ID: 1121003466

View in Genome Browser
Species Human (GRCh38)
Location 14:90470011-90470033
Sequence TCCTCCCCAGGTTACAAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121003466_1121003468 -6 Left 1121003466 14:90470011-90470033 CCAAACTTGTAACCTGGGGAGGA No data
Right 1121003468 14:90470028-90470050 GGAGGAAGCCAATTTGATCTTGG No data
1121003466_1121003469 -3 Left 1121003466 14:90470011-90470033 CCAAACTTGTAACCTGGGGAGGA No data
Right 1121003469 14:90470031-90470053 GGAAGCCAATTTGATCTTGGTGG No data
1121003466_1121003471 22 Left 1121003466 14:90470011-90470033 CCAAACTTGTAACCTGGGGAGGA No data
Right 1121003471 14:90470056-90470078 AAGATTTTTTGATGTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121003466 Original CRISPR TCCTCCCCAGGTTACAAGTT TGG (reversed) Intergenic
No off target data available for this crispr