ID: 1121006072

View in Genome Browser
Species Human (GRCh38)
Location 14:90491475-90491497
Sequence CGTTAAAAGAAGAAGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 591
Summary {0: 1, 1: 0, 2: 4, 3: 52, 4: 534}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121006065_1121006072 19 Left 1121006065 14:90491433-90491455 CCAGGAAAGAGGGATGTAGAGAA 0: 1
1: 0
2: 1
3: 30
4: 340
Right 1121006072 14:90491475-90491497 CGTTAAAAGAAGAAGAAGGAGGG 0: 1
1: 0
2: 4
3: 52
4: 534

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121006072 Original CRISPR CGTTAAAAGAAGAAGAAGGA GGG Intergenic
900459312 1:2793954-2793976 TGTCCACAGAAGAAGAAGGAGGG - Intronic
901309907 1:8261397-8261419 CCTAAAACAAAGAAGAAGGAAGG - Intergenic
902088744 1:13884935-13884957 AAGAAAAAGAAGAAGAAGGAAGG - Intergenic
903279649 1:22243428-22243450 AAAAAAAAGAAGAAGAAGGAAGG + Intergenic
903303312 1:22394160-22394182 CCATAAAAGAAAAGGAAGGAAGG + Intergenic
903424408 1:23243154-23243176 CATTAAAAAAAAAAGAAGAATGG + Intergenic
904645603 1:31963827-31963849 AAACAAAAGAAGAAGAAGGAAGG - Intergenic
904848849 1:33441632-33441654 CATTAGAAAAAGAAGAAAGAAGG - Intergenic
905412390 1:37779541-37779563 TGTTAAAAGAAAGAAAAGGAAGG + Intergenic
905485192 1:38291162-38291184 TGTTAAAAAAAGAAAAAGGAAGG - Intergenic
905513305 1:38541653-38541675 TGTCAAAGGAAGAAGAAAGAAGG + Intergenic
905948313 1:41922783-41922805 CACTAAAAAAGGAAGAAGGAAGG + Intronic
906225719 1:44119558-44119580 CGTTACATGAAGAAGAAGTCAGG + Intronic
906285262 1:44583006-44583028 CCAAAAAAGAAGAAGAAGAAGGG + Intronic
906289876 1:44612904-44612926 AGTGGGAAGAAGAAGAAGGAAGG + Intronic
906430704 1:45753713-45753735 TGCAAAAAGAAGAAGAAGGGGGG + Intergenic
907295845 1:53453552-53453574 AAAAAAAAGAAGAAGAAGGAAGG + Intergenic
907564254 1:55419990-55420012 ATTTAAAAGAAAAAGAAGAATGG + Intergenic
907673312 1:56495841-56495863 CGTCAAAAGAAGAAAAGTGAGGG + Exonic
907707575 1:56845981-56846003 CTTTGAAGGAAGCAGAAGGAAGG - Intergenic
908035443 1:60046429-60046451 AAAAAAAAGAAGAAGAAGGAAGG - Intronic
908713216 1:67041320-67041342 CTTTAAAAGAAGAGGTATGATGG + Intronic
908787360 1:67748471-67748493 CTTTAAAAGAAGTAGCAAGAAGG + Intronic
909253659 1:73390571-73390593 AGTTAGAAGAAGAAGGAGGAAGG - Intergenic
909315781 1:74216460-74216482 ATTTAAAAAAAGAAGAAGAAAGG - Intronic
909723650 1:78808313-78808335 ATTTAAATGAAAAAGAAGGAAGG + Intergenic
910162140 1:84284799-84284821 AGAAAGAAGAAGAAGAAGGAGGG + Intergenic
910611613 1:89149686-89149708 AATTGAAAGAAGGAGAAGGAGGG - Intronic
910817328 1:91305111-91305133 CTTGAAAAGAAAAAGAAGGAAGG - Intronic
911496314 1:98636100-98636122 CATTAAAAAAAGAAGAAAGCAGG + Intergenic
911660823 1:100499473-100499495 GGTAAGAAGAAAAAGAAGGAAGG - Intronic
912609974 1:111033044-111033066 GGTGACAAGAAGAAGAAGGCAGG - Intergenic
912739910 1:112184691-112184713 TGTTAGGAGAAGAAGATGGAGGG + Intergenic
912769164 1:112446860-112446882 TTTTAAAATAAGAAGAAGAATGG + Intronic
912928126 1:113930574-113930596 CGTTAAAAAAACAAAAGGGAGGG + Intronic
914422249 1:147540199-147540221 CATTAAAAAAAGAAGAAAAATGG - Intergenic
914877107 1:151520301-151520323 AGCTAGAAGAAAAAGAAGGAGGG - Intronic
915353683 1:155242526-155242548 CATTTAAAGAACAAAAAGGATGG - Intronic
915552180 1:156641758-156641780 TGTTCAAAGAAGAAGGAGGAGGG - Intronic
916259738 1:162829600-162829622 AAAAAAAAGAAGAAGAAGGAAGG - Intronic
