG - Intergenic
1104179852 12:126368743-126368765 CTGAGCAGTGAGAAGGTGTGAGG + Intergenic
1104549037 12:129739143-129739165 CGGTATAGTGAGGAGGTGGGTGG + Intronic
1104804023 12:131573691-131573713 CTGCTCAGTGGGGAGCCGGGGGG - Intergenic
1104943896 12:132407208-132407230 GCGTGCCCTGGGGAGGTGGGGGG - Intergenic
1105313825 13:19237893-19237915 CTGGGAAGTGGGGAGGGGGTTGG + Intergenic
1106095303 13:26638029-26638051 CCTTGCAGTGGGGAGGAGAGGGG + Intronic
1106495422 13:30270282-30270304 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1106918683 13:34540872-34540894 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1106918808 13:34541148-34541170 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1107103030 13:36614469-36614491 GTGTGCAGTGAGGATGGGGGAGG - Intergenic
1107146813 13:37069469-37069491 GGCTGCAGTGGGGAGGTGCGAGG + Intergenic
1107240015 13:38221587-38221609 CTGGCCCGTAGGGAGGTGGGGGG + Intergenic
1107493236 13:40900856-40900878 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1107493415 13:40901256-40901278 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1107546088 13:41434919-41434941 CAGTACGGTGGGGAGATGGGAGG - Intergenic
1107588804 13:41881734-41881756 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1107863488 13:44682542-44682564 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1107953266 13:45485286-45485308 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1108502083 13:51078223-51078245 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1108578212 13:51807220-51807242 CTGCGGAGTGGGGAGGAGGGTGG - Intergenic
1108608692 13:52064160-52064182 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1108925113 13:55732739-55732761 CTCTGCAGTGGGTGGGGGGGGGG + Intergenic
1109562831 13:64075773-64075795 CTGTGCTCTTGGGAGCTGGGAGG - Intergenic
1109840773 13:67914641-67914663 ATATCCAGGGGGGAGGTGGGGGG - Intergenic
1110269557 13:73575337-73575359 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1110269605 13:73575437-73575459 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1110281508 13:73699186-73699208 GATTGCAGTGGGGGGGTGGGGGG - Intronic
1110456663 13:75696841-75696863 CTGAGCCGAGGGGAGGTGTGGGG + Intronic
1110678773 13:78283322-78283344 TTGTGGAGGGGGGAGGGGGGAGG - Intergenic
1111051173 13:82884439-82884461 CAGTGCAGTGGGGAAATGTGAGG - Intergenic
1111418324 13:87976644-87976666 CAGTCCAGGAGGGAGGTGGGGGG - Intergenic
1111647054 13:91044591-91044613 CTTTACAGTGGGCAGATGGGCGG - Intergenic
1111928186 13:94485119-94485141 CTCTGCTGGGGGGCGGTGGGGGG + Intergenic
1111987346 13:95078512-95078534 CTTTGCACTGGGAAGGTGGCAGG + Intronic
1112192448 13:97191278-97191300 CTTTGCAGTGGGGAGGAGCCTGG + Intergenic
1112286136 13:98106079-98106101 GTGTGCAGTGGGGAGGAGCCTGG - Intergenic
1112433269 13:99372085-99372107 CTGTGCAGGCAGGCGGTGGGAGG + Intronic
1113446231 13:110369780-110369802 CTGTGCAATGGGGAGCTTTGGGG - Intronic
1113468933 13:110530787-110530809 CTGTGTAGAGGTGGGGTGGGTGG - Intronic
1113532298 13:111037163-111037185 CAGTGAGGTGGGGAAGTGGGGGG + Intergenic
1113794522 13:113049329-113049351 CTCTGCAGTGGGGAAGGGGTGGG + Intronic
1113892489 13:113743736-113743758 CTGTGCAGTGTCGTGGTGGCCGG - Intergenic
1114165190 14:20212748-20212770 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1114165215 14:20212799-20212821 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1114165265 14:20212900-20212922 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1114165288 14:20212950-20212972 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1114165313 14:20213001-20213023 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1114191579 14:20443206-20443228 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1114199330 14:20506649-20506671 CAGTCCAGGAGGGAGGTGGGGGG + Intronic
1114387169 14:22267446-22267468 CTTTGCAGTGGGGAGGAGCCAGG - Intergenic
1114427742 14:22637392-22637414 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1114427966 14:22637886-22637908 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1114522883 14:23349807-23349829 CTGTTCAGAGGAGATGTGGGAGG + Intronic
1114863271 14:26553901-26553923 CTTTGCAGGGCTGAGGTGGGCGG + Intronic
1115703279 14:35976779-35976801 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1115847577 14:37555521-37555543 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1115858753 14:37660378-37660400 CTGTCCAGGGGTGAGGTGTGGGG - Intronic
1116030074 14:39560822-39560844 TTGTGGGGTGGGGAGGGGGGAGG + Intergenic
1116191489 14:41673451-41673473 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1116191743 14:41674080-41674102 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1116191964 14:41674608-41674630 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1116809223 14:49523468-49523490 CTGGGCAGTGGGGAGGAGTAGGG - Intergenic
1117143113 14:52810009-52810031 GTCTGAAGTGGGGAGGTGGGGGG - Intergenic
1117733525 14:58747197-58747219 ATGAGCAGTGGGGAGGTCGTGGG + Intergenic
1117848882 14:59946648-59946670 GTGAGGAGTGGGGAGGGGGGAGG - Intronic
1117920150 14:60721138-60721160 CAGTGCCCTGGTGAGGTGGGAGG + Intronic
1118018319 14:61684387-61684409 CTATGGAATGTGGAGGTGGGGGG - Intergenic
1118184208 14:63522842-63522864 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1118341124 14:64895579-64895601 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1118423567 14:65633832-65633854 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1118517583 14:66545614-66545636 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1118517688 14:66545868-66545890 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1118730516 14:68662891-68662913 CAGAGCAGTGGGGAGGAGGATGG - Intronic
1119054352 14:71403987-71404009 CTGTGATGTGGGTGGGTGGGTGG - Intronic
1119242691 14:73074566-73074588 CTGTCTTGTGGGGAGGTGGGGGG + Intronic
1119254266 14:73184110-73184132 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1119326827 14:73764823-73764845 CTGGGGAGGGGGCAGGTGGGAGG - Intronic
1119437949 14:74610545-74610567 CTGGGCAGTGAGGGGCTGGGTGG - Intronic
1119594834 14:75924918-75924940 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1119617840 14:76110590-76110612 CTGTGAAGTGGGGAGTGGGCCGG + Intergenic
1119659475 14:76439964-76439986 CTGTGCATGGGGGAGCTGAGGGG - Intronic
1119700436 14:76750732-76750754 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1119704715 14:76776446-76776468 CTGCGGAGGGAGGAGGTGGGTGG + Intronic
1119710909 14:76821856-76821878 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1119711006 14:76822081-76822103 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
1119729665 14:76943009-76943031 CAGAGCAGTTGGAAGGTGGGAGG - Intergenic
1119844992 14:77822591-77822613 CTTTGCGGGGGTGAGGTGGGAGG - Intronic
1119947547 14:78710804-78710826 CTTTGCAGAGGGCAGATGGGTGG + Intronic
1120193758 14:81462479-81462501 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1120279373 14:82419893-82419915 CTCTGCATGGGGGAAGTGGGTGG + Intergenic
1120892893 14:89506054-89506076 CCGTCCAGAAGGGAGGTGGGGGG + Intronic
1121001831 14:90456648-90456670 CTGTGCAGTGGGGAGGTGGGAGG - Intergenic
1121016045 14:90549645-90549667 CAGTGGAGTGTGGAGGTTGGGGG + Intronic
1121245918 14:92460770-92460792 CTGATAAGTGGGGAGGTGGGAGG + Intronic
1121517956 14:94566033-94566055 ATGTGCAGTGAGGTGGTGGCAGG - Intronic
1121752089 14:96365458-96365480 CTGGGCAGTTTGGGGGTGGGGGG + Intronic
1121794737 14:96725514-96725536 CTGTGGGCTGGGAAGGTGGGAGG - Intergenic
1121972047 14:98367257-98367279 CAGTACAGTTGGGAGCTGGGGGG + Intergenic
1122056016 14:99098898-99098920 CTGTGCCGTGGGGGAGTCGGGGG - Intergenic
1122148175 14:99706538-99706560 CTGTGCAGAGTGAAGGTGGGTGG - Intronic
1122358092 14:101136340-101136362 CTGTGCAGGTGGGGGCTGGGAGG - Intergenic
1122517995 14:102321981-102322003 CTGTGGGGTGGGGAAGAGGGAGG - Intronic
1122568127 14:102676472-102676494 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1122568297 14:102676861-102676883 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1122606215 14:102948623-102948645 CTGTGGAGAGGGGGAGTGGGGGG + Intronic
1122879468 14:104683599-104683621 GTGTGTGGTGGGGAGGGGGGCGG - Intergenic
1122912309 14:104836848-104836870 CGGTGCAGGGGGGGGGGGGGGGG - Intergenic
1123114913 14:105890273-105890295 GTGTGCAGATGGGGGGTGGGGGG + Intergenic
1202917639 14_GL000194v1_random:190837-190859 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1123966870 15:25468129-25468151 CTGATCAGTGGTGAGGTGGCTGG + Intergenic
1124024985 15:25957753-25957775 CTGCGCAGGGGGCAGGTGTGGGG - Intergenic
1124839748 15:33230570-33230592 CAGTGCAGTGAAGGGGTGGGGGG - Intergenic
1125016859 15:34946464-34946486 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1125079399 15:35656574-35656596 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1125131839 15:36290925-36290947 CTGTCGGGAGGGGAGGTGGGGGG + Intergenic
1125254195 15:37744687-37744709 CTGAGCAGTGCGGAGGAGGATGG - Intergenic
1125306666 15:38325079-38325101 CAGCACTGTGGGGAGGTGGGTGG - Intronic
1125313798 15:38409535-38409557 CTATGGAGTGGGGGGGGGGGGGG - Intergenic
1125651512 15:41321184-41321206 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1125743226 15:41982052-41982074 AAGTGCAGTGGGGAGCTGGTTGG - Exonic
1126203865 15:46020044-46020066 CAGTGCAGTGGGGAAGTGTGAGG + Intergenic
1126295711 15:47133311-47133333 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1126517020 15:49550065-49550087 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1126517067 15:49550164-49550186 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1126571622 15:50158420-50158442 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1126649592 15:50908094-50908116 CTGGGATTTGGGGAGGTGGGCGG - Intergenic
1126691928 15:51294614-51294636 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1126751899 15:51885919-51885941 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1127073060 15:55303242-55303264 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1127465650 15:59241975-59241997 CTGTGATGTGGGAAGCTGGGAGG + Intronic
1127644730 15:60947094-60947116 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1127782919 15:62332387-62332409 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1127826536 15:62708805-62708827 CTGTGCTGTGGGTGGGTGGATGG + Intronic
1127874328 15:63099087-63099109 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1128311635 15:66634595-66634617 CTGTGCAGTGGTTAGGTTGCAGG + Intronic
1128344618 15:66845558-66845580 CCGCACAGTGGGGGGGTGGGCGG + Intergenic
1128597318 15:68964359-68964381 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1128704568 15:69829197-69829219 GTGGGAAGTGGGGAGGAGGGAGG - Intergenic
1129270042 15:74414766-74414788 CAGGTCAGTGGGGTGGTGGGAGG + Intronic
1129301292 15:74627082-74627104 CTCTGCAGAGGAGAGGTGGAGGG + Intronic
1129313842 15:74729179-74729201 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1129318668 15:74761797-74761819 CAGTGCAATGGGGCGGAGGGGGG + Intergenic
1129386819 15:75201036-75201058 GTGTGCAGTGGGGAAGGGGAGGG - Intronic
1129431763 15:75504672-75504694 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1129661390 15:77554846-77554868 CGGGGCAGTGGGGAGGGAGGAGG + Intergenic
1129675943 15:77632523-77632545 CTCGGGAGTGGGGAGGCGGGAGG + Intronic
1129755188 15:78093838-78093860 GGCTGCAGTGGGGAGTTGGGGGG + Intronic
1130139986 15:81216837-81216859 GTATGCAGTGGAGAGGAGGGAGG - Intronic
1130275991 15:82476606-82476628 CTGTGCAGTGGGGTTGTCGTGGG + Intergenic
1130371399 15:83287708-83287730 GGGGGAAGTGGGGAGGTGGGGGG + Intergenic
1130468352 15:84203998-84204020 CTGTGCAGTGGGGTTGTCGTGGG + Intergenic
1130495914 15:84469544-84469566 CTGTGCAGTGGGGTTGTCGTGGG - Intergenic
1130590645 15:85208596-85208618 CTGTGCAGTGGGGTTGTCGTGGG + Intergenic
1130770089 15:86915642-86915664 TGGTGCAGTGGGGCGGTGGGGGG - Intronic
1131127408 15:89868373-89868395 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1131188727 15:90295625-90295647 CTGTGCAGTGGGGTTGTCGTGGG - Intronic
1131320391 15:91384323-91384345 CTTTGCTGTAGAGAGGTGGGTGG + Intergenic
1131814299 15:96206419-96206441 TTGTGGAGTGGGGGGGAGGGGGG + Intergenic
1131885082 15:96903768-96903790 CTTTGCAGTGGGGAGGAGCCTGG + Intergenic
1132161027 15:99542881-99542903 CTGTGGAGAGGGGAGGAGTGGGG + Intergenic
1132275919 15:100563868-100563890 CTGTACCATGGGGTGGTGGGTGG - Intronic
1132598004 16:761997-762019 CTGTGGGGTGGGGAAGTGGGTGG - Intronic
1132682004 16:1146265-1146287 CTGTGGAGTGGGAAGGAGGAGGG - Intergenic
1132744339 16:1430480-1430502 CTGAGCTCTGGGCAGGTGGGCGG + Intergenic
1132776996 16:1599811-1599833 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1132804753 16:1770211-1770233 CTGAGCAGTGGGGCGGCTGGGGG + Exonic
1132819731 16:1858463-1858485 CCGAGCAGTGGGGAGGAGGTGGG - Intronic
1133924583 16:10182592-10182614 TTGGGAAGGGGGGAGGTGGGAGG - Intronic
1134471819 16:14532764-14532786 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1134471868 16:14532862-14532884 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1135235901 16:20755777-20755799 CTGTGGGGTGGGGGGGGGGGAGG - Intronic
1135257842 16:20955541-20955563 CTGTGGGATGGTGAGGTGGGAGG - Intronic
1135504111 16:23021547-23021569 CTGTGCTGCTGGGAGGTGAGCGG + Intergenic
1135658234 16:24270573-24270595 CTGAGCAGTTGGGAGATGGCAGG + Intronic
1136370107 16:29830911-29830933 CTGTGCAGTAGTGACGTGGGGGG - Exonic
1136402019 16:30024374-30024396 CTGGGAAGGGAGGAGGTGGGGGG - Exonic
1136525330 16:30825958-30825980 ATTTGCAGTGGAGAGGTAGGTGG - Intergenic
1136572206 16:31104612-31104634 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1136751268 16:32637941-32637963 CTGGGCAGTGGGTAGGTGAAGGG + Intergenic