916616377 1:166445531-166445553 CACTAGAAGAAGAAGAAGGAAGG + Intergenic
918046088 1:180941845-180941867 TGTTAAAAGAAGAATGAGGAGGG - Intronic
918230111 1:182521520-182521542 TATTAAAACAAGAAGATGGAGGG + Intronic
918312845 1:183298128-183298150 CCTAAAATGAAGAACAAGGAAGG + Intronic
918350211 1:183647688-183647710 GATGAAAAGAAGAAGAAGAAAGG - Exonic
918543952 1:185661365-185661387 GGTTAAAAGAAAAGGAAGGGGGG - Intergenic
918901066 1:190418343-190418365 CATAAAAAGAATAAGAAGGCTGG - Intronic
919516525 1:198532276-198532298 CTTTAAGAAAAGAAGGAGGAAGG + Intronic
920674536 1:208029994-208030016 AGTCAAGAGAAGATGAAGGAGGG - Intronic
921027533 1:211300494-211300516 AGTTAAAGGAAGAAAAAGAAGGG - Intronic
921562219 1:216672578-216672600 TGTTAAAATAAGAAGTAAGATGG + Intronic
922786365 1:228284355-228284377 CTTTAAAAGAAGATGAAGAGAGG - Intronic
924637922 1:245806612-245806634 GGTTAAAAGAGGGAGAAGGCCGG + Intronic
1062970665 10:1645851-1645873 TGATAAATGAAGAAGAATGACGG - Intronic
1063372700 10:5532123-5532145 GGGTAAAGGAAGGAGAAGGAGGG + Intergenic
1063646860 10:7893740-7893762 GGTGAAAAGCTGAAGAAGGAAGG - Intronic
1063925981 10:10977978-10978000 AGTTAATATATGAAGAAGGAAGG + Intergenic
1064078974 10:12293104-12293126 GGTTTGGAGAAGAAGAAGGAAGG - Intergenic
1064279753 10:13940956-13940978 CTATAAAGGAAGAAGCAGGATGG + Intronic
1064666959 10:17663549-17663571 AGAAAAAAGAAGAAAAAGGAGGG - Intronic
1064686513 10:17867315-17867337 AGGAAGAAGAAGAAGAAGGAAGG - Intronic
1064952861 10:20873517-20873539 AGATTAAAGAAGAAGAAAGAAGG + Intronic
1065182728 10:23143214-23143236 AGTTAAAATAAGGAGGAGGATGG + Intergenic
1066366300 10:34780036-34780058 CGGGGAAAGAAGAAGATGGAGGG - Intronic
1067128149 10:43537792-43537814 AAAGAAAAGAAGAAGAAGGAAGG - Intergenic
1068522501 10:58093311-58093333 TGTGATAAGAAGAAGAAGGCGGG + Intergenic
1071381268 10:85062707-85062729 CCTAAAAAGAAGAAGAAAGACGG - Intergenic
1071444337 10:85731806-85731828 AAAAAAAAGAAGAAGAAGGAAGG + Intronic
1072263353 10:93703181-93703203 CTTAAAAAGAAGAAGAAAAAAGG + Intergenic
1072367186 10:94724258-94724280 GGTTACAAGAAGCATAAGGAAGG - Intronic
1072560790 10:96571776-96571798 CGATAAAATAAACAGAAGGAAGG + Intronic
1072745627 10:97937285-97937307 GGTTTAAAGGAGATGAAGGAGGG - Intronic
1073028240 10:100504231-100504253 CTTAAAAAGAAAAAGAAGTAGGG - Intronic
1074730947 10:116374889-116374911 CGTTAAAAAAAAAAAAAGAATGG + Intronic
1074779092 10:116787755-116787777 GGTGAAAAGAAGAGGAAAGAAGG + Intergenic
1075245432 10:120818128-120818150 AGAGAAGAGAAGAAGAAGGAAGG - Intergenic
1075904061 10:126065292-126065314 CCTCAGAGGAAGAAGAAGGAGGG + Intronic
1077765486 11:5155431-5155453 TTTTGAAAGAAAAAGAAGGAAGG - Intronic
1079649176 11:22905412-22905434 CTTTAAAACAAGAAGATGGAAGG - Intergenic
1079798028 11:24831023-24831045 AATAAAAAGAAGAAGAAGCAAGG + Intronic
1080168363 11:29268137-29268159 AGTTAAAAGAGGAGCAAGGATGG - Intergenic
1082085072 11:48043586-48043608 CGGTCAAAGCAGAAGAGGGAAGG + Intronic
1082599850 11:55135681-55135703 CATTCAAAGAAGAATATGGAGGG + Intergenic
1082812211 11:57485175-57485197 CGGTAATAGAAGAGGTAGGAAGG + Exonic
1084289164 11:68150855-68150877 CTTTAAAAGAAAAAAAAGGCCGG - Intergenic
1084712725 11:70853900-70853922 CTTTATAAGAAGAAGGAGGGGGG - Intronic
1085013604 11:73158123-73158145 CTTTGGAAGAAGAAGAAGTATGG + Intergenic
1086532638 11:87803796-87803818 CGTGAAAAGGAGAAGATGGAAGG + Intergenic