1136765443 16:32772732-32772754 GTGGGCGGGGGGGAGGTGGGAGG + Intergenic
1136802656 16:33097647-33097669 GTGGGCGGGGGGGAGGTGGGAGG - Intergenic
1137240772 16:46653338-46653360 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1137592357 16:49701448-49701470 ATGTGCAGAGGGGAGGTGAGAGG + Intronic
1137628914 16:49928346-49928368 GTGTGGAGTGGGGATGTGGAGGG - Intergenic
1137731700 16:50694540-50694562 CTCTGCACTGGGTAGGAGGGAGG - Intronic
1138102888 16:54268661-54268683 CTGGGCAGAGGAGAGCTGGGTGG + Intronic
1138194664 16:55043458-55043480 TTGTGCAGTGGGGTGGCTGGTGG + Intergenic
1138324594 16:56153753-56153775 CTAAACAGTGGGCAGGTGGGAGG - Intergenic
1138453363 16:57106682-57106704 CTGTGAAGTGAGGAGGGGGTAGG + Intronic
1138642128 16:58395966-58395988 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1138642570 16:58397022-58397044 CTGTCCGGAAGGGAGGTGGGGGG - Intronic
1138664454 16:58553027-58553049 CTTTGCAGGGCGGAGGTGGGCGG + Intronic
1138903388 16:61301444-61301466 CTTTGGAATGGGGTGGTGGGTGG + Intergenic
1139394809 16:66631196-66631218 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1139394832 16:66631244-66631266 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1139396405 16:66643162-66643184 CTTTGCAGGGCTGAGGTGGGTGG - Intronic
1139576657 16:67846602-67846624 CTGTGCACTGGGGTGGGGGTTGG - Intronic
1139582888 16:67883765-67883787 CTGGGGAGTGGGGCAGTGGGAGG + Intronic
1139639221 16:68278940-68278962 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1139864255 16:70051264-70051286 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1139864457 16:70051712-70051734 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1139864562 16:70051966-70051988 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1139885688 16:70205310-70205332 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1139946840 16:70647627-70647649 CTCTGCAGTGGGCACGTGGGAGG - Intronic
1139953558 16:70683073-70683095 CTCTGGAGTGGGGAGGTGAGGGG + Intronic
1140031210 16:71340696-71340718 CTGAGCAGACAGGAGGTGGGAGG - Intergenic
1140407653 16:74721727-74721749 CTGTGAAGTAGGAAGCTGGGTGG - Intronic
1140479221 16:75253475-75253497 CGGTGCAGAGAGGAGGTGGATGG + Intronic
1140670385 16:77271914-77271936 CATTGCAGAGGGGAGATGGGTGG + Intronic
1140822679 16:78678097-78678119 CTCTCCAGTGGGGAGGGGGAGGG - Intronic
1141035212 16:80620321-80620343 CTCAGCAGTGGGGAGGTTGATGG - Intronic
1141236662 16:82224625-82224647 CTGGAGGGTGGGGAGGTGGGTGG + Intergenic
1141251648 16:82364088-82364110 GTGTGGAGTGGGAGGGTGGGGGG + Intergenic
1141311210 16:82914955-82914977 CTGTTAAGTGTGGAGGAGGGAGG - Intronic
1141330719 16:83108522-83108544 CTTTGCAGTGGGGAGGAGCCTGG - Intronic
1141410346 16:83828803-83828825 CTGAGGAGTGGGGAGGATGGTGG - Intergenic
1141528574 16:84629640-84629662 GTCTGCGGTGGGGAGGTGGAGGG - Intergenic
1141586008 16:85034031-85034053 ATGTGCTGTGGCGAGGTTGGAGG - Intronic
1141599608 16:85117531-85117553 CTCTGCAGATGGGTGGTGGGAGG - Intergenic
1141762611 16:86038676-86038698 CTGTGCCATGGGGAGGAGGAAGG + Intergenic
1142072390 16:88098425-88098447 CTAGGCAGTGGAGAGCTGGGCGG - Intronic
1142160494 16:88554966-88554988 ATGGGCAGTGGGCAGCTGGGAGG + Intergenic
1142284779 16:89167315-89167337 CTGAGCACTGGGAAGGTGGGGGG - Intergenic
1142352409 16:89586304-89586326 CTGGGCACAGGGGTGGTGGGAGG + Intronic
1203053402 16_KI270728v1_random:897196-897218 CTGGGCAGTGGGTAGGTGAAGGG + Intergenic
1142690885 17:1605580-1605602 CTGCGGAGCTGGGAGGTGGGTGG + Intronic
1142818636 17:2447560-2447582 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1142818884 17:2448103-2448125 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1142825515 17:2507486-2507508 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1142913112 17:3112520-3112542 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1142950937 17:3479585-3479607 TGGTGCAGTGGGAAGGTGGAAGG - Intronic
1142978452 17:3658511-3658533 CTCTGGAGAGGTGAGGTGGGAGG + Intronic
1143021513 17:3919239-3919261 CTGTGCAGCGTGGAGGCTGGAGG + Intergenic
1143117162 17:4587590-4587612 CTGTGTAGTGGGGGTCTGGGTGG + Intronic
1143158511 17:4853678-4853700 CTGGGCAGTTGGGTGGTGGTAGG + Intronic
1143598168 17:7928152-7928174 GTGTGCAGTGAGGGGCTGGGAGG + Intronic
1143871152 17:9958103-9958125 CTGTCAAGTGGGGAAATGGGGGG - Intronic
1144261655 17:13527553-13527575 TTGTGCTGTGGGGAGCAGGGGGG - Intronic
1144724200 17:17493469-17493491 TTTTGGAGGGGGGAGGTGGGGGG + Intergenic
1145174255 17:20685449-20685471 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1145206058 17:20985100-20985122 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1145757504 17:27403436-27403458 TTATGCTCTGGGGAGGTGGGAGG - Intergenic
1145781210 17:27564743-27564765 CTGTGGGTGGGGGAGGTGGGGGG - Intronic
1145862931 17:28224136-28224158 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1145863054 17:28224410-28224432 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1145896181 17:28459075-28459097 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1145977663 17:28993581-28993603 CAGTGCAGTGGTGAAGTTGGGGG + Intronic
1146095982 17:29930409-29930431 CTGTGGAGTGGGGTGGGGGAAGG + Intronic
1146731256 17:35195154-35195176 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1147167571 17:38601591-38601613 CTGTGGTGTGGGGAGGGGGATGG + Intronic
1147172843 17:38631502-38631524 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1147172894 17:38631629-38631651 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1147278454 17:39337804-39337826 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1147314236 17:39611974-39611996 GTGTGTGGAGGGGAGGTGGGAGG + Intergenic
1147652561 17:42070898-42070920 GAGGGCAGTGGGGAGGTGGCAGG - Intergenic
1147671892 17:42181143-42181165 CTGGCCCGTGGGGAGGTGGGGGG - Exonic
1147673590 17:42190669-42190691 CCGGGCAGTGGGGCAGTGGGCGG - Exonic
1147852249 17:43452101-43452123 CCGTCCAGGAGGGAGGTGGGCGG + Intergenic
1147963547 17:44181038-44181060 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1147963570 17:44181086-44181108 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1147963594 17:44181135-44181157 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1147963617 17:44181183-44181205 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1148209796 17:45801200-45801222 ATGGGCAGTGGGGAGGAAGGTGG - Intronic
1148244266 17:46020298-46020320 CTGTGCAGTGAGGGTGTGTGTGG + Intronic
1148524090 17:48313139-48313161 CGGGGCGGTGGGGGGGTGGGAGG + Intronic
1149208664 17:54278517-54278539 TTCAGCAGTGGGGAGCTGGGAGG - Intergenic
1149243686 17:54680571-54680593 CGTTGCAGTGGGTGGGTGGGCGG - Intergenic
1149499606 17:57142177-57142199 CTGTGGGGTGGGGAGATGGGGGG - Intergenic
1149596748 17:57868702-57868724 CTGTGTGGCGGGGAGGTGAGGGG + Intronic
1149793714 17:59500509-59500531 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1149909051 17:60551780-60551802 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1149909123 17:60551956-60551978 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1150004630 17:61462337-61462359 GTGTGCCGTGGGGAGGGCGGGGG + Intronic
1150056435 17:62021323-62021345 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1150213987 17:63456764-63456786 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1150299981 17:64039805-64039827 CAGTACACAGGGGAGGTGGGGGG + Exonic
1150512542 17:65771911-65771933 CTTGGGAGTTGGGAGGTGGGAGG + Intronic
1150643811 17:66965842-66965864 CTGTGCGGTGGGGTGGTAAGGGG + Intronic
1151322440 17:73360001-73360023 CTGAGAGGTGGGGAGGTGGGAGG - Intronic
1151694202 17:75705729-75705751 ATGTGAGGTGGGGCGGTGGGCGG + Intronic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1151979430 17:77499782-77499804 CTCTGAGCTGGGGAGGTGGGAGG + Exonic
1151997566 17:77619556-77619578 ATGTGCAGTGGGGAGGAGCCTGG + Intergenic
1152020176 17:77776602-77776624 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1152045312 17:77931275-77931297 GTGTGCAGTGTGGATGTGTGTGG - Intergenic
1152112694 17:78365967-78365989 GCGGGCAGTGGGTAGGTGGGTGG - Intergenic
1152129182 17:78465791-78465813 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1152370837 17:79887620-79887642 CTGCGGGGTGCGGAGGTGGGTGG + Intergenic
1152412649 17:80136510-80136532 CTGTGCAGAGGGGCTGTTGGTGG + Intronic
1152420151 17:80188354-80188376 CTGTGCGGTGGGGAGGCGACAGG - Intronic
1152610603 17:81313474-81313496 CTCTGCAGGAGGGAGGTCGGAGG - Exonic
1152676216 17:81642609-81642631 CTGCGCAGTGGGGAAGGGGGAGG - Intronic
1152696138 17:81797878-81797900 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1152769610 17:82159108-82159130 CTTTGGAATGGTGAGGTGGGAGG - Intronic
1152892800 17:82892024-82892046 CTGTGCAGGGGGGAAGTGGGGGG - Intronic
1153326521 18:3826395-3826417 CTGTGTGGAGGAGAGGTGGGTGG + Intronic
1153507690 18:5818818-5818840 GTGGGGGGTGGGGAGGTGGGGGG + Intergenic
1153646672 18:7202216-7202238 CAGGGCAGAGGGGAGGTTGGAGG + Intergenic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1154107383 18:11534272-11534294 CTGGGCAGTGGCCAGGTGGTAGG + Intergenic
1154278251 18:12980038-12980060 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1154278277 18:12980089-12980111 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1154492373 18:14931998-14932020 CAGAGCAGGAGGGAGGTGGGAGG - Intergenic
1154525692 18:15287835-15287857 CTGTCCACTGGTGAGCTGGGTGG + Intergenic
1154962877 18:21327709-21327731 TGGTGGGGTGGGGAGGTGGGGGG + Intronic
1155169846 18:23259318-23259340 CTGGGGAGTGGGGTGGGGGGAGG + Exonic
1155267075 18:24104498-24104520 CTGGGCAGGGATGAGGTGGGTGG - Intronic
1155364572 18:25036825-25036847 CTGTGGTGTGGGGAGGTGGCAGG + Intergenic
1156292405 18:35759456-35759478 CTGGGGAGGGGGGAGGGGGGAGG + Intergenic
1156457607 18:37303572-37303594 CTGGGCAGAGGTGAGGCGGGTGG + Intronic
1156665483 18:39400684-39400706 TTGTGGGGTGGGGAGGGGGGAGG + Intergenic
1157452848 18:47801201-47801223 CCCTGCAGTGGGGGGGTTGGAGG - Intergenic
1157578431 18:48759175-48759197 CTGGGCAGTGGGGTCGGGGGTGG - Intronic
1157629427 18:49080595-49080617 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1157762778 18:50276414-50276436 CTGTGCTGTGGGGAGGAAGAGGG + Exonic
1157980436 18:52373569-52373591 CTGTACATTGTGGGGGTGGGTGG + Intronic
1158302351 18:56066067-56066089 CTTAGCATTGGGGAGGTGGAGGG + Intergenic
1158345353 18:56510810-56510832 CTTTGCAGTGCTGAGGTGAGAGG - Intergenic
1158459312 18:57633015-57633037 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1159105028 18:63995321-63995343 GAGTTCAGTGAGGAGGTGGGAGG + Intronic
1159357787 18:67358974-67358996 CAGTGCAGAGGGGAAATGGGGGG + Intergenic
1160506207 18:79427953-79427975 CTGTGCAGTGGGTGGCGGGGGGG + Intronic
1160534592 18:79585416-79585438 GGGTGCAGTGGGGAGGTGCAGGG - Intergenic
1160562897 18:79770711-79770733 CTCTGCTGTGAGGAGGAGGGAGG - Intergenic
1160577406 18:79864347-79864369 CTGGGCTGCGGGGAGGTGGGTGG + Intronic
1160687737 19:444516-444538 TAGTGCACGGGGGAGGTGGGGGG + Intronic
1160699487 19:498914-498936 CTGTGCTGTGGGGCGCTGGGAGG + Intronic
1160714568 19:570535-570557 CTGTCCAGCGGGGATGTGGGTGG + Intergenic
1160742232 19:692001-692023 CTCTGCAGGGAGGAGGTGGTGGG + Exonic
1160960436 19:1718481-1718503 GGGTGCAGTGGGGAGGGGGAGGG + Intergenic
1161026425 19:2039346-2039368 GTGAGCAGAGGGTAGGTGGGTGG - Exonic
1161026484 19:2039589-2039611 ATGTACAGAGGGGAGATGGGAGG + Exonic
1161076577 19:2288663-2288685 CTGGGCTGTGGGGAGGACGGAGG + Intronic
1161109446 19:2461214-2461236 CTTTGCAGGGCCGAGGTGGGCGG - Intergenic
1161123009 19:2540504-2540526 CTGTGCAGAGGGTGGGTGCGTGG + Intronic
1161176383 19:2844801-2844823 CTGTGCAGTGGGCTAGGGGGTGG - Intronic
1161200920 19:3014386-3014408 CTGTGCAGTGGAGAGGAGGTCGG + Intronic
1161245383 19:3249043-3249065 CTGTGTGGTGGGGAGGGGGTAGG - Intronic
1161349109 19:3782784-3782806 CTGGGCTGTGGGGAGGGGAGGGG + Intronic
1161366256 19:3881428-3881450 CTGTGGGGTGGGGAGGAAGGGGG + Intronic
1161389082 19:4011872-4011894 CTGTGGGGTGTGGAGGTGTGGGG + Intronic
1161473658 19:4473195-4473217 CTGCGCCGTGGGGATCTGGGGGG + Intronic
1161790292 19:6355732-6355754 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1161974054 19:7599257-7599279 GAGTGCAGTGGGTAGGTGGGTGG - Intronic
1161974100 19:7599424-7599446 GAGTGCAGTGGGTAGGTGGGTGG - Intronic
1161994491 19:7703929-7703951 CTGAGCATTGGAGAGGTGGCTGG - Intergenic
1162158533 19:8696032-8696054 CTGTGGAGGAGGGAGTTGGGAGG + Intergenic
1162163962 19:8739726-8739748 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1162332482 19:10038832-10038854 TTGGGCAGTGGCGGGGTGGGGGG - Intergenic
1162735943 19:12747176-12747198 ATCTGCAGGGGGGATGTGGGAGG - Exonic
1162781497 19:13009300-13009322 CTGGGCAGCGGGTGGGTGGGGGG + Intronic
1162809283 19:13154461-13154483 CTGGGCAGTGGGGAGGAGAGTGG + Exonic
1162856180 19:13470251-13470273 ATGTGCAGTGAGGAAGTGGCAGG - Intronic
1162887042 19:13703756-13703778 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1162925196 19:13927389-13927411 CTGGGCAGTAGGGAGGTCTGAGG - Intronic
1163363938 19:16865709-16865731 CCCTGCAGTGGGGAGGGGAGGGG - Intronic
1163434927 19:17289758-17289780 CTAAGCAGTGGCGAGGTGGGTGG - Intergenic
1163542333 19:17918627-17918649 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1163558478 19:18005770-18005792 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1163761082 19:19137224-19137246 CTGAGCTGTGGGGAGGTGGAGGG - Intronic
1163796710 19:19342181-19342203 CTGTGCTCTGAGGGGGTGGGAGG - Intronic
1163849808 19:19656510-19656532 CTGTGGACTGGGGAGCCGGGTGG - Intronic