1086586125 11:88454369-88454391 CTTTAAAAAAAAAAGAATGAAGG + Intergenic
1087244210 11:95815390-95815412 CGTTCAAAGAGATAGAAGGAAGG - Intronic
1087955736 11:104285625-104285647 GGTTAAAAGAAGCAATAGGAAGG - Intergenic
1088211231 11:107458601-107458623 ATTTACAAGAAGAAGAAGGCTGG + Intergenic
1088503128 11:110503557-110503579 GCTTAAAACAAGTAGAAGGATGG - Intergenic
1089036536 11:115399680-115399702 TGTTAAAAAAAGAATGAGGATGG - Intronic
1089636829 11:119819910-119819932 GGTTAATAGAGGAAGCAGGAAGG + Intergenic
1090080418 11:123608880-123608902 TGTGGAAAGAAGAATAAGGAAGG - Intronic
1090534852 11:127629610-127629632 TGTTAAAAAAATAAGAAAGATGG + Intergenic
1091905102 12:4179369-4179391 ATTTAGATGAAGAAGAAGGAGGG + Intergenic
1092092267 12:5812699-5812721 AAAGAAAAGAAGAAGAAGGAAGG + Intronic
1092551119 12:9501291-9501313 CCGAAAAAGAAAAAGAAGGAAGG - Intergenic
1093120731 12:15268062-15268084 CATTAAAAAAAAAAAAAGGAGGG - Intronic
1093236928 12:16620897-16620919 AATTAAAAGAAGAAAAAGGGAGG + Intergenic
1093918842 12:24836772-24836794 ATTTAAAAAAAGAAGAAAGAAGG + Intronic
1094175201 12:27534135-27534157 TATTAAAAGAAGAAAAAGGGAGG + Intronic
1094214111 12:27922521-27922543 GGTTAAAAGAAAAAAAAGGCAGG - Intergenic
1094476387 12:30843888-30843910 GGTGACAAGAAGAAGAAGGTGGG - Intergenic
1094520685 12:31185065-31185087 CCGAAAAAGAAAAAGAAGGAAGG + Intergenic
1095251824 12:39988468-39988490 ATTTAAAAAAAGAGGAAGGAAGG + Intronic
1096580989 12:52585143-52585165 GGTTAAAAGAAGAGGAAGACAGG + Intergenic
1096783245 12:54002800-54002822 CTTAAAAAGAAAAACAAGGAAGG + Exonic
1097350356 12:58542298-58542320 GGTTAAAAGAAGATTAGGGAAGG + Intergenic
1098412335 12:70199876-70199898 AGAAAAAAGAAGAAAAAGGAAGG - Intergenic
1098708689 12:73725677-73725699 CCTTAAAAGAGGAAGAAGTCTGG - Intergenic
1099308037 12:80982777-80982799 AGTTAAATGAAGGAAAAGGAAGG - Intronic
1099325735 12:81212502-81212524 CTTTCAAAGAAGGAGAAGAATGG - Intronic
1099957738 12:89367652-89367674 CTCTTAAAGAAGAAGAAGAAGGG + Intergenic
1100593099 12:96047498-96047520 GGTTAAAAGTAGATGAAGTAGGG + Intergenic
1100702084 12:97159867-97159889 AGAGAAAAGAAGAAGAAGGATGG + Intergenic
1100864311 12:98840106-98840128 CTCTAAAAGAAAAAGAGGGAAGG + Intronic
1101245258 12:102878607-102878629 CATAAAGAGAAAAAGAAGGAGGG + Intronic
1102167846 12:110820701-110820723 AGGAAGAAGAAGAAGAAGGAGGG - Intergenic
1102808078 12:115799650-115799672 CAAAAAAAGAAGAAGAAGGGGGG + Intergenic
1104204841 12:126628847-126628869 CCTTAAAAGTAGAAGAGGAAGGG - Intergenic
1104599192 12:130141128-130141150 AGTTAAAAAAAGAACAAGGGCGG - Intergenic
1105408342 13:20150145-20150167 CGTTTAAAGAGGAAGAAGTTGGG + Intronic
1105609267 13:21954031-21954053 CCTGAAAAGAAGGAGCAGGAAGG - Intergenic
1105688714 13:22814159-22814181 GATTAATAGAAGAGGAAGGAAGG - Intergenic
1107615707 13:42164986-42165008 GGGAAAAGGAAGAAGAAGGACGG - Intronic
1107703464 13:43073950-43073972 CAAAAAAAAAAGAAGAAGGATGG - Intronic
1108044364 13:46369214-46369236 TCTCAAAAGAAGAAGAAGAAAGG - Intronic
1108303118 13:49101087-49101109 AGTTAAAAGGAGAAGAAACAAGG + Intronic
1108466732 13:50724354-50724376 GGATAAAAGATGAAGAAGTATGG - Intronic
1109299384 13:60575185-60575207 AATTAAAAACAGAAGAAGGAAGG + Intergenic
1110253957 13:73410824-73410846 CAATAAAAAAAGAGGAAGGATGG - Intergenic
1110456191 13:75692858-75692880 AGTCAAAAGAAGAAGACTGAAGG - Intronic