1163905741 19:20149724-20149746 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1164034733 19:21443577-21443599 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1164066567 19:21721447-21721469 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1164105676 19:22106924-22106946 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1164105827 19:22107278-22107300 CTGTCCGGGTGGGAGGTGGGGGG - Intergenic
1164214701 19:23134457-23134479 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1164301241 19:23964354-23964376 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1164406788 19:27955685-27955707 TTGTGCAGTGGGGAGGAGCCTGG + Intergenic
1164443466 19:28297980-28298002 CAGGGCAATGGGGAGGGGGGAGG - Intergenic
1164587318 19:29484148-29484170 CTCTGCAGAGAGGAGGTGTGGGG + Intergenic
1164652463 19:29899556-29899578 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1164652647 19:29899962-29899984 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1164652854 19:29900416-29900438 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1164652983 19:29900719-29900741 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1164778869 19:30876396-30876418 CAGAGCAGTGGGGAGGAGTGAGG + Intergenic
1164930035 19:32168319-32168341 CTGGGCCGTGGTGAGGTAGGAGG - Intergenic
1165033084 19:33012418-33012440 CTTTGGGGTGTGGAGGTGGGCGG - Intronic
1165386819 19:35514658-35514680 CTGGGCAGGGGTGAGGCGGGGGG - Intergenic
1165391600 19:35542301-35542323 CTTTGCTGTGGGGAAGTGGCAGG - Exonic
1165403807 19:35618155-35618177 CTGTGCAGTGGGGATGGGCTTGG + Exonic
1165407511 19:35639790-35639812 CTGTGCAGTGGGAAGGGGGACGG + Intergenic
1165411587 19:35665701-35665723 CAGAGCAGTGGGGAGATGAGGGG - Intergenic
1165788695 19:38477875-38477897 CGGGGCTGGGGGGAGGTGGGAGG + Intronic
1166028155 19:40107817-40107839 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1166028372 19:40108318-40108340 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1166107289 19:40603729-40603751 CTGTGCGGAGGGGAGGGAGGAGG - Intronic
1166162589 19:40965401-40965423 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1166163015 19:40966397-40966419 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1166191823 19:41180768-41180790 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
1166259492 19:41627631-41627653 CTGTGGTGGAGGGAGGTGGGTGG + Intronic
1166339627 19:42129737-42129759 CTGTGGGGTGGGGAGGGGTGAGG - Intronic
1166347288 19:42174728-42174750 GTGTGCAGTGGGGGGCTGGTGGG - Intronic
1166347296 19:42174761-42174783 GTGTGCAGTGGGGGGCTGGTGGG - Intronic
1166417975 19:42610399-42610421 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1166499929 19:43332843-43332865 CTGTGGTGGAGGGAGGTGGGTGG + Intergenic
1166732822 19:45068315-45068337 TTGTGCGGGGGGGGGGTGGGGGG - Intronic
1166959296 19:46488239-46488261 CTTCGCGGTGGGGAGGTGGCGGG + Intronic
1166966481 19:46532151-46532173 CTGTGCAGTGGGAAGTAGGCGGG - Intronic
1167028953 19:46943916-46943938 CCTTGCCGTGGGGAGGAGGGTGG + Intronic
1167107919 19:47441441-47441463 CTGTGCAGGGGGTAAGGGGGAGG + Intronic
1167408362 19:49329537-49329559 CTTTGCAAGGGCGAGGTGGGAGG + Intergenic
1167703545 19:51065255-51065277 GGGTGCAGTGGCGAGGTGGGAGG + Intergenic
1167720441 19:51176268-51176290 CAGGACAGTGGGGAGGTGGCTGG - Intergenic
1167776986 19:51564869-51564891 CCCTGCTGTGGGGAGGTGAGGGG - Intergenic
1167959522 19:53095042-53095064 CTGGGCAGTGGGGAAGGGGTGGG - Intronic
1167959570 19:53095163-53095185 CTGGGCAGTGGGGAGGGGGCGGG - Intronic
1167970653 19:53186887-53186909 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1167970901 19:53187430-53187452 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1168102753 19:54149663-54149685 CTGGGCGTTGGGGAGCTGGGAGG - Exonic
1168157502 19:54484188-54484210 CATTGCACTGGGCAGGTGGGGGG + Intergenic
1168226479 19:54999021-54999043 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1168308552 19:55449855-55449877 CTGGGCAGGGGGCTGGTGGGGGG - Intergenic
1168405475 19:56108237-56108259 CTGGGCAGGGGCGAGGTGGAGGG - Intronic
1168584676 19:57583257-57583279 CAGGGCAGTAGGGAGGTAGGCGG - Intronic
1168602029 19:57726104-57726126 GGGTGGGGTGGGGAGGTGGGAGG - Intronic
1168658331 19:58147403-58147425 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1168658430 19:58147627-58147649 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1168677897 19:58292044-58292066 GCTTGCAGTGGGGAGGAGGGTGG + Intronic
1168695958 19:58404872-58404894 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1168696009 19:58404999-58405021 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1168696106 19:58405224-58405246 CTGTCCGGAAGGGAGGTGGGGGG - Intronic
1202715065 1_KI270714v1_random:37869-37891 CTGTGCGGTGGGAGGGAGGGAGG - Intergenic
925128227 2:1476845-1476867 CAGGCCAGGGGGGAGGTGGGGGG + Intronic
925295026 2:2770443-2770465 CTGTGCAGTGAGGATCGGGGCGG - Intergenic
925303720 2:2834954-2834976 CTTGGCCTTGGGGAGGTGGGTGG + Intergenic
925403553 2:3591262-3591284 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
925412501 2:3648022-3648044 TGGTGCAGTGGGCAGGTGTGGGG + Intergenic
925861783 2:8184552-8184574 GTGTGGTGTGGGGAGTTGGGAGG + Intergenic
925925523 2:8667439-8667461 GTGTACAGTGGGGTGGTGTGGGG - Intergenic
926006529 2:9377350-9377372 CTGAGCAGTAGGGAGGTAGCAGG + Intronic
926252739 2:11165164-11165186 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
926328035 2:11802274-11802296 TTGTTTAGTGGGGAGCTGGGAGG - Intronic
926430526 2:12780685-12780707 TTGTGGGGTGGGGAGGGGGGAGG + Intergenic
926639546 2:15220086-15220108 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
926675019 2:15612144-15612166 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
926683302 2:15680172-15680194 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
926982198 2:18584434-18584456 CTGCGCAGTGGAGAGGAGGGCGG + Intronic
927198251 2:20562933-20562955 CTGGGGAGCGGGGAGGTTGGTGG - Intronic
927670656 2:25066110-25066132 GTGTGACGTGGGGAGGTGGGGGG - Intronic
927747333 2:25634219-25634241 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
927757796 2:25723259-25723281 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
927833264 2:26370983-26371005 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
927882529 2:26698726-26698748 CTGAGGAGCGGGGAGATGGGGGG - Intronic
928003149 2:27540402-27540424 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
928326923 2:30326623-30326645 TGGGGCAGTGGGAAGGTGGGTGG - Intergenic
928363571 2:30684947-30684969 CTGGGGAGTGGGGAGGGGGAAGG + Intergenic
928542094 2:32293997-32294019 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
928732904 2:34253380-34253402 GTTTGCAGTGGGGAGAAGGGAGG + Intergenic
929056786 2:37885204-37885226 CTATGCAGTGGGGATGGGGTGGG - Intergenic
929064980 2:37963946-37963968 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
929151877 2:38755889-38755911 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
929314832 2:40464670-40464692 CTGAGAAGTGGGGATGTGGTGGG + Intronic
929347158 2:40898230-40898252 TGGTGGGGTGGGGAGGTGGGGGG + Intergenic
929441899 2:41971362-41971384 CTGGGCAGAGGGGTGGTGCGGGG - Intergenic
929461641 2:42106196-42106218 CTCTGGGGTGGGGAGGAGGGTGG + Intergenic
929469996 2:42182300-42182322 CAGTGGAGGGGGGAGGGGGGAGG - Intronic
929484522 2:42342003-42342025 CTAAGCAGGGGGCAGGTGGGAGG + Intronic
929516081 2:42605846-42605868 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
929569859 2:43015693-43015715 CAGTGCTGTGGGTAGGTGTGGGG - Intergenic
929572604 2:43032127-43032149 CTGTGCTGAGTGGAGGTGGGTGG - Intergenic
929739672 2:44588584-44588606 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
930002951 2:46873588-46873610 CTGTGCAATGGGGTGGTGGTGGG - Intergenic
930049843 2:47206480-47206502 CTGGGCAAGAGGGAGGTGGGTGG + Intergenic
930128986 2:47829002-47829024 ACTTGAAGTGGGGAGGTGGGAGG - Intronic
930201867 2:48556174-48556196 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
930201940 2:48556350-48556372 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
930202117 2:48556752-48556774 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
930202218 2:48556978-48557000 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
930665398 2:54095666-54095688 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
930703998 2:54486080-54486102 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
930727886 2:54699132-54699154 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
930821515 2:55651055-55651077 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
931783732 2:65601105-65601127 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
931938729 2:67228657-67228679 CTTTGCAGTGGGGAGGAGCTTGG - Intergenic
932367278 2:71161266-71161288 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
932427086 2:71644945-71644967 GTGTGCAGTGGGGGTGTGGCTGG + Intronic
932781909 2:74564284-74564306 CTGTGCAGTGCGGAGCTCTGAGG + Intronic
932807340 2:74795771-74795793 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
932904796 2:75738333-75738355 GTTTGCAGTGGGCGGGTGGGAGG - Intergenic
933123808 2:78577069-78577091 CTGTGGGGTGGGGAGAGGGGGGG + Intergenic
933243084 2:79944576-79944598 CAGTGCAGTGTGGAGCGGGGTGG + Intronic
933395722 2:81728506-81728528 ATGTGAACTTGGGAGGTGGGTGG + Intergenic
934085534 2:88506093-88506115 CTTTACACTGGGGAGGTGGGAGG + Intergenic
934309676 2:91851925-91851947 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
934309746 2:91852071-91852093 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
934309839 2:91852295-91852317 CTGTCCGGGAGGGAGGTGGGCGG + Intergenic
934762881 2:96866077-96866099 CTGTGTAGTGGGGTGGTTTGGGG - Intronic
934998509 2:98988903-98988925 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
935126075 2:100223991-100224013 CTGTGAAGTGGGCAGTTGGTGGG - Intergenic
935366160 2:102293103-102293125 CAGTGCAGTTGGCAGGTGGAGGG + Intergenic
935405870 2:102708288-102708310 CTCTGCTGTGGGGTGTTGGGGGG - Exonic
935544531 2:104386880-104386902 CTGGGCAGTGAGGAGGTGGCTGG - Intergenic
935630682 2:105210824-105210846 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
936546373 2:113394882-113394904 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
937274340 2:120674436-120674458 CTGTGCAGTGGGGACATCAGTGG - Intergenic
937318244 2:120945529-120945551 CTGGGCAGTGGGAAGCTGTGTGG + Intronic
937919417 2:127119665-127119687 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
938005866 2:127788202-127788224 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
938005889 2:127788252-127788274 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
938088694 2:128418340-128418362 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
938089109 2:128419307-128419329 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
938250601 2:129812933-129812955 CTGAGCAGAGGGGAGGTGAGAGG - Intergenic
938336844 2:130508682-130508704 CTGGGCTGGGAGGAGGTGGGAGG - Intronic
938352979 2:130611953-130611975 CTGGGCTGGGAGGAGGTGGGAGG + Intronic
938533864 2:132221303-132221325 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
938720734 2:134064328-134064350 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
938789006 2:134660125-134660147 CTATGAGGTGGGGAGGTAGGTGG + Intronic
938891192 2:135707012-135707034 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
938995731 2:136675492-136675514 GTGTGTAGTGGGGAGGGGGGTGG - Intergenic
939032801 2:137096437-137096459 CTGGGAAGTGGGGATGTGAGTGG - Intronic
939518464 2:143199787-143199809 GTGTCCATTGGGGAGGTGGATGG - Intronic
940004385 2:148997985-148998007 CTGTGCAGTGGGCAGGGCAGGGG + Intronic
940299182 2:152160587-152160609 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
940308003 2:152247127-152247149 CTGTGCAGGGGGTAGGGTGGGGG - Intergenic
940416840 2:153432712-153432734 CTGGGGGGTGGGGAGGTGGTTGG + Intergenic
940451355 2:153842119-153842141 CTGTGGGATGGGGAGGTGGGGGG + Intergenic
940643335 2:156368541-156368563 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
940643714 2:156369361-156369383 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
941023849 2:160438895-160438917 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
941025158 2:160449186-160449208 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
941149237 2:161893252-161893274 GTGTGCGGAGGGGAGGTGGAAGG + Intronic
941768807 2:169327166-169327188 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
941786777 2:169506112-169506134 CCGTCCAGGAGGGAGGTGGGGGG + Exonic
941914366 2:170800184-170800206 TCGTGGAGTTGGGAGGTGGGAGG - Intergenic
942012217 2:171774842-171774864 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
942096322 2:172538294-172538316 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
942458603 2:176154013-176154035 CTGTGCAGTGGGGAGAAAGTGGG + Intronic
942861504 2:180618540-180618562 CTTTGCAGGGCCGAGGTGGGTGG + Intergenic
942904361 2:181163220-181163242 CTGTGGAGGGCTGAGGTGGGTGG + Intergenic
943323648 2:186473505-186473527 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
943455662 2:188103645-188103667 CAGTGCAGTGGGGTGCTGGTAGG - Intergenic
944283448 2:197923085-197923107 CCGTCCGGTAGGGAGGTGGGGGG - Intronic
944532935 2:200683688-200683710 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
944598698 2:201283448-201283470 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
944732954 2:202535040-202535062 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
944797977 2:203207271-203207293 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
945048356 2:205801183-205801205 ATGGGGAGTGGGGTGGTGGGAGG + Intergenic
945688022 2:212996269-212996291 CTGTGCAGAGGGGTGGGGTGAGG + Intergenic
946183702 2:217964904-217964926 CCTTGCAGCGGGCAGGTGGGTGG - Intronic
946188941 2:217997004-217997026 AGGTGCAGTGGGGTGGCGGGTGG - Intronic
946318295 2:218931959-218931981 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
946704742 2:222447254-222447276 GTGAGAAGTAGGGAGGTGGGTGG - Intronic
946742722 2:222816675-222816697 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
946751397 2:222896979-222897001 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
947301054 2:228689044-228689066 CCAGGCAGTGGGGAGTTGGGAGG + Intergenic
947537323 2:230948347-230948369 CAGTGCGGTTGGGAGGTGTGTGG - Intronic
947611900 2:231530056-231530078 CTGTGCAGCGGGGGTGAGGGCGG - Intronic
947875231 2:233463255-233463277 GCGTGCAGTGAGGAGGTGAGTGG - Intronic
948251928 2:236536242-236536264 CTGGGCACTGAGGAGCTGGGGGG + Intergenic
948554653 2:238799831-238799853 CTGTGCTGTGTGCAGGTGTGAGG + Intergenic
948718483 2:239881397-239881419 CAGGGCAGTGGGCAGGAGGGAGG - Intergenic
948804905 2:240449317-240449339 CTTTGCAGCGTGGGGGTGGGGGG - Intronic
948888630 2:240896426-240896448 CTGGGCTGTGGGGAGGAGGGTGG - Intronic
948928778 2:241117053-241117075 CTGAGCTGTGAGGAGGTGTGAGG + Intronic
949062989 2:241972155-241972177 CTGTGGCCTGGGAAGGTGGGTGG + Intergenic
1168812933 20:717977-717999 CCGTGGAGTGGGGCGGGGGGTGG + Intergenic
1169028708 20:2391489-2391511 CTGAGCTGTGAGGGGGTGGGGGG + Intronic
1169077460 20:2770037-2770059 CTGGGTAGGGGGTAGGTGGGAGG - Intergenic
1169085791 20:2824173-2824195 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1169086140 20:2824974-2824996 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1169278909 20:4250762-4250784 CTGGGCAATGGGGAGGAGGGAGG - Intergenic
1169605757 20:7317000-7317022 CTTTGCAGTGGGGAGTTGCAAGG - Intergenic
1169659430 20:7961967-7961989 CTGGGCAGTGGGCATGTGGTGGG - Intergenic
1169700777 20:8444181-8444203 ATGTGGTGGGGGGAGGTGGGAGG - Intronic
1169885590 20:10394946-10394968 CCGTCCGGTAGGGAGGTGGGGGG - Intergenic
1169991887 20:11513407-11513429 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1170256461 20:14349595-14349617 GGAGGCAGTGGGGAGGTGGGTGG - Intronic
1170409899 20:16077751-16077773 AAGTGCAGTGGGGGGTTGGGAGG - Intergenic
1170574520 20:17652511-17652533 CTGTGCTGCGGGGATCTGGGAGG - Intronic
1170623095 20:18010609-18010631 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
1170930568 20:20766602-20766624 GTGAGCACTGGGTAGGTGGGTGG + Intergenic
1170940758 20:20846107-20846129 CTGGGCACTGGGCAGGTTGGTGG + Intergenic
1171233680 20:23507946-23507968 CTGGACAGTGTGGGGGTGGGGGG - Intergenic
1171388012 20:24783159-24783181 CTGGGCAGGGGGAAGGAGGGAGG - Intergenic
1171411752 20:24952597-24952619 CTGAGCACTGGGGTGTTGGGGGG - Intronic
1171534307 20:25872806-25872828 CTGTGCAGTAGGGAAATGTGGGG + Intergenic
1171861332 20:30405243-30405265 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1171861590 20:30405865-30405887 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1171861636 20:30405962-30405984 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1171951767 20:31427397-31427419 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1171951790 20:31427446-31427468 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1171956880 20:31470210-31470232 TTGTCCAGGAGGGAGGTGGGGGG - Intronic
1171957058 20:31470612-31470634 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1171957081 20:31470661-31470683 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1171957261 20:31471092-31471114 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
1171999233 20:31759305-31759327 CTCCTCAGTGGGGTGGTGGGAGG - Intronic
1172051452 20:32121985-32122007 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1172059262 20:32176626-32176648 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1172117166 20:32579896-32579918 GTGTGGGGTGGGGAGGAGGGAGG - Intronic
1172149588 20:32780470-32780492 CTGGGCAGTGGGGACTGGGGTGG + Intronic
1172209152 20:33185283-33185305 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1172279379 20:33699443-33699465 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1172279503 20:33699718-33699740 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1172279577 20:33699893-33699915 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1172337959 20:34132726-34132748 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1172349336 20:34229444-34229466 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1172349659 20:34230197-34230219 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1172379218 20:34474799-34474821 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1172402117 20:34659186-34659208 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1172574948 20:36001372-36001394 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1172638295 20:36424586-36424608 CTGTGCAGGGGGGTCCTGGGTGG + Intronic
1172717682 20:36976713-36976735 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1172721006 20:37000351-37000373 CCGTCCAGAAGGGAGGTGGGGGG + Intronic
1172721228 20:37000880-37000902 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1172728971 20:37069829-37069851 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1172881720 20:38204433-38204455 CTGGGGATAGGGGAGGTGGGAGG - Intergenic
1172907250 20:38378942-38378964 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1172957401 20:38770902-38770924 TGGTGGAGTGGGGAGGTGAGAGG + Intronic
1173025758 20:39305901-39305923 CTGTGCTGGGGGTGGGTGGGAGG + Intergenic
1173199720 20:40945592-40945614 CTAGGCACTGGGGAGGTGGTTGG - Intergenic
1173273065 20:41555240-41555262 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1173435452 20:43028382-43028404 CAGGGAAGTTGGGAGGTGGGAGG - Intronic
1173750286 20:45470574-45470596 CTGGGCTGGGAGGAGGTGGGAGG + Intronic
1173769506 20:45645782-45645804 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1173790934 20:45827357-45827379 CTGGGGAGCAGGGAGGTGGGAGG - Intronic
1174020459 20:47525569-47525591 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1174127243 20:48315611-48315633 GTGTGGGGTGGGGAGGTGGAGGG + Intergenic
1174246810 20:49188046-49188068 CGCCGCGGTGGGGAGGTGGGCGG - Intronic
1174344964 20:49922478-49922500 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1174394671 20:50239596-50239618 CTTTGCACTGGGGATGAGGGTGG + Intergenic
1174878309 20:54250519-54250541 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1174878385 20:54250696-54250718 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1175109121 20:56633809-56633831 CTGTATTGAGGGGAGGTGGGGGG + Intronic
1175337439 20:58205620-58205642 GTGGGGAGTGGGGACGTGGGAGG - Intergenic
1175337476 20:58205778-58205800 GTGGGGAGTGGGGACGTGGGAGG - Intergenic
1175353156 20:58340762-58340784 AAGTGCAGTGGTGAGTTGGGTGG + Intronic
1175423030 20:58847656-58847678 CTTTGCAGGGAGGAGGTGGGTGG - Intronic
1175469872 20:59219903-59219925 GGGTTCAGTGGGCAGGTGGGTGG + Intronic
1175608208 20:60328687-60328709 CTGTGAATTAGGGAGGTGGAGGG - Intergenic
1175654763 20:60760533-60760555 CTCTGTAGTGGGGAGGTGGGTGG - Intergenic
1175724910 20:61311018-61311040 CTGTGCAGTGGAGTGGGGTGGGG - Intronic
1175739993 20:61413499-61413521 CTGTAAACTGGGGAGGTGGTGGG + Intronic
1175840270 20:62022160-62022182 CTGTGCAGTCAGGAGGTGGGTGG + Intronic
1175950432 20:62580691-62580713 CTGTGGAGCAGGGAGGTGGGAGG + Intergenic
1176348188 21:5770441-5770463 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1176355002 21:5891025-5891047 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1176496639 21:7554014-7554036 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
1176542509 21:8168511-8168533 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1176561460 21:8351556-8351578 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1176966691 21:15219025-15219047 CAGTGCATTGGGGGGGTGGGTGG + Intergenic
1178034443 21:28564148-28564170 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1178294546 21:31398071-31398093 TGGTGCAGAGGGGAGGTTGGGGG - Intronic
1179590686 21:42405975-42405997 CTAGGCAGTGGGGGGGGGGGGGG + Intronic
1179993843 21:44964521-44964543 CTGGGCACTGGGGAGGTATGTGG - Intronic
1180026163 21:45163532-45163554 TGGTGCAGGGTGGAGGTGGGGGG - Intronic
1180144027 21:45909791-45909813 CTGGGCAGTGGGTGGGGGGGGGG - Intronic
1180172883 21:46069568-46069590 GTGTGCATTGTGGGGGTGGGGGG + Intergenic
1180829985 22:18900332-18900354 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1180961730 22:19765442-19765464 ACGTGCAGTGGGGTGGGGGGTGG - Intronic
1181167268 22:20990535-20990557 CTGGCCAGTGGGGTGGAGGGAGG + Intronic
1181288692 22:21773874-21773896 GGGTGCTGGGGGGAGGTGGGAGG + Intronic
1181356116 22:22297400-22297422 GTGGGCGGTGGGGGGGTGGGTGG - Intergenic
1181465145 22:23106918-23106940 GTGTGCAGTGTGGAGGGGGTGGG - Intronic
1181468334 22:23122721-23122743 ATGGGCAGTGGGAAGATGGGGGG + Intronic
1181586189 22:23854793-23854815 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1181657746 22:24317091-24317113 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1181688328 22:24544079-24544101 CTGTGCTGTGGGCGGGAGGGGGG + Exonic
1182311143 22:29408401-29408423 GTCTGGAGTGTGGAGGTGGGCGG - Intronic
1182399863 22:30066917-30066939 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1182512167 22:30827213-30827235 ATGTGAAGTGGGGAGTTGTGAGG + Intronic
1182708687 22:32306765-32306787 ATGTGCAGTAACGAGGTGGGGGG - Intergenic
1182976284 22:34626152-34626174 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1183218032 22:36493799-36493821 CTGTTCTGTGGGGAGGAGAGAGG + Exonic
1183330255 22:37216190-37216212 CTGTGGGATGGGGGGGTGGGAGG - Intergenic
1183467869 22:37988920-37988942 CTATGCACTGGGAAGGTGGAGGG + Intronic
1183595353 22:38807413-38807435 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1183596458 22:38815445-38815467 CGGTGGAGTGGGGGTGTGGGGGG + Intergenic
1183742957 22:39678584-39678606 CTCTGCAGGGTGGGGGTGGGAGG - Intronic
1183841134 22:40501332-40501354 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1183841209 22:40501508-40501530 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1183841283 22:40501684-40501706 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1183841332 22:40501811-40501833 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1183845435 22:40537398-40537420 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1183845509 22:40537574-40537596 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1183871650 22:40745413-40745435 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1183941030 22:41295009-41295031 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1183995631 22:41631097-41631119 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1184037498 22:41925704-41925726 CTGGCCAGTGGGGAGCTGGCAGG + Intronic
1184202821 22:42981758-42981780 CCGTCCAGGAGGGAGGTGGGTGG + Intronic
1184247373 22:43242472-43242494 CTGCCCGGTGGGGAGGTTGGGGG + Intronic
1184273479 22:43397759-43397781 TTGTGCAGGGGGCAGGTGGCAGG + Intergenic
1184347613 22:43923432-43923454 CTGTTAAGTCGGGGGGTGGGAGG - Intergenic
1184359391 22:44005673-44005695 CCATGCAGTGGAAAGGTGGGAGG - Intronic
1184502014 22:44880063-44880085 CTCTGAGATGGGGAGGTGGGAGG + Intergenic
1184516385 22:44965297-44965319 CTGTGCAGAGGGGAAGAGGCTGG - Intronic
1184998663 22:48228378-48228400 CTGGGCTGTGGGGAGGTCTGAGG + Intergenic
1185037365 22:48486486-48486508 CTGAGGAGTGGGGAGGCAGGGGG - Intergenic
1185055418 22:48576283-48576305 CTGGGCAGGGGGGAGGGGAGCGG - Intronic
1185336794 22:50274622-50274644 AGGTGCTGAGGGGAGGTGGGGGG - Intergenic
1185345263 22:50307958-50307980 CTGGGCAGGGGAGAAGTGGGGGG - Intergenic
1185377595 22:50489308-50489330 GCGGGCAGTGGGGCGGTGGGGGG + Intronic
1185389211 22:50549745-50549767 CAGTGCAGTGGGGCGGGGGCGGG - Exonic
1203247449 22_KI270733v1_random:84929-84951 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1203280076 22_KI270734v1_random:125603-125625 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
949241707 3:1880512-1880534 ATGAGGAGTGGGGAGGAGGGTGG - Intergenic
949509508 3:4755812-4755834 CTGTACAGTGTGGATGAGGGAGG + Intronic
949543618 3:5053654-5053676 ATGTGTGGTGGGGACGTGGGTGG + Intergenic
949841592 3:8325977-8325999 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
950533859 3:13568440-13568462 CAGCGCAGTGGGCAGCTGGGTGG + Intronic
950653846 3:14424523-14424545 CTGGGCAATGGGGAGGGGAGAGG + Intronic
950754618 3:15162666-15162688 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
950754706 3:15162845-15162867 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
950754822 3:15163119-15163141 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
950777333 3:15362032-15362054 CTGTGCAGCGGTGAGGAGGCTGG - Intergenic
951013351 3:17704831-17704853 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
951348446 3:21575264-21575286 CTGTGCAGGGTGGAGGTGGGAGG + Intronic
952875803 3:37943332-37943354 CTGAGAAGTGGGGAAATGGGGGG + Intronic
953652726 3:44821261-44821283 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
954080673 3:48211420-48211442 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
954081132 3:48212438-48212460 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
954109754 3:48427492-48427514 CTGAGAAGTTGGGAGTTGGGAGG - Intronic
954118983 3:48483821-48483843 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
954380347 3:50215857-50215879 CGGTGCAGTGAGGAGGGGTGGGG + Intronic
954452747 3:50580456-50580478 CTGACCAGAGGGGAGGTGGATGG + Exonic
954481255 3:50803749-50803771 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
954628783 3:52037121-52037143 CTGGGCTGGGGGAAGGTGGGAGG + Intergenic
954708542 3:52493833-52493855 CAGGGCTGTGGAGAGGTGGGTGG + Intergenic
954753980 3:52829084-52829106 GTGTGGAGAGGGGAGGAGGGTGG + Intronic