1110751208 13:79118666-79118688 CTAAAAAAGAAAAAGAAGGAAGG + Intergenic
1110927167 13:81168320-81168342 TGTTAAAAAAAAAAGAAGGAAGG - Intergenic
1111547567 13:89762411-89762433 CGGCAAAAGAAAAAGATGGAGGG - Intergenic
1112170896 13:96970775-96970797 GGTTACAAGGAGAAGAGGGAGGG - Intergenic
1112421034 13:99248915-99248937 AATTAAAATAAGAAGAAAGAGGG - Intronic
1113010957 13:105765111-105765133 AGAAAAAAGAAAAAGAAGGAGGG - Intergenic
1113013873 13:105805207-105805229 CATTAAGGGAAGAAGAATGAAGG + Intergenic
1113221449 13:108108242-108108264 CTTATAAAGAAGAAGAAGCAAGG - Intergenic
1113305704 13:109076275-109076297 CCTAAGAAGAAGAAGAAGGAAGG - Intronic
1114042045 14:18688111-18688133 CTTAAAAAGAAAAAGAAAGAGGG + Intergenic
1114062259 14:19028313-19028335 TTTTAAAAGAAGCAGAAGGGAGG + Intergenic
1114100000 14:19371680-19371702 TTTTAAAAGAAGCAGAAGGGAGG - Intergenic
1114346708 14:21804090-21804112 TGGTGAAAGAAGAGGAAGGATGG - Intergenic
1114510884 14:23259422-23259444 CTTTAAAAGAAGAAAAAAAAAGG - Intronic
1114710977 14:24777938-24777960 GGTTAAAGGAAGAGGAAGCAAGG - Intergenic
1114866128 14:26597702-26597724 GGGTGAAAGAAGAAGAAGAAAGG + Exonic
1115228703 14:31134039-31134061 CCTTAAAAAAAAAAAAAGGATGG + Intronic
1115271726 14:31560345-31560367 TGTCAGAAGAAGAAGAAAGAAGG - Intronic
1116248003 14:42442494-42442516 AGTAAAAAGAAGAAAATGGATGG - Intergenic
1117249003 14:53916524-53916546 GGTCAAAAGAAGAACAATGAAGG + Intergenic
1117386767 14:55222452-55222474 TTTTAAAAGAAGAATAAAGAAGG + Intergenic
1117693575 14:58335770-58335792 GGTTAAGAGAAGAAGAATCAAGG - Intronic
1118100511 14:62595835-62595857 CATTAAAAAAAAAAGAGGGAAGG - Intergenic
1118669479 14:68107520-68107542 CTTTTAAAGAAGAAGAAAGTTGG + Intronic
1119186888 14:72649471-72649493 AGTGAGAAGAGGAAGAAGGAAGG + Intronic
1120234404 14:81874590-81874612 AGTTAAAACAAGAAAAATGAAGG - Intergenic
1120575227 14:86173845-86173867 TGGTAAAATAAGAAGAAGCAAGG + Intergenic
1121006072 14:90491475-90491497 CGTTAAAAGAAGAAGAAGGAGGG + Intergenic
1121095046 14:91212208-91212230 TGTTAAGAGAAGGAGAAGGCTGG + Intronic
1121574806 14:94975370-94975392 TGTTATCACAAGAAGAAGGATGG - Intergenic
1122551178 14:102550860-102550882 CAAAAAAAGAAGAAGAAGAAAGG + Intergenic
1124339623 15:28881864-28881886 GGGAAAAAGAAGAACAAGGAAGG - Intergenic
1124640670 15:31394116-31394138 AGTTAAAGGAAAAAAAAGGAAGG + Intronic
1124666468 15:31597469-31597491 TGTTAAAAAAAAAAAAAGGAGGG - Intronic
1125056747 15:35368219-35368241 AGTTAAAAAGAGAAGAAGAAAGG + Intronic
1125179868 15:36870441-36870463 AGGTAAAAGAAGATGAAGGGAGG - Intergenic
1125281205 15:38044292-38044314 TTTTTAAAGAAAAAGAAGGAAGG + Intergenic
1125291497 15:38153184-38153206 CTTTAAAAGAAAAATAAGGAGGG + Intergenic
1126342258 15:47654094-47654116 CCTAAAATGAAGAAGAAAGAAGG + Intronic
1126528878 15:49689759-49689781 CCTTAAAGGAATAAGAAGGCTGG + Intergenic
1126966716 15:54062465-54062487 TGTGAAAAGAAGAAGAAAAATGG - Intronic
1127137639 15:55941249-55941271 TCTTTAAAGAAAAAGAAGGAAGG - Intronic
1127402120 15:58599151-58599173 AGAAAAAAGAAAAAGAAGGAAGG + Intronic
1127434341 15:58942211-58942233 AAATAAAAGAAGTAGAAGGAAGG + Intronic
1127975539 15:63994400-63994422 TGTTAAAAGAAAAGGAAGGAAGG + Intronic
1128068660 15:64779871-64779893 ATTTAAAAGAAAAAGAAGAAAGG + Intergenic
1128095707 15:64953287-64953309 AAGTAAAAGAAGAAGAAAGAAGG - Intronic