954906505 3:54067706-54067728 CTGTGAAGTGGAGGGGTGGCAGG + Intergenic
954910841 3:54106256-54106278 GTGTGCTGTGGGGAGTTGCGTGG + Intergenic
955007720 3:54985231-54985253 ATGTGCAGTGTAGGGGTGGGAGG + Intronic
955111778 3:55957716-55957738 AGCTGCAGTGGGGAGGAGGGGGG + Intronic
955130768 3:56165462-56165484 ATATGCAGGGGGGAGGGGGGAGG - Intronic
955297566 3:57747938-57747960 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
955574259 3:60342094-60342116 CTGTGCAGTGGGGAGGAGCCTGG - Intronic
956836115 3:73097325-73097347 CTGTGCAGTAGGGAAGGGGAAGG + Intergenic
956917751 3:73891033-73891055 CTGTGCAGACAGGAGATGGGAGG - Intergenic
957203218 3:77164469-77164491 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
957203240 3:77164518-77164540 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
957316667 3:78583215-78583237 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
957457617 3:80472674-80472696 CTGGGAGGTGGGGAGGTGGCTGG - Intergenic
957620230 3:82584866-82584888 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
957620272 3:82584960-82584982 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
957620291 3:82585007-82585029 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
958928867 3:100187953-100187975 CTCCACAGTGGGGGGGTGGGGGG - Intronic
959042883 3:101439931-101439953 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
959415136 3:106073579-106073601 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
960692664 3:120363187-120363209 GTGTGTGGTGGGGAGGAGGGCGG + Intergenic
960780482 3:121313445-121313467 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
960780903 3:121315482-121315504 TTGTGGGGTGGGGAGGGGGGAGG + Intronic
960862091 3:122164687-122164709 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
960862240 3:122165040-122165062 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
960862264 3:122165089-122165111 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
960924139 3:122780142-122780164 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
960924261 3:122780386-122780408 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
961043901 3:123695889-123695911 CTCTGCTGAGGGGTGGTGGGAGG - Intronic
961120705 3:124368146-124368168 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
961381454 3:126498701-126498723 CTGTGGGGTGCAGAGGTGGGAGG - Intronic
961386678 3:126526791-126526813 CTGGGCACTGGGGATGAGGGTGG - Intronic
961436401 3:126921391-126921413 CTGTGCTGCTGTGAGGTGGGTGG - Intronic
961962530 3:130868357-130868379 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
962112784 3:132470798-132470820 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
962112805 3:132470847-132470869 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
962169237 3:133083181-133083203 CTGAGGAGTGGGGCGGCGGGGGG - Intronic
962176754 3:133163306-133163328 CTGTCCAGTGGGGAAGAGGCAGG + Intronic
962245080 3:133785155-133785177 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
962407254 3:135110857-135110879 CAGGGCAGTGGTGGGGTGGGGGG + Intronic
962572221 3:136723590-136723612 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
962836905 3:139197717-139197739 TGCTGGAGTGGGGAGGTGGGAGG + Intronic
962853969 3:139328106-139328128 CTGCCTCGTGGGGAGGTGGGAGG + Intronic
963085715 3:141434386-141434408 GTGTGCACTGGGGGGGCGGGGGG + Intronic
963101088 3:141604755-141604777 CTGGGGTGTGGGGAGGGGGGAGG + Intronic
963147973 3:142014391-142014413 CAGTGCTTTGGCGAGGTGGGAGG - Intronic
963244614 3:143047453-143047475 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
963244742 3:143047757-143047779 CCGTTCAGGAGGGAGGTGGGAGG - Intronic
963300510 3:143592281-143592303 CTTTGCAGGGTGGAAGTGGGAGG + Intronic
963451213 3:145483045-145483067 CGGTCCAGGAGGGAGGTGGGGGG + Intergenic
963498558 3:146097110-146097132 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
963757901 3:149255340-149255362 TTCTGCAGTGTAGAGGTGGGAGG + Intergenic
963770092 3:149380117-149380139 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
963770353 3:149380759-149380781 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
963911214 3:150820164-150820186 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
964270987 3:154956659-154956681 CAGTGAAGTGGGGAAGTGGGTGG + Intergenic
964541331 3:157783018-157783040 CTGTGCAGAGTGGAGGGGGTGGG - Intergenic
964683724 3:159370810-159370832 CTGAAAACTGGGGAGGTGGGAGG - Intronic
966043848 3:175526631-175526653 CTGGCCAGAGGTGAGGTGGGGGG + Intronic
966783919 3:183608278-183608300 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
966863083 3:184241467-184241489 CTGAGGAGAGAGGAGGTGGGGGG - Intronic
966923121 3:184627356-184627378 GTCTGCAGTGTGGGGGTGGGGGG + Intronic
967546226 3:190732030-190732052 CTGTGCAGTGGGGAGAAGCCTGG - Intergenic
967592941 3:191299652-191299674 CAGTGCAGAGGGGAAGTGTGGGG + Intronic
967774127 3:193368746-193368768 CAGTGGGGTGGGGCGGTGGGGGG - Intronic
967896536 3:194400456-194400478 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
967962138 3:194933902-194933924 CTGTGAAGAGGGGAGCTGGGAGG + Intergenic
967981310 3:195066801-195066823 CTGTGCACTGGGGGGTTGGAAGG + Intergenic
968083389 3:195862893-195862915 CTCTGCACTGGGGAAGTGGACGG + Intergenic
968194477 3:196695165-196695187 CTGTGCGGTGTGCAGGTGTGCGG - Intronic
968292713 3:197551195-197551217 CTGTGCAGTGGGGAGAAGATGGG - Intronic
968316785 3:197731804-197731826 CTGTCCCGGAGGGAGGTGGGGGG - Intronic
968440952 4:624155-624177 CGGGGGAGTGGGGATGTGGGTGG - Intergenic
968445513 4:650354-650376 CTGGGCAGTGGGGACAGGGGGGG - Intronic
968647904 4:1749232-1749254 GGGCGCAGTGGGGAGGGGGGAGG - Intergenic
968667278 4:1828562-1828584 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
968667490 4:1829045-1829067 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
968726641 4:2250958-2250980 CAGTGCAGCAGGGAGCTGGGAGG + Intronic
968730879 4:2268703-2268725 TTGTGCAGGGGGGAGGGGAGAGG - Intergenic
968761546 4:2444851-2444873 CTGGTGAGTGGGGAGCTGGGAGG - Intronic
968936575 4:3614243-3614265 CTGGGCTGCAGGGAGGTGGGAGG - Intergenic
968957481 4:3726706-3726728 CAGGGCAGTGGGGCGGTGGGTGG - Intergenic
968990134 4:3905236-3905258 GAGTGCAGTGGGCAGATGGGAGG - Intergenic
969310052 4:6347795-6347817 CTGTGCATTGGGCAGGCGGGCGG - Intronic
969365949 4:6694363-6694385 CTGTGCAGTGGGGGCAGGGGCGG + Intronic
969486199 4:7473736-7473758 CTTGGCAATGGGGAGGTGGGAGG + Intronic
969719964 4:8888205-8888227 CTGTGGGGTGCGGAGGTGGAGGG - Intergenic
969844850 4:9912405-9912427 CTGTGCAGCTGGCAGGTGTGGGG + Intronic
969886360 4:10218988-10219010 CTGGGCTGTGGGGTGGTGAGTGG - Intergenic
969924781 4:10575598-10575620 CCCTGCACTGGGCAGGTGGGTGG + Intronic
970273848 4:14375901-14375923 GTGCGGAGTTGGGAGGTGGGGGG + Intergenic
970360931 4:15308274-15308296 CAGTGCAGTGGGGAAATGTGGGG - Intergenic
970471665 4:16385441-16385463 GAGTGCAGTGGGGAGGTAGTGGG + Intergenic
970472593 4:16393216-16393238 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
970976479 4:22048150-22048172 CTGTGCAGAGGGGAAATGTGGGG - Intergenic
971028010 4:22607557-22607579 CTGTGCAGTTGGCAGAGGGGAGG + Intergenic
972163525 4:36254538-36254560 GTGTGCTGTGAGGAGGAGGGCGG + Intergenic
972241451 4:37197830-37197852 CTGTGCAGTGGGGTTGGGAGGGG - Intergenic
972265443 4:37454557-37454579 CTGGGCAGTGGGTAGGGGTGGGG + Intronic
972426289 4:38936335-38936357 CTTTGCAGGGCCGAGGTGGGCGG - Intronic
972436720 4:39042502-39042524 CTGAGAAGTGAGGAGTTGGGGGG + Intergenic
972551740 4:40141224-40141246 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
972778550 4:42265851-42265873 CAGTGCAGTGGGGAGGCTGAAGG - Intergenic
973274483 4:48292755-48292777 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
973281299 4:48363575-48363597 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
973593715 4:52465587-52465609 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
973593871 4:52465944-52465966 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
973673051 4:53238311-53238333 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
973784930 4:54325429-54325451 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
973785001 4:54325576-54325598 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
973955460 4:56058952-56058974 CTGTGCATTGTGAAGGTTGGAGG + Intergenic
975685659 4:76917031-76917053 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
975686133 4:76918096-76918118 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
975716419 4:77209703-77209725 ATGTGCTGCGGGGTGGTGGGTGG + Intronic
976265274 4:83182720-83182742 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
976265764 4:83185680-83185702 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
976518315 4:85997098-85997120 CTCTGCAGTAGGGTGGAGGGTGG + Intronic
976617516 4:87093501-87093523 CTCTGGAGAGGGGAGGTAGGGGG + Intronic
976724511 4:88202610-88202632 CTTTGCAGTGGGGAGGAGCCTGG - Intronic
977151203 4:93514406-93514428 GTGTGTACTGTGGAGGTGGGGGG - Intronic
977177968 4:93838784-93838806 TTGTGGGGTGGGGAGGGGGGGGG + Intergenic
977619959 4:99125162-99125184 CTTTGCAGTTGGGTGGTAGGAGG + Intronic
977685643 4:99844255-99844277 CTTTGCAGTGGGGAGGAGCCTGG - Intronic
977786599 4:101042338-101042360 CAGGGCAGAGGGAAGGTGGGAGG - Intronic
978417375 4:108490773-108490795 CTGGGGAGGGTGGAGGTGGGTGG + Intergenic
978518999 4:109597689-109597711 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
978855027 4:113385192-113385214 CTGTGCGGTGGGGATGGAGGGGG + Intergenic
979622478 4:122812251-122812273 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
979622577 4:122812505-122812527 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
979948255 4:126860995-126861017 CTGTGGTGGGGGGAGGGGGGAGG - Intergenic
980056452 4:128083678-128083700 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
980895241 4:138854449-138854471 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
980895264 4:138854498-138854520 CAGTCCAGGAGGGAGGTGGGGGG + Intergenic
981191722 4:141872293-141872315 CAGTGCAGTGGGGAAGTGTGGGG - Intergenic
981770762 4:148304807-148304829 CTATGCAGTGGGGAGGAGTCTGG + Intronic
981970686 4:150660110-150660132 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
982040489 4:151391152-151391174 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
982224000 4:153149210-153149232 CTTTGCAGGGCTGAGGTGGGAGG - Intergenic
982607108 4:157528760-157528782 CAGTGCAGAGGGGATTTGGGGGG + Intergenic
982784306 4:159523515-159523537 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
982820651 4:159939221-159939243 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
982895169 4:160911446-160911468 GTCTGCAGTGGGGTGGTGGGGGG + Intergenic
983628805 4:169828587-169828609 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
983693632 4:170502354-170502376 GTGTGCATTTGGAAGGTGGGAGG + Intergenic
984105395 4:175539217-175539239 CTGAGCAGTTGGGGTGTGGGGGG + Intergenic
984512783 4:180699023-180699045 TTGTGCAGTGGGGAGGAGCCTGG + Intergenic
984832453 4:183988118-183988140 CTGTGCAGTGCGGAGACGCGAGG - Intronic
984977125 4:185240528-185240550 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
984983467 4:185304730-185304752 CTGTGCAGGGCTGAAGTGGGAGG - Intronic
985546879 5:514382-514404 CTCTGCAGAGGTGAGGAGGGAGG - Intronic
985559329 5:574572-574594 CTGGGGGCTGGGGAGGTGGGAGG - Intergenic
985569963 5:639451-639473 CTGTGCTCTGGGGTGTTGGGGGG + Intronic
985600683 5:828367-828389 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
985600703 5:828412-828434 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
985685057 5:1277589-1277611 CGCTGCAGCGGGGATGTGGGGGG + Intronic
985736485 5:1586311-1586333 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
986063285 5:4212031-4212053 CTATGGGGTGGGGGGGTGGGGGG - Intergenic
986102184 5:4623146-4623168 CCCTGGAGTGGGGAGGGGGGTGG + Intergenic
986136312 5:4982359-4982381 GTGTGCAGGGGGCAGGCGGGGGG + Intergenic
986151935 5:5137697-5137719 CAGTGCAGTGGGGAGCTGAAGGG - Intergenic
986200191 5:5572511-5572533 CTGTTCACTGGGGAGGGCGGGGG - Intergenic
986224655 5:5801502-5801524 CTGTGCAGTGGGATGGAGGCTGG + Intergenic
986255969 5:6101604-6101626 CCGTGCAGTGGGGAGGTCCATGG - Intergenic
986268215 5:6208784-6208806 ATGTGCAGAGGGGACATGGGAGG + Intergenic
986334199 5:6741020-6741042 AGGGGCAGCGGGGAGGTGGGTGG + Intronic
986974925 5:13382933-13382955 CTGTGTGGTGGGGGGGTGAGAGG - Intergenic
987061387 5:14247070-14247092 CTGAGCTGTGGGGAAGGGGGAGG - Intronic
987147732 5:15008794-15008816 CAGTGATGTGGGAAGGTGGGAGG + Intergenic
987233880 5:15923847-15923869 CTGTGCATGGGGGCGGAGGGGGG - Intronic
988240024 5:28596951-28596973 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
988240047 5:28597000-28597022 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
988544410 5:32142583-32142605 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
988544507 5:32142809-32142831 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
988636338 5:32988640-32988662 CTGTCTACTAGGGAGGTGGGGGG - Intergenic
989021365 5:37013048-37013070 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
989048545 5:37296036-37296058 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
989075768 5:37563181-37563203 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
989075818 5:37563307-37563329 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
989174538 5:38510373-38510395 TTCTGGAGTGGGGGGGTGGGAGG - Intronic
989211272 5:38861752-38861774 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
989247741 5:39273006-39273028 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
989568960 5:42927273-42927295 CCATGCAGTGGGGAGGCTGGGGG + Intergenic