1128301105 15:66566893-66566915 GTTTAAAAGAAAAAGAAAGAAGG - Intergenic
1129227460 15:74178454-74178476 TGTTCCAAGAAGAGGAAGGAAGG - Intergenic
1129338766 15:74871450-74871472 CCTTAAAAAAGGAAGAAAGAGGG + Intronic
1131357012 15:91754143-91754165 CCTGAAAAGAAGATGAAGAAGGG + Intergenic
1132052581 15:98619390-98619412 GGTTAAAAAAAAAAGAAGAAAGG + Intergenic
1133647783 16:7780630-7780652 CCTTAAAAAAGGAAGAAGGAAGG - Intergenic
1134329395 16:13236625-13236647 CAGAAAAAGAAGAGGAAGGAAGG - Exonic
1135091368 16:19520733-19520755 AAAAAAAAGAAGAAGAAGGAAGG + Intronic
1135342833 16:21663863-21663885 CGTTAAAAGAAGTTATAGGACGG - Intergenic
1135633367 16:24053673-24053695 CTTTCAAAGGAGATGAAGGAGGG + Intronic
1136095839 16:27955871-27955893 CCATAAGAGAAGAGGAAGGAAGG + Intronic
1136571269 16:31098373-31098395 CCTTAAAAAATGAAGGAGGATGG + Intergenic
1137517398 16:49158796-49158818 AGTTAAAGGAAGAAGAAGAATGG + Intergenic
1137952380 16:52795940-52795962 CCTTAAAAGTGGAAGAAGGAAGG + Intergenic
1138502302 16:57454789-57454811 GGTGGAAAGAAAAAGAAGGATGG + Intronic
1139019275 16:62726909-62726931 CGTTGAAAAAAGAAGGAGCAAGG - Intergenic
1139164055 16:64545413-64545435 CATTAAAATAAGAAGATGGCTGG + Intergenic
1139350213 16:66330238-66330260 CCTTAAAAGAAGAGGAAGGCCGG - Intergenic
1140117727 16:72057287-72057309 ATTAAAAAGAAGAAGAAGAAAGG - Intronic
1140119962 16:72075040-72075062 ATTAAAAAGAAGAAGAAGAAAGG - Intronic
1141018710 16:80474815-80474837 CTTTATAAGTGGAAGAAGGAAGG - Intergenic
1142305657 16:89283501-89283523 CGAGAGAAGGAGAAGAAGGATGG - Exonic
1143150478 17:4804878-4804900 CATTGAAAGAAAAAGAAGGCGGG - Intergenic
1144394697 17:14832845-14832867 CTTTAAAAGAAAAAGCAGGCCGG - Intergenic
1145754072 17:27377494-27377516 CATCACAAGAAGAAAAAGGATGG + Intergenic
1145927100 17:28656264-28656286 ATTTAAAAGAAGAAAAAGGCTGG - Intronic
1146129558 17:30259524-30259546 AGTTAACAGAAGAAGAACTAGGG - Intronic
1146479251 17:33191515-33191537 TGTTAAAAGAAGAAGAAGAAGGG + Intronic
1146530613 17:33604721-33604743 CGCTAAAAGGAGAGGATGGAGGG + Intronic
1146557950 17:33842781-33842803 CATTCAGAGGAGAAGAAGGATGG + Intronic
1146664544 17:34688944-34688966 AGTTAAAACAAAAAAAAGGATGG + Intergenic
1146687309 17:34849632-34849654 CTTTTAAGGAAGAAAAAGGAGGG + Intergenic
1148039598 17:44696365-44696387 CGTTAAAAAATGAAGTAGGCCGG + Intergenic
1149226350 17:54475959-54475981 CTTTGAAAGAACAAGAAAGATGG - Intergenic
1149900018 17:60467263-60467285 ATTTAAAAGAAAAACAAGGATGG + Intronic
1151269723 17:72984818-72984840 TGTTAAATGAATAAGGAGGAAGG + Intronic
1151541620 17:74767652-74767674 CCTTGAAAGAAGAAGGTGGATGG - Intronic
1151764131 17:76123366-76123388 CTGAAAAAGAAAAAGAAGGAAGG - Intergenic
1153877772 18:9390459-9390481 ATTTAAAAAAAGAAGAAAGAAGG - Intronic
1155016802 18:21850501-21850523 GGTTGAAAGTAGAAGAAGCAGGG - Intronic
1155413243 18:25569035-25569057 CCTTAAATGAAGTAGAAGCAGGG + Intergenic
1155889947 18:31255392-31255414 GGATAAAAGCAGAGGAAGGAAGG + Intergenic
1156177713 18:34566279-34566301 CTTTAAAAAAAAAAAAAGGAAGG + Intronic
1156253177 18:35371611-35371633 CTTTATAAGAAGAGGAAGAAAGG - Intronic
1156851434 18:41732375-41732397 GGTTAAAAGAAAAAAAAAGAGGG + Intergenic
1156881837 18:42089220-42089242 AGTTTAAAGAAGAAAAAGGCTGG + Intergenic
1157104857 18:44764443-44764465 CGAAGAAAGAAGAAGAAAGAAGG - Intronic
1157151248 18:45220961-45220983 CCTTAACAGAAGAAGAAGTTTGG - Intronic