989587937 5:43088177-43088199 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
989587988 5:43088304-43088326 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
989828901 5:45890794-45890816 CTGTCCAGGAAGGAGGTGGGGGG + Intergenic
989850234 5:46199275-46199297 TTGTGGAGTGGGGGGGAGGGGGG + Intergenic
990036735 5:51330927-51330949 CTGTGGTGGGGGGAGGAGGGGGG - Intergenic
990498647 5:56372835-56372857 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
991672608 5:69062995-69063017 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
992374078 5:76172096-76172118 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
992469835 5:77043139-77043161 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
992469909 5:77043315-77043337 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
992574553 5:78096995-78097017 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
992600202 5:78391414-78391436 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
992964021 5:81983241-81983263 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
993162821 5:84312515-84312537 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
993401788 5:87462355-87462377 CTGTGAAGTGGGTGGGTGTGGGG - Intergenic
993447163 5:88027521-88027543 CAGGGCAGTGGTTAGGTGGGTGG - Intergenic
993644206 5:90443161-90443183 GTGGGGAGTGGGGAGGGGGGAGG - Intergenic
993944165 5:94097840-94097862 CGGTGGGGTGGGGTGGTGGGGGG - Intronic
994505886 5:100642221-100642243 CTTTGCAGTGGGGAGGAGATGGG + Intergenic
995123475 5:108559010-108559032 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
995123578 5:108559264-108559286 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
995193686 5:109342310-109342332 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
997362601 5:133304848-133304870 CTGTGCACTGGGGTTCTGGGTGG - Intronic
997581208 5:135018576-135018598 CTGTGCTGTGGGGTGAGGGGTGG + Intergenic
997656834 5:135561448-135561470 CTGTGGGGTGGGGAAGTGGGGGG + Intergenic
997834312 5:137179904-137179926 GTGTGCAGTGGCAAGGTAGGAGG - Intronic
997874813 5:137537936-137537958 CCGTCCAGGTGGGAGGTGGGGGG - Intronic
997874957 5:137538288-137538310 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
997892357 5:137687271-137687293 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
997930777 5:138070402-138070424 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
997930854 5:138070578-138070600 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
997930905 5:138070704-138070726 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
997972939 5:138419166-138419188 CAGTGCAGGGCGGAGGAGGGTGG - Exonic
998003280 5:138640893-138640915 CTGAGGGGTGGGGAGGTGTGAGG + Intronic
998239456 5:140427779-140427801 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
998431935 5:142075943-142075965 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
998433101 5:142083561-142083583 CTTTGCGGGGGTGAGGTGGGCGG - Intergenic
998494137 5:142572376-142572398 GTGTGGTGTGGGGGGGTGGGAGG + Intergenic
999180998 5:149670317-149670339 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
999295775 5:150458778-150458800 CTGTGCTGAGGGGAGGGGGTGGG + Intergenic
999588170 5:153114512-153114534 GTGTGTAGTGGGGCGGTGAGGGG + Intergenic
999604131 5:153296880-153296902 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1000103390 5:158037136-158037158 CCGTCCAGCAGGGAGGTGGGGGG - Intergenic
1000280857 5:159780728-159780750 CTGTGCAGTGTGTGGGTAGGAGG - Intergenic
1000302846 5:159971858-159971880 GCCTGCAGTGGGGAGGGGGGTGG - Exonic
1000444867 5:161307126-161307148 CTGTGTAGTGGTGAGGAAGGAGG - Intronic
1000509609 5:162165104-162165126 CTGTGCTGTGCAGAGGTGGTGGG - Intergenic
1000985561 5:167859765-167859787 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1001012669 5:168112594-168112616 GTGTGCAGTGGGCGGGGGGGGGG + Intronic
1001077752 5:168643290-168643312 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1001393969 5:171403692-171403714 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1001541464 5:172542751-172542773 CTTTGCAGTGGGATGGTGAGTGG + Intergenic
1001823823 5:174730219-174730241 GTGTGTGGTGGGGCGGTGGGGGG - Exonic
1002073545 5:176694895-176694917 CAGAGCAGTGGGCTGGTGGGTGG + Intergenic
1002163903 5:177332924-177332946 CTGTACAGTGTGGAGTCGGGGGG - Intronic
1002501504 5:179650410-179650432 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1202772758 5_GL000208v1_random:26871-26893 GTGTGGTGGGGGGAGGTGGGAGG + Intergenic
1002791577 6:441367-441389 CTGAGCAGGGGTGAGGTGGGAGG - Intergenic
1003115567 6:3281647-3281669 CTGTGAAGTGGGGGGATGGTAGG + Intronic
1003256986 6:4483234-4483256 CTGTGTGGTGGGGAGGGGGTGGG - Intergenic
1003465570 6:6376860-6376882 CTGGGCAGCGGCGGGGTGGGTGG - Intergenic
1003590217 6:7431189-7431211 CACTGCACTGTGGAGGTGGGCGG - Intergenic
1004136693 6:12974161-12974183 CTTTGCAAGGCGGAGGTGGGTGG - Intronic
1004152555 6:13134235-13134257 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1004300890 6:14456122-14456144 CTGTGGTGGGGGGAGGTGGGGGG - Intergenic
1004448686 6:15726191-15726213 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1004664207 6:17735575-17735597 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1004871268 6:19906887-19906909 CTGTGCAGTGGGGTGGGGATAGG - Intergenic
1004874393 6:19939598-19939620 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
1004914675 6:20320538-20320560 CTGAGGAGTGGGGGGGTGCGTGG + Intergenic
1005063533 6:21797427-21797449 CAGTCCAGGAGGGAGGTGGGGGG - Intergenic
1005069796 6:21851999-21852021 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1005158851 6:22836762-22836784 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1005420925 6:25650068-25650090 CTCTGGAGTGGGGAAGAGGGAGG - Intergenic
1005606849 6:27485190-27485212 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1005644319 6:27826775-27826797 CCGTCCGGGGGGGAGGTGGGGGG - Intergenic
1005647743 6:27857207-27857229 CTCTGGAATGGTGAGGTGGGAGG + Intronic
1005675932 6:28154855-28154877 GTGTACAGTGGGGAGGTGGAAGG - Exonic
1005837332 6:29718996-29719018 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1005860346 6:29895846-29895868 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1006039657 6:31243885-31243907 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1006039733 6:31244063-31244085 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1006128318 6:31854096-31854118 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1006141373 6:31931996-31932018 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1006148974 6:31976140-31976162 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1006154412 6:32006565-32006587 CTGTGCAGCGGGCAGGGCGGGGG - Intergenic
1006160725 6:32039301-32039323 CTGTGCAGCGGGCAGGGCGGGGG - Intronic
1006195927 6:32242311-32242333 CAGAGCAGGGGTGAGGTGGGAGG + Intergenic
1006209760 6:32384995-32385017 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1006387607 6:33740130-33740152 CTGAGCTGTAGGGATGTGGGAGG - Intronic
1006403756 6:33832574-33832596 CTGTCCGGAAGGGAGGTGGGGGG - Intergenic
1006429727 6:33988234-33988256 CTGGACAGTGGGGTGGTAGGTGG + Intergenic
1006492532 6:34398130-34398152 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1006984039 6:38166157-38166179 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1006984047 6:38166185-38166207 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1006984063 6:38166241-38166263 GTGCGCAGGGGGGAGGTGGAGGG - Intergenic
1006984097 6:38166344-38166366 CTCTGCTGTGCGGAGGGGGGAGG - Intergenic
1006984135 6:38166462-38166484 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1007067607 6:39007785-39007807 CAGTGGGGTGGGGTGGTGGGAGG - Intronic
1007169062 6:39849781-39849803 GTGGGCAGTGGGGAGATGTGTGG + Intronic
1007234480 6:40380382-40380404 CTGTGCATCTGGGAGGTGGTAGG + Intergenic
1007236131 6:40392412-40392434 CTGGGCAGTGGGGAGGCTGCGGG - Exonic
1007277911 6:40689146-40689168 CTGTGCTGTGGGGGGTGGGGAGG + Intergenic
1007359506 6:41345016-41345038 GTGTGCAGTGGGGGCCTGGGTGG - Intronic
1007474102 6:42107473-42107495 CTGGGCCTGGGGGAGGTGGGGGG + Exonic
1007632554 6:43280862-43280884 ATGTGCAGAGAGGAGGTGAGAGG + Intronic
1007675925 6:43594939-43594961 CTGGGGGCTGGGGAGGTGGGGGG + Intronic
1007694949 6:43726067-43726089 CTGGGGAGTTGGGAGGAGGGCGG - Intergenic
1008112123 6:47505806-47505828 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1008906656 6:56684985-56685007 GTGTGGGGTGGGGGGGTGGGTGG - Intronic
1008926320 6:56894537-56894559 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1008926543 6:56895035-56895057 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1009029382 6:58038224-58038246 CTGTCCAGTGGCCAGGTGGATGG - Intergenic
1009960088 6:70509188-70509210 CTGTGGAAGGTGGAGGTGGGAGG + Intronic
1010360473 6:74987304-74987326 CAGTGCAGAGGGGAAATGGGAGG + Intergenic
1010872280 6:81058423-81058445 CTTTGCAGTGGGGAGGAGCCTGG - Intergenic
1011148450 6:84244394-84244416 CCGTCCAGGAGGGAGGTGGGAGG - Intergenic
1011782967 6:90811066-90811088 ATATGTAGTGGGGAGGAGGGGGG - Intergenic
1012728864 6:102853679-102853701 CTCTGCAGTGGAGAGGAGGAGGG + Intergenic
1012950164 6:105509742-105509764 GTGTGGGGTGGGGAGGTGGAAGG + Intergenic
1013204621 6:107934653-107934675 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1013204739 6:107934926-107934948 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1013206871 6:107953728-107953750 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1013243911 6:108269991-108270013 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1013286922 6:108689756-108689778 CTGCACAGTGGGGCAGTGGGCGG - Intergenic
1013592674 6:111632376-111632398 CAGTGCAGAGGTGAGGAGGGTGG + Intergenic
1013770701 6:113624914-113624936 GTGTGCAGTGGGGAGGCTGAAGG - Intergenic
1013837091 6:114345366-114345388 AGGTGAAGTGTGGAGGTGGGTGG + Intergenic
1013955571 6:115836513-115836535 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1014556774 6:122848679-122848701 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1014556853 6:122848858-122848880 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1014556877 6:122848908-122848930 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1014764113 6:125389024-125389046 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1015476910 6:133665365-133665387 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1015665085 6:135619455-135619477 CTTGGCAGTGGGGACATGGGAGG + Intergenic
1015936888 6:138413578-138413600 TTGTGCAGTGGGGCAGTGGGAGG - Exonic
1016187305 6:141212479-141212501 CTTTGCAGTGGGGAGGAGCCTGG - Intergenic
1016233205 6:141831114-141831136 CTGTGCACTGGGAGGATGGGAGG - Intergenic
1016448393 6:144156065-144156087 CTGAGGAGTGGGGAGGGGAGGGG - Intronic
1016515864 6:144892664-144892686 CTCTCCAGTGGGGTGGCGGGGGG - Intergenic
1016794970 6:148108184-148108206 AAGGGCAGTGGAGAGGTGGGAGG - Intergenic
1016802125 6:148178831-148178853 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1017258396 6:152360306-152360328 TGGTGCAGTGGGGAGCTGTGAGG - Intronic
1017532359 6:155308112-155308134 CTGTGCTGTGGAGAGGAGTGAGG - Intronic
1017796311 6:157847953-157847975 ATGTGGGGTGGGGAGGTGGCAGG - Intronic
1017841007 6:158222985-158223007 CTTTGCAAGGGCGAGGTGGGAGG + Intergenic
1017843536 6:158239771-158239793 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1017843715 6:158240174-158240196 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1017843840 6:158240477-158240499 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1017851476 6:158308988-158309010 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1017992230 6:159501065-159501087 GTGTGAAGTGGGGTGGTGGGTGG - Intergenic
1018074318 6:160197567-160197589 ATGGGCAGTGGGGAGGGTGGTGG - Intronic
1018222326 6:161593514-161593536 CAGTGCAGCGGTCAGGTGGGAGG + Intronic
1018239625 6:161760491-161760513 CTCTGCAGTGGGGAGGAGCCTGG + Intronic
1018349762 6:162943958-162943980 CTGTGGGCTGGGCAGGTGGGTGG - Intronic
1018833253 6:167462561-167462583 CTGTGTGCTGGGAAGGTGGGAGG + Intergenic
1018908902 6:168090692-168090714 CTCAGCAGTGGGGAGATGGAAGG - Intergenic
1018939890 6:168302038-168302060 CTGGGCAGTGAGGAGCTGGATGG - Intronic
1019160983 6:170066687-170066709 GTGGGCAGTGGGGATGGGGGTGG - Intergenic
1019273901 7:166053-166075 CTGTGATGGGGGGAGGTGGCTGG + Intergenic
1019292840 7:258736-258758 CTGCGCAGTAGGGAGGAGGGTGG - Intronic
1019439381 7:1038689-1038711 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1019443021 7:1056849-1056871 CTGTGCTTTGGCGGGGTGGGGGG + Intronic
1019458809 7:1146419-1146441 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1019458982 7:1146812-1146834 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1019497763 7:1348346-1348368 CATTGCAGTGGGTTGGTGGGTGG - Intergenic
1019640473 7:2100897-2100919 GTCTGCAGAGTGGAGGTGGGGGG - Intronic
1019669209 7:2268581-2268603 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1019721605 7:2575603-2575625 CTGTGCTGTGGGGAGGACTGTGG + Intronic
1019845351 7:3494129-3494151 TGGGGCAGTGGGGAGGAGGGAGG - Intronic
1020096809 7:5374159-5374181 GTGGGCGGTGGGGAGGCGGGCGG + Exonic
1020138380 7:5599000-5599022 CTGTGCAGTGGGGGTGGGGCGGG + Intronic
1020434865 7:8151711-8151733 CTGAGAAATGTGGAGGTGGGTGG + Intronic
1020616238 7:10465358-10465380 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1020831789 7:13102933-13102955 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1020831836 7:13103031-13103053 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
1021340876 7:19460850-19460872 GTGGGGAGTGGGGAGGGGGGAGG + Intergenic