1157450037 18:47779374-47779396 CGTGAAAAGAAGGAAAAGAACGG - Intergenic
1157466856 18:47954723-47954745 TGTTAAATGAAGATGAAGCAAGG - Intergenic
1157872840 18:51246383-51246405 CTTTATAAGAAGAGGAAGGCCGG + Intergenic
1158412852 18:57222953-57222975 AGAAAAAACAAGAAGAAGGAAGG + Intergenic
1158415483 18:57246502-57246524 TCTAAAAAAAAGAAGAAGGAAGG + Intergenic
1161795093 19:6381778-6381800 AGGAAAAAGAAGAAGAAGAAGGG - Exonic
1162504408 19:11074577-11074599 CTTAAAAAAAAAAAGAAGGAAGG + Intergenic
1162627956 19:11900772-11900794 TGTTAAAAGAAGAAAAAGAGAGG - Intronic
1163238247 19:16042423-16042445 TGTTAAAACAAGAAGAAGCTGGG - Intergenic
1164053810 19:21605476-21605498 CGTCAAAAGAATAAGGAGAATGG + Intergenic
1164811386 19:31159299-31159321 CCTTAAAAGTAGAAGAGGGATGG - Intergenic
1165361952 19:35342165-35342187 TATAAGAAGAAGAAGAAGGAAGG - Intronic
1166965086 19:46524985-46525007 CAGAAAAAGAAAAAGAAGGAAGG - Intronic
1167534686 19:50042166-50042188 AGGTAAAAGAAGTAGAATGAGGG - Intronic
1168341455 19:55625580-55625602 CTATAAAAGAAGAAGAAAGGAGG - Intergenic
927285068 2:21348640-21348662 ATTTAAAAGATGAGGAAGGAAGG + Intergenic
928073111 2:28237482-28237504 CCTTAGAAAAGGAAGAAGGAGGG - Intronic
929017957 2:37519307-37519329 TGTTAAAAGAAGAACAAGGTTGG - Intergenic
930389337 2:50740759-50740781 AGTTAAAAGGACAAGGAGGAAGG + Intronic
931183337 2:59925795-59925817 CTTAAAAAGAAAAAGAAGAAGGG + Intergenic
931330059 2:61271560-61271582 CTTTAAAAGGAGAAGAAAGGAGG + Intronic
931435811 2:62245286-62245308 CGATAAAAGAAAAAGTAGGCTGG + Intergenic
932116235 2:69050947-69050969 CAATATAAGAAGCAGAAGGAAGG - Intronic
933130836 2:78672806-78672828 CATTAGAATAAGAATAAGGATGG + Intergenic
933203791 2:79481799-79481821 CTTTAAAAGAAGAAGACAGACGG + Intronic
933276606 2:80290800-80290822 CGGTAAAAAGAAAAGAAGGAAGG + Intronic
933286032 2:80385625-80385647 ATTTAAGGGAAGAAGAAGGAGGG - Intronic
933661722 2:84933050-84933072 AATAAAAAGAAGAAGAAGTAGGG + Intergenic
934164581 2:89282534-89282556 CCTTATAAAAAGAAGAAGGTGGG - Intergenic
934202693 2:89899990-89900012 CCTTATAAAAAGAAGAAGGTGGG + Intergenic
936654475 2:114468924-114468946 CTTTAGAACAAGAAGAAGAAGGG + Intronic
937122484 2:119450586-119450608 TGCTCAAAGAAGAAGGAGGAAGG + Intronic
938078260 2:128353614-128353636 CTTTACAAGAAGAGGAAGGGAGG + Intergenic
938268171 2:129944421-129944443 CTTAAAAAGAAAAAGAAAGAGGG - Intergenic
938479622 2:131648498-131648520 TTTTAAAAGAAGCAGAAGGGAGG + Intergenic
939014181 2:136882376-136882398 AGAAAGAAGAAGAAGAAGGATGG - Intronic
939542183 2:143507942-143507964 GGTTAAGAGGAGAAGTAGGAAGG - Intronic
939706822 2:145465172-145465194 CAGGAAAAGAAGAAGAAAGAAGG + Intergenic
939729506 2:145764680-145764702 CTGTAAGAGAAGATGAAGGAGGG - Intergenic
939967367 2:148623682-148623704 CAAGAAAAGGAGAAGAAGGATGG - Intergenic
940405202 2:153293336-153293358 CCTTAAAAGATGAAAGAGGAAGG + Intergenic
940479710 2:154212715-154212737 CCTTAGAAGGAGAAGAAGGATGG - Intronic
940786423 2:157986458-157986480 TAATAGAAGAAGAAGAAGGATGG + Intronic
940866308 2:158820813-158820835 CTTTATAAGGAGAAGAAGGGAGG + Intronic
941421049 2:165283164-165283186 GGAAAAAAGAAGAAAAAGGAAGG + Intronic
942488513 2:176466004-176466026 GGTTAAAAGAAAAAGAAAGCAGG + Intergenic
942823386 2:180143486-180143508 TGTCAAAAGAAGATGAGGGATGG - Intergenic
942849984 2:180472854-180472876 CATGAAAAAAAGAAAAAGGAAGG - Intergenic
943169820 2:184384592-184384614 CTTTAAAAGTGGAGGAAGGAGGG - Intergenic
943269718 2:185783624-185783646 CTGTAAAAGATGCAGAAGGAAGG + Intronic
944105231 2:196072483-196072505 TGTAAAAGGAAGAAGAAGGAAGG + Intergenic
944676923 2:202041382-202041404 CTTTTAAAGATGAAGAAGGCCGG + Intergenic
945831064 2:214785619-214785641 AGTTAAAACAAAAAGAAGGAAGG + Intronic
945983358 2:216334166-216334188 CCTTAAAAGTGGAAGAAGGCAGG + Intronic
946610087 2:221448555-221448577 CTTTAAAAGAAGGGAAAGGACGG - Intronic
947154750 2:227150899-227150921 TGTTAAAAAAAAAAAAAGGAGGG - Intronic
947439526 2:230107375-230107397 CCTTAAAAGAGGAGGAAGAAAGG - Intergenic
947765027 2:232632618-232632640 AAATAAACGAAGAAGAAGGAGGG - Intronic
947844272 2:233231693-233231715 CTTTATAAGAAGAGGAAGAAAGG - Intronic
948721599 2:239904251-239904273 AGAAAAAAGAAGAAGAAGAAAGG - Intronic
948774510 2:240276630-240276652 CATAAAAATAAAAAGAAGGAAGG + Intergenic
1169040469 20:2490324-2490346 AGAGAAAAGAAAAAGAAGGAAGG + Intronic
1169668924 20:8072711-8072733 TTTTAAAAGTAGAAGAAGGAGGG + Intergenic
1169881653 20:10353240-10353262 CATTGAAAGAAGCAGAAGTACGG + Intergenic
1169925387 20:10778221-10778243 TGTTATAAAAGGAAGAAGGAAGG - Intergenic
1170901523 20:20468017-20468039 GGAAAAAAGAAGAAGAAGAATGG - Intronic
1171447921 20:25217746-25217768 CATTAAAGGATGAAGGAGGAGGG - Intronic
1171568250 20:26216939-26216961 TGTTTAAAGAAGGAGAAGGAAGG + Intergenic
1172726808 20:37050245-37050267 CTTTAAAAGTAGAATAAGGCCGG + Intronic
1172784221 20:37455726-37455748 CCTTAAAAGAAGAGGAAGAGAGG + Intergenic
1172927895 20:38556731-38556753 CTTTAAAAAAAAAAGAAGAATGG + Intronic
1173087724 20:39940303-39940325 CATTAATAGAAGAGGAAGCAGGG + Intergenic
1173460625 20:43240381-43240403 TGTTTCCAGAAGAAGAAGGAGGG - Intergenic
1173914701 20:46698338-46698360 CCTTAAAAGTAGAAGGAGGCAGG - Intergenic
1174251725 20:49224965-49224987 CGGAAGAAGAAGAAGAAGAAAGG + Exonic
1174287443 20:49483096-49483118 CGTTAAAAAAAAAAAAAAGAAGG - Intergenic
1177232674 21:18342697-18342719 GGATCAAAGAAGAAGAAAGAAGG + Intronic
1177379387 21:20319295-20319317 AGTAAAAAGAGGGAGAAGGAGGG + Intergenic
1178002337 21:28176392-28176414 AATGAAAAGAAGAAGAAGGAAGG + Intergenic
1178138408 21:29654591-29654613 AGTTAAAAGAAAAAGAAAGAAGG + Intronic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1180480751 22:15750939-15750961 TTTTAAAAGAAGCAGAAGGGAGG + Intergenic
1181829487 22:25548350-25548372 CTCTAAAAGAGGGAGAAGGAGGG + Intergenic
1182020026 22:27073851-27073873 AATTAAAAGAAGAAGAAGAAAGG - Intergenic
1182951461 22:34380204-34380226 AGTCAAAAGAAGAGGAAGAAGGG + Intergenic
1183644993 22:39120184-39120206 CATTAAAAAAAAAAGAAGAAAGG - Intronic
1184370745 22:44080501-44080523 CCTTACAAGAGGAAGCAGGAGGG - Intronic
1184571027 22:45325091-45325113 CGTCATAGGAAGAAGAAGGGAGG + Intronic
1184587671 22:45458857-45458879 GCTTAAAAGAAGAATAAGGTGGG + Intergenic
950193213 3:10992337-10992359 CATCAAAGGAAGGAGAAGGAAGG + Intergenic
950655136 3:14431852-14431874 GTTTAAAAGAGGAACAAGGAGGG + Intronic
951137052 3:19116656-19116678 CGTTATAAGAAAGTGAAGGAAGG - Intergenic
952083505 3:29789670-29789692 ATTTAAAAGAAGAGGAATGATGG - Intronic
952313879 3:32215508-32215530 CGTTATAGGAACAAAAAGGAAGG + Intergenic
952495443 3:33911958-33911980 CATTCAAAGAGGAAGAATGAGGG - Intergenic
953302140 3:41788286-41788308 CATTTAAAGCAGAAGAAGCATGG + Intronic