1021440309 7:20668705-20668727 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1021648344 7:22808352-22808374 CTGTGCAGTGGGGAGGAGCCTGG + Intergenic
1021672323 7:23046235-23046257 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1021735403 7:23636883-23636905 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1021735759 7:23637688-23637710 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1021735821 7:23637822-23637844 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1021858758 7:24884548-24884570 CTTTTCAGCTGGGAGGTGGGTGG - Intronic
1021872493 7:25018989-25019011 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
1022083333 7:27044978-27045000 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1022168475 7:27797491-27797513 GTGTGCATTGGGGAGGGGAGGGG + Intronic
1022187933 7:27987551-27987573 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1022322499 7:29300069-29300091 CTTTGCAGTGGGGAGGAGCCTGG + Intronic
1022855379 7:34309178-34309200 ATGTGCACTGCGGAGGGGGGCGG + Intergenic
1022864851 7:34406750-34406772 CTGTGCAGTGGTGAAGTCAGTGG - Intergenic
1022932930 7:35140253-35140275 CTGATCAGTGTGGAGATGGGAGG + Intergenic
1022951720 7:35345614-35345636 CTTGGTGGTGGGGAGGTGGGAGG + Intergenic
1023424411 7:40020309-40020331 CTTTGCCGGGAGGAGGTGGGAGG - Intronic
1023759838 7:43455053-43455075 CTGAGCTGGGGTGAGGTGGGTGG - Intronic
1023858014 7:44197204-44197226 TTGTGCAGTGGGGAGGGGGTGGG + Intronic
1023983350 7:45082004-45082026 CTCTGAGGTGGCGAGGTGGGGGG - Intronic
1024015587 7:45311658-45311680 TTGGGCATTGGGGAGGTGAGTGG + Intergenic
1024512284 7:50213357-50213379 CTGGGCAGTGGGGAGCAGTGGGG + Intergenic
1024619875 7:51148212-51148234 TTGTGCACAGGGCAGGTGGGAGG + Intronic
1025000634 7:55312113-55312135 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1025016154 7:55440562-55440584 CTGAACAGTGAGGTGGTGGGAGG - Intronic
1025795897 7:64738597-64738619 CCGTCCAGGAGGGAGGTGGGAGG - Intergenic
1025808456 7:64856752-64856774 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1025821419 7:64967796-64967818 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1025829000 7:65033733-65033755 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1026101838 7:67390270-67390292 CTGTGCTGTGGGAAGGGGAGGGG - Intergenic
1026456103 7:70574001-70574023 CTGTGCAGTTGGGAGGCCTGGGG + Intronic
1026566812 7:71496217-71496239 CCCTGCAGTGGGGAGGCCGGGGG + Intronic
1026767704 7:73171045-73171067 CTGAGCTGTGGGGATGCGGGAGG + Intergenic
1026802285 7:73407904-73407926 GTGGGCAGTGGGGGGGTTGGCGG + Intergenic
1026868340 7:73836260-73836282 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1026959296 7:74398507-74398529 CTGGGCAGGAGGGTGGTGGGGGG - Intronic
1027044170 7:74980753-74980775 CTGAGCTGTGGGGATGCGGGAGG + Intronic
1027079472 7:75221605-75221627 CTGAGCTGTGGGGATGCGGGAGG - Intergenic
1027198558 7:76048079-76048101 CTGGGCAGTGTGGAGGTCGTTGG + Exonic
1027336727 7:77158759-77158781 CTTTGTGGTGTGGAGGTGGGCGG - Intronic
1027371099 7:77509264-77509286 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1027371341 7:77509811-77509833 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1027373978 7:77534080-77534102 CTGTCCCGGAGGGAGGTGGGGGG - Intergenic
1028007549 7:85593893-85593915 CAGTGAAGTGGGGGGGCGGGGGG + Intergenic
1028216381 7:88138949-88138971 CTCTGCAGTGGGCAGGAGGGTGG + Intronic
1029225623 7:99026212-99026234 CTGTGGAAGGTGGAGGTGGGTGG + Intergenic
1029279580 7:99427288-99427310 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1029388692 7:100260187-100260209 CTGAGCTGTGGGGATGCGGGAGG - Intronic
1029705391 7:102273212-102273234 CTAGGCAGTGGTGAGTTGGGAGG + Intronic
1029779063 7:102712352-102712374 CTTTGTGGTGTGGAGGTGGGCGG + Intergenic
1029828848 7:103233020-103233042 CTGATCAGTGTGGAGATGGGAGG + Intergenic
1030329397 7:108255943-108255965 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1030335818 7:108324628-108324650 CTGTCCAGTCGGGGGCTGGGTGG + Intronic
1030369906 7:108687082-108687104 GTGTGTGGTGGGTAGGTGGGAGG + Intergenic
1030434141 7:109493800-109493822 GTTTGCAGTGAGGAGTTGGGAGG + Intergenic
1030602801 7:111610162-111610184 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1030692732 7:112551868-112551890 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1030706307 7:112697277-112697299 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1031172050 7:118304288-118304310 TTGTGCAGTGGGGAGGAGCCTGG - Intergenic
1031374241 7:121004603-121004625 CTGGGCAGGATGGAGGTGGGAGG + Intronic
1031427333 7:121621473-121621495 CTTTGCTGTGGGGAAGTGGGAGG + Intergenic
1031895845 7:127347381-127347403 CGGGGGGGTGGGGAGGTGGGCGG + Intronic
1032042726 7:128576645-128576667 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1032042750 7:128576695-128576717 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1032116392 7:129121337-129121359 CTGCCCAGTGGGGAGGTGAAAGG - Intergenic
1032259015 7:130319641-130319663 GTATGGACTGGGGAGGTGGGAGG + Intronic
1032291117 7:130591075-130591097 CCGTCCAGAAGGGAGGTGGGGGG + Intronic
1032410471 7:131690396-131690418 CGGTGCAGTGGGGCCGGGGGTGG + Intergenic
1032569827 7:132985486-132985508 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1032569851 7:132985535-132985557 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1032696978 7:134345587-134345609 CTGTGCAGTGGCGAAGCTGGTGG + Intergenic
1032849897 7:135785112-135785134 CTATGGAGTGGGGAGGAAGGTGG + Intergenic
1032902325 7:136323759-136323781 GTGTGTGGTGGGGTGGTGGGGGG + Intergenic
1033210780 7:139458738-139458760 CTTTGCAGAGTGGAGGAGGGAGG - Intronic
1033360190 7:140633581-140633603 CTGAGAAGTGGGGAAGTGTGAGG + Intronic
1033376110 7:140763292-140763314 CTGTCCAGGAGGGAGGTGGGGGG - Intronic
1034200338 7:149280103-149280125 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1034234136 7:149554678-149554700 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1034234255 7:149554953-149554975 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1034343787 7:150373485-150373507 CTACGCAGGGGGCAGGTGGGAGG - Intronic
1034392981 7:150800620-150800642 CTGGGCTCTGGGGAGCTGGGAGG - Exonic
1034447913 7:151122883-151122905 CTCTGGAGTGGGGAGCTCGGCGG - Intronic
1034638700 7:152586084-152586106 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1034749115 7:153552280-153552302 GTTTGCATTGGGGAGCTGGGTGG - Intergenic
1034858635 7:154577335-154577357 CTGTGCAGGTGGGAGCTGGAAGG + Intronic
1034915392 7:155034658-155034680 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1034938046 7:155212334-155212356 GGGTGGTGTGGGGAGGTGGGGGG + Intergenic
1034961803 7:155367719-155367741 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1034961856 7:155367847-155367869 CCGTCCGGGGGGGAGGTGGGGGG - Exonic
1035440237 7:158891173-158891195 CTCCGCAGTGGTGGGGTGGGGGG + Intronic
1035507710 8:149483-149505 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1035507809 8:149708-149730 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1035754944 8:2023910-2023932 CTCTGCAGGGAGGAGGAGGGAGG + Intergenic
1035901490 8:3462128-3462150 CCGAGCAGCTGGGAGGTGGGGGG - Intronic
1036461803 8:8960094-8960116 CAGTGCAGAAGGGAGATGGGGGG - Intergenic
1036500279 8:9307941-9307963 GTATGCAGTGGGGAGATGGGTGG + Intergenic
1036536583 8:9657431-9657453 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1036737300 8:11330276-11330298 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1036775789 8:11612478-11612500 CTGGGGAGGGGGGTGGTGGGCGG - Intergenic
1036823105 8:11955498-11955520 CAGCGCAGTGTGGAGGAGGGAGG + Intergenic
1037256515 8:16961542-16961564 TTGTGCAGTTTGGATGTGGGAGG - Intergenic
1037635540 8:20698530-20698552 CTGTGCACTGGGCAGGGTGGAGG - Intergenic
1037797428 8:22008264-22008286 TTTTCCAGTGGGGAGTTGGGGGG - Intergenic
1038533820 8:28339584-28339606 GTGTGGAGTGGGGAGGGGGCGGG - Intronic
1038595188 8:28881235-28881257 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1038744807 8:30246939-30246961 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1038957541 8:32483711-32483733 CTGAGAAGAGGGGATGTGGGTGG + Intronic
1039396801 8:37233039-37233061 CTTTGGAGTGGGGAGAGGGGTGG - Intergenic
1039566171 8:38553977-38553999 CTGTGCAGAGGCGCCGTGGGTGG - Intergenic
1040043433 8:42939528-42939550 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1040069858 8:43179940-43179962 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1040093290 8:43419531-43419553 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1040480245 8:47819043-47819065 CTGAGCAGTGGGGAAGAGGCAGG - Intronic
1040785589 8:51159446-51159468 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1040818259 8:51531369-51531391 GTGGGCAGTGGGGCGGAGGGAGG - Intronic
1040818773 8:51534559-51534581 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1040818794 8:51534605-51534627 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1040949700 8:52925068-52925090 CTTTGCAGTGGGGAGGAGCCTGG + Intergenic
1041110700 8:54479876-54479898 CAGTGTAGTGGGGAGGTGGAAGG + Intergenic
1041270348 8:56104425-56104447 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1041286892 8:56272013-56272035 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1041286940 8:56272143-56272165 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1041286962 8:56272192-56272214 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1041591967 8:59598201-59598223 TTGTGCAGTGGGGAGGAGCCTGG - Intergenic
1041672200 8:60502743-60502765 CTGTGCAGTGCCGAGGTTGTGGG - Intergenic
1041676877 8:60547836-60547858 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1041714822 8:60923341-60923363 CTGGGCGGTGGGGGGGGGGGGGG + Intergenic
1041796473 8:61752862-61752884 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1042290681 8:67167398-67167420 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1042323645 8:67504884-67504906 CTGTGCAGGAGGGAGGAGGATGG + Intronic
1042563091 8:70088189-70088211 GCGTGCAGTGCGGGGGTGGGGGG - Intergenic
1043985858 8:86694131-86694153 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1044116560 8:88343169-88343191 CTGTCAAGGGGGGTGGTGGGGGG - Intergenic
1044190470 8:89310358-89310380 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1044597188 8:93970670-93970692 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1044660837 8:94591281-94591303 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1045120350 8:99028724-99028746 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1045298490 8:100892233-100892255 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1045803941 8:106134977-106134999 GTGTTGAGTGAGGAGGTGGGAGG + Intergenic
1046026901 8:108735361-108735383 CTGAGGAGTGGGGAAATGGGGGG - Intronic
1046636350 8:116678974-116678996 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1046636836 8:116680059-116680081 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
1047180718 8:122585171-122585193 CTGTGGGGTGGGGGGGTGGGGGG - Intergenic
1047266723 8:123315110-123315132 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1047409369 8:124611581-124611603 CTGTAAAGTGTTGAGGTGGGTGG - Intronic
1047508012 8:125495169-125495191 CTGTGCTGTAGAGTGGTGGGAGG + Intergenic
1047687262 8:127316413-127316435 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1047687400 8:127316736-127316758 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1047687550 8:127317061-127317083 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1047703697 8:127475957-127475979 TTGTGGGGTGGGGAGGGGGGAGG - Intergenic
1047782005 8:128118627-128118649 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1047800458 8:128304267-128304289 GGGTGGAGTGGGGAGATGGGAGG - Intergenic
1047847815 8:128825893-128825915 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1048221328 8:132544884-132544906 CTGTGCACTGCGGAGGTATGTGG + Intergenic
1048348314 8:133595286-133595308 CTGTGAAGGTGGGAGGAGGGAGG + Intergenic
1048368536 8:133758025-133758047 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1048368657 8:133758328-133758350 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1048368681 8:133758377-133758399 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1048496511 8:134940277-134940299 CAGGGCAGGGGGCAGGTGGGGGG + Intergenic
1048744252 8:137595777-137595799 CTTTGGAGAAGGGAGGTGGGTGG + Intergenic
1048799287 8:138181442-138181464 GTGGGCAGAGGTGAGGTGGGGGG - Intronic
1049074955 8:140388220-140388242 TTGTGGGGTGGGGAGGGGGGAGG + Intronic
1049074958 8:140388227-140388249 GTGGGGAGGGGGGAGGTGGGAGG + Intronic
1049157488 8:141075735-141075757 CTGTGCAATGGGGACGCGGGAGG - Intergenic
1049365240 8:142233897-142233919 CTGTGCAGGGGGAAGCTGGGAGG - Intronic
1049377753 8:142297054-142297076 CTGTGAAGTGGGCAGGTGGAAGG - Intronic
1049386479 8:142345401-142345423 TTGTGCAGTGGGCCGGTGAGGGG - Intronic
1049688381 8:143948317-143948339 CTGTGCAGTGGGGAAGGGCAGGG + Intronic
1049800108 8:144513762-144513784 GTGTGCAGTGGGGAGTGAGGAGG + Intronic
1049976176 9:862503-862525 CCGTGCAATGGGGAGGGGGAGGG + Intronic
1049989026 9:975525-975547 ATGGGCAGTGGGGAGGTGCGAGG + Intergenic
1051281009 9:15442297-15442319 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1051644987 9:19259238-19259260 AAGGGCAGTGGGGAGGTGGCGGG - Intronic
1052408497 9:28092543-28092565 TTGTGCGGTGGGGGGGAGGGGGG + Intronic
1052492791 9:29189150-29189172 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1052941946 9:34137697-34137719 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1053165552 9:35841503-35841525 CTGGGCAGAGGAGAGGTTGGGGG - Intronic
1053407620 9:37891220-37891242 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1053457344 9:38242397-38242419 CCGTGCGGGAGGGAGGTGGGGGG + Intergenic
1053457442 9:38242623-38242645 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1053468236 9:38325325-38325347 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1053870514 9:42487052-42487074 CTGAGCAGTGGAGAGATGGAAGG + Intergenic
1054241032 9:62613312-62613334 CTGAGCAGTGGAGAGATGGAAGG - Intergenic
1054877293 9:70110385-70110407 CTGTGCAGTGGAGAGGCGCAGGG + Intronic
1055137194 9:72840790-72840812 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1055137323 9:72841065-72841087 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1055138586 9:72851111-72851133 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1055138636 9:72851237-72851259 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1055154139 9:73039850-73039872 CTGAGTAGTGAGTAGGTGGGAGG - Intronic
1055336928 9:75241686-75241708 CTATGAAGTGGGGGTGTGGGAGG - Intergenic
1055414076 9:76063964-76063986 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1055586087 9:77761099-77761121 CTGTCCAGGAGGGAGGTGGGGGG + Intronic
1055586152 9:77761257-77761279 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1055588477 9:77783610-77783632 CTGAGCAGTGGGAAGGTAGGTGG - Intronic
1055668408 9:78575147-78575169 CTGTGAACTGGGGTGTTGGGGGG + Intergenic
1055727006 9:79241054-79241076 TGTTGGAGTGGGGAGGTGGGAGG + Intergenic
1055913226 9:81374601-81374623 CTGCTGAGTGGGAAGGTGGGAGG - Intergenic
1055931618 9:81565129-81565151 CTGGGGAGGGGGGAGGGGGGAGG + Intergenic
1055942215 9:81661351-81661373 ATGTGTAGTGGGGAAGTGTGCGG - Intronic
1055948528 9:81710897-81710919 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1056526429 9:87447018-87447040 CTGTCCAATGGGCAGGTAGGAGG - Intergenic
1056564178 9:87758571-87758593 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1056564343 9:87758989-87759011 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1057050853 9:91922979-91923001 TTGGGCAGTGGGGAGTGGGGAGG - Intronic
1057154684 9:92830700-92830722 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1057154929 9:92831244-92831266 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1057216199 9:93230199-93230221 CTGGGGAGTGGGGAGTGGGGTGG + Intronic
1057249886 9:93492658-93492680 CTGCGAAGTGGGGTGGTGGAGGG + Intronic
1057259204 9:93575102-93575124 CTGGGCACTGGGGAAGGGGGCGG - Intergenic
1057343265 9:94222725-94222747 CTGTGGTGTGGTGAGGCGGGGGG + Intergenic
1057757446 9:97849192-97849214 CCGTGGAGAGGGGCGGTGGGTGG + Intergenic
1057825467 9:98369389-98369411 CTTGGCAGTGAAGAGGTGGGTGG + Intronic
1057828812 9:98391811-98391833 CTGAGCAGTGGGGACGTGCGGGG + Intronic
1057920886 9:99095656-99095678 CTGTGTAATGGGGAGGGGGAAGG - Intergenic
1057921784 9:99104371-99104393 CTGTGCTGGAGGGAGGCGGGAGG + Intronic
1057928252 9:99171353-99171375 CTGTGCTGTGGGGAGGATGCAGG - Intergenic
1057930044 9:99185255-99185277 CTGTACAGCGGGCAGGTGGTGGG + Intergenic
1058659488 9:107256655-107256677 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1058661556 9:107272192-107272214 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1058661658 9:107272446-107272468 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1058857375 9:109076377-109076399 CTGTGGGGTGGGGGGGAGGGGGG + Intronic
1058897866 9:109415658-109415680 CAGTGCAGTGGGGATGGTGGAGG + Intronic
1059211450 9:112515243-112515265 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1059331386 9:113537789-113537811 CTATGCAGGGGGCAGTTGGGGGG + Intronic
1059346816 9:113634575-113634597 CTGTGCGGTGGGGAGGGTCGTGG + Intergenic
1059433523 9:114263645-114263667 CTGTGCAGGGGGGATGGGGGTGG + Intronic
1059603191 9:115803772-115803794 TTGTGGGGTGGGGAGGGGGGAGG + Intergenic
1059669163 9:116477032-116477054 TTGTGGAGTGGGGAGGGGGTGGG - Intronic
1059707749 9:116840512-116840534 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1060065179 9:120496187-120496209 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1060065437 9:120496768-120496790 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1060231720 9:121830409-121830431 CTGTGCAGTGGGGAGCAGGGAGG - Intronic
1060294428 9:122333550-122333572 CTACGATGTGGGGAGGTGGGAGG + Intergenic
1060351897 9:122867440-122867462 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1060404674 9:123367432-123367454 GTGTGGGGTGGGGGGGTGGGGGG - Intronic
1060682438 9:125577546-125577568 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1060687462 9:125624545-125624567 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1060703860 9:125780730-125780752 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1060760346 9:126242157-126242179 ATGTGCGGCGGGGTGGTGGGGGG - Intergenic
1060979276 9:127783407-127783429 CTGAGCAGTAGTGCGGTGGGCGG - Intergenic
1061143180 9:128780509-128780531 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1061296944 9:129681992-129682014 CTGTACCGTGGGAAGGTGGAGGG - Intronic
1061635865 9:131908110-131908132 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1061846493 9:133391220-133391242 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1061914897 9:133744872-133744894 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1061982715 9:134115642-134115664 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1061983039 9:134116396-134116418 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1061983340 9:134117101-134117123 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1061983664 9:134117855-134117877 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1062042338 9:134409832-134409854 CTGGGCCTTGTGGAGGTGGGAGG + Intronic
1062108551 9:134768970-134768992 GTGTGGAGGGGGGAGGTGTGAGG + Intronic
1062137270 9:134936125-134936147 CTGTGCAGGGGTGAGGGAGGTGG - Intergenic
1062216520 9:135392457-135392479 CTCTTCAGTAGGGAGGAGGGAGG + Intergenic
1062265149 9:135683539-135683561 GTGGCCAGTGGGGAGGTGTGAGG - Intergenic
1062451680 9:136618355-136618377 TTGGCCAGTGCGGAGGTGGGAGG - Intergenic
1203463781 Un_GL000220v1:67989-68011 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1185584978 X:1236312-1236334 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1185815081 X:3147013-3147035 CTGTGGGGTGGTGAGGTAGGAGG + Intergenic
1186244790 X:7608636-7608658 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1186244812 X:7608685-7608707 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1186244911 X:7608939-7608961 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1186244962 X:7609066-7609088 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1186245008 X:7609164-7609186 CAGTCCAGGAGGGAGGTGGGGGG - Intergenic
1186245055 X:7609291-7609313 CAGTCCAGGAGGGAGGTGGGGGG - Intergenic
1186245098 X:7609418-7609440 CAGTCCAGGAGGGAGGTGGGGGG - Intergenic
1186356887 X:8799788-8799810 GTGTGCAGTGGGGAGGGGTGGGG - Intronic
1186357213 X:8800903-8800925 GTGTGCAGTGGGTAGGGGTGGGG - Intronic
1187149636 X:16669767-16669789 CTGTGCAGTGGATGGCTGGGTGG - Intronic
1187183411 X:16964665-16964687 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1187183611 X:16965144-16965166 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1187203569 X:17159639-17159661 ATGTGCATTGGGGGGCTGGGGGG - Intergenic
1187374975 X:18743963-18743985 CTGGGCAGCGGGGAGGTTGCAGG - Intronic
1187708960 X:22034963-22034985 GGGTGCAGAGTGGAGGTGGGTGG - Intronic
1187950596 X:24466224-24466246 CTGTCCGGTGGGCTGGTGGGCGG + Intronic
1187976406 X:24709199-24709221 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1187976476 X:24709346-24709368 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1188367658 X:29333763-29333785 CTGTCCGGGAGGGAGGTGGGGGG - Intronic
1188367909 X:29334331-29334353 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1188763339 X:34058367-34058389 GTGTGCAGTGGGGAGGAGCCTGG + Intergenic
1188833785 X:34932227-34932249 CTGTGCTGTAGGGAGTAGGGTGG - Intergenic
1188971849 X:36627442-36627464 AAGGGCAGTGGGGAGCTGGGGGG - Intergenic
1188972068 X:36630048-36630070 AAGGGCAGTGGGGAGCTGGGGGG - Intergenic
1189002240 X:36958765-36958787 CTTTGAACTGGGGAGATGGGAGG - Intergenic
1189210243 X:39277747-39277769 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1189327459 X:40121431-40121453 CTGTGCACTGGGGAGGCCTGTGG - Intronic
1189383964 X:40521597-40521619 TTGGGGAGTTGGGAGGTGGGAGG + Intergenic
1189649779 X:43176940-43176962 TTATGCAGTGGGGAGGAGCGTGG + Intergenic
1189790440 X:44598642-44598664 CTTTGCGGGGTGGAGGTGGGTGG + Intergenic
1189838000 X:45041307-45041329 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1189968424 X:46395792-46395814 CTGTCCAGGAGGGAGGTGGGGGG - Intergenic
1190074938 X:47310007-47310029 ATGTGGAGTTGGGAGGTGGGAGG + Intergenic
1190109131 X:47578693-47578715 CTGTGCTGTGGGGGTGGGGGTGG - Intronic
1190109348 X:47579862-47579884 CTCTGCTGCGGGGTGGTGGGGGG - Intronic
1190116156 X:47627328-47627350 GTGTGCTGTGGTGGGGTGGGAGG + Exonic
1190171529 X:48115454-48115476 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1190576799 X:51847653-51847675 CTTTGCAGTGGGGAGGAGCCTGG - Intronic
1190779039 X:53578466-53578488 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1190790105 X:53691113-53691135 CTGTTCAGTGTAGAGGTGTGAGG - Intergenic
1190793644 X:53721873-53721895 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1190878658 X:54477193-54477215 CTCTGCTGTGGGGATGGGGGTGG + Intronic
1190891489 X:54572689-54572711 CTGTCCGGGAGGGAGGTGGGGGG - Intergenic
1191592323 X:62901420-62901442 TTGTGAGGTGGGGAGGGGGGAGG - Intergenic
1191671317 X:63751245-63751267 ATTTACAGTGGGGAGGTGGGAGG + Intronic
1191984337 X:66962192-66962214 CTGGGCAGTGGGGTGGAGGAGGG + Intergenic
1191985033 X:66970485-66970507 TTGTGGGGTGGGGAGGAGGGGGG - Intergenic
1192463891 X:71341311-71341333 CCGTGCGGGAGGGAGGTGGGGGG - Intergenic
1192476968 X:71452164-71452186 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1192554196 X:72077244-72077266 TTCAACAGTGGGGAGGTGGGGGG - Intergenic
1192567916 X:72179208-72179230 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1192768573 X:74166635-74166657 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1192768770 X:74167086-74167108 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1192768894 X:74167360-74167382 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1192892667 X:75407424-75407446 CTGCCCAGGAGGGAGGTGGGAGG + Intronic
1192933437 X:75833416-75833438 TTGGGGTGTGGGGAGGTGGGAGG - Intergenic
1193114819 X:77766324-77766346 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1193132265 X:77931776-77931798 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1193132365 X:77932002-77932024 CCGTCCAGGAGGGAGGTGGGGGG - Intronic
1193164587 X:78265576-78265598 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1193362359 X:80591556-80591578 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1194544625 X:95217934-95217956 GTGGGCAGTGGGCAGGAGGGAGG + Intergenic
1194650898 X:96512701-96512723 CTGTGCAGTGGGGGGCTGAAGGG + Intergenic
1194810331 X:98380705-98380727 CTTTGCAGTGGGGAGGAGCCTGG - Intergenic
1195009830 X:100723902-100723924 CTGTCCGGGAGGGAGGTGGGGGG + Intronic
1195009977 X:100724229-100724251 CCGTCCAGGAGGGAGGTGGGGGG + Intronic
1195257546 X:103104579-103104601 CCGTCCAGGAGGGAGGTGGGGGG - Intergenic
1195377749 X:104244222-104244244 CTGTGGTGTGGGGAGATAGGTGG - Intergenic
1195485248 X:105397277-105397299 CTATGGACTGGGGAGGTGGCAGG - Intronic
1195688299 X:107604266-107604288 CTGTGGATCGGGGAGGGGGGTGG + Exonic
1195688490 X:107605390-107605412 CTGTGTGTTGGGGAGGTGGGAGG - Intergenic
1195964215 X:110415570-110415592 GGGTGCTGTGGGGAGATGGGTGG + Intronic
1196029953 X:111086103-111086125 GTGTGCACTGGGCAGGGGGGCGG + Intronic
1196029958 X:111086110-111086132 CTGGGCAGGGGGGCGGTGGGGGG + Intronic
1196181316 X:112693611-112693633 GTTTGGAGTGGGGAGTTGGGAGG - Intergenic
1196512156 X:116524322-116524344 CAGTGGACTGGGAAGGTGGGTGG - Intergenic
1196778627 X:119362381-119362403 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1196859317 X:120012683-120012705 CAGTACAGTGGGGGTGTGGGGGG - Intergenic
1197185952 X:123587858-123587880 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1197425679 X:126294984-126295006 CTTTGCAGTGGGGAGGAGCCTGG - Intergenic
1197455782 X:126674248-126674270 CCGTCCAGGAGGGAGGTGGGGGG + Intergenic
1197736189 X:129851181-129851203 CTGTCCGGGAGGGAGGTGGGGGG + Intergenic
1197766435 X:130062074-130062096 CTGTGCAGAGGGGAGGTCAGAGG + Intergenic
1197892340 X:131279559-131279581 CTGCGGAGTGGGGAGGGGGCGGG - Intronic
1198193193 X:134331495-134331517 CTGTGTTGTGGGGTGGGGGGAGG + Intergenic
1198489961 X:137129600-137129622 ATTGGCAGTAGGGAGGTGGGGGG + Intergenic
1198567157 X:137916387-137916409 CAGGGCAGTGGGGGGATGGGGGG + Intergenic
1198681824 X:139191415-139191437 ATGTCCAGTGGGGTGGAGGGAGG + Intronic
1199491728 X:148407343-148407365 TTGTGGAGGGGGGAGGGGGGAGG + Intergenic
1199614663 X:149647359-149647381 CTGTGCCCAGGGGAGGGGGGCGG - Intergenic
1199754707 X:150853391-150853413 CAGTGAAGTGGGTGGGTGGGGGG - Intronic
1199770758 X:150973779-150973801 CGGGGGAGGGGGGAGGTGGGTGG + Intergenic
1199860790 X:151798921-151798943 CTGTGGAGAGGGGTGGAGGGAGG + Intergenic
1199928104 X:152490725-152490747 GTGGGGAGTGGGGAGGGGGGAGG + Intergenic
1200090912 X:153635538-153635560 CTGGGCTCTGGGGAGGCGGGTGG + Intergenic
1201243997 Y:11985835-11985857 CAGTGAAGTGGGGATGAGGGAGG + Intergenic
1201282277 Y:12352287-12352309 CTGTCCAGGAGGGAGGTGGGGGG + Intergenic
1201304823 Y:12541552-12541574 CTGTGCAGAGGGGAAGCGGGAGG - Intergenic
1201539171 Y:15087805-15087827 CTGTGGTGGGGGGAGGTGGGAGG - Intergenic
1202197288 Y:22308216-22308238 CTGTGCCGTGGGCACATGGGAGG - Intergenic