953466469 3:43125504-43125526 CATTAAAAGACAAAGAAGGTCGG + Intergenic
953552612 3:43915462-43915484 TGTTAAAATATGAAGAAGAAAGG + Intergenic
953573316 3:44091008-44091030 CTTTAAAAAAAGTAGAAGAAAGG - Intergenic
953887855 3:46727692-46727714 CTTTAAAAGATGGAGAATGAAGG + Intronic
955486389 3:59438819-59438841 CCACAAAGGAAGAAGAAGGAGGG + Intergenic
955645783 3:61136060-61136082 CTTTAACACAAGAACAAGGAGGG + Intronic
955695618 3:61633026-61633048 CGCCAAATCAAGAAGAAGGATGG - Intronic
956334161 3:68144805-68144827 AGTTAAAAGAAGCAGAAGCTGGG - Intronic
956778946 3:72589479-72589501 CATGAGAAGAAGAAGAAGGATGG - Intergenic
957110603 3:75951399-75951421 TGTTTAAAGAAGGAGAAGGAAGG - Intronic
957415062 3:79891152-79891174 TATTAAAAGAAGAAGAAAAAAGG + Intergenic
957510005 3:81175572-81175594 CGTTTAAAGAAGAACTAGAAAGG - Intergenic
957834222 3:85565857-85565879 AGTTAAAAGAAAACGATGGAAGG - Intronic
957894078 3:86397462-86397484 AGTAAAAAGAGGAAGAAGAAAGG - Intergenic
958259649 3:91365738-91365760 CATTTAAAGCAAAAGAAGGAAGG + Intergenic
958860451 3:99438893-99438915 AATTTAAAGCAGAAGAAGGAAGG + Intergenic
958896105 3:99831467-99831489 TTTTAAAAGACGAAAAAGGAAGG + Intronic
959256833 3:104025797-104025819 GGGGGAAAGAAGAAGAAGGAAGG + Intergenic
959481448 3:106877402-106877424 AGTAAGAAGAAGAGGAAGGAAGG + Intergenic
959542060 3:107551386-107551408 CTTTAAAAGAAGAAAAAGATGGG - Intronic
959577719 3:107952286-107952308 ATTTAGAAGAAGAATAAGGAGGG + Intergenic
960245109 3:115391715-115391737 TGTTAAAGGAAGAAGAAGGAAGG - Intergenic
960417936 3:117408185-117408207 CGCTGAAAGATGAATAAGGAGGG + Intergenic
961074532 3:123969600-123969622 GGTTAAAAGAAAAAGAGGGCCGG - Intronic
961490821 3:127255802-127255824 CGGGAATCGAAGAAGAAGGAAGG - Intergenic
962513422 3:136125996-136126018 GGTTAAAAGAAAAAAAAGGAGGG + Intronic
962914670 3:139888977-139888999 AGATAAATGATGAAGAAGGAAGG - Intergenic
962946548 3:140176300-140176322 CCTTAGAAGAAGAAGAAACAAGG - Intronic
963380866 3:144528617-144528639 GGTTAAAAGTAGAAGCCGGAAGG - Intergenic
963957404 3:151270013-151270035 AGATAAATGATGAAGAAGGATGG + Intronic
964063822 3:152557678-152557700 GTTAAAAAGAAGAAAAAGGAGGG + Intergenic
964166181 3:153708105-153708127 TCATAAAAGAAAAAGAAGGAAGG + Intergenic
964704779 3:159606593-159606615 AGTTCAAGGAATAAGAAGGATGG + Intronic
965565402 3:170111248-170111270 CTTTAAAACAAGAAGAAGGAAGG + Intronic
965617141 3:170606102-170606124 AAAAAAAAGAAGAAGAAGGAAGG - Intronic
965906464 3:173713447-173713469 AGTTAAGAGAAGGAGAAGAATGG + Intronic
966021686 3:175220585-175220607 CATGAAAAGAAAAAGAAGGAGGG - Intronic
966038646 3:175452405-175452427 CCTTAAAAGAAAAAAAAGAAAGG + Intronic
966230043 3:177641768-177641790 GATTAAAAGATCAAGAAGGAGGG + Intergenic
966458076 3:180141002-180141024 AGTTGAAAGGAGAAGATGGAGGG - Intergenic
966844811 3:184120330-184120352 CAAAAAAAGAAGAAGAAGAAAGG + Intergenic
967509867 3:190298251-190298273 CTTTGAAAGAAGCAGTAGGATGG - Intergenic
967783052 3:193460247-193460269 CCAAAAAAGAAGAATAAGGAAGG - Intronic
967839105 3:193990384-193990406 CTTTATAAGAAGAAGAAGAGAGG - Intergenic
967968231 3:194979465-194979487 CCTTAAAAGAAGAAGAAATTTGG - Intergenic
968485868 4:861292-861314 CGTCAAAAGCAGAGGAAGGCCGG + Intronic
968543753 4:1184521-1184543 CTTTAAAAGAAGAACAAAGCTGG + Intronic
969985040 4:11199757-11199779 ATTTAAAAGAAGATAAAGGAAGG - Intergenic
970272346 4:14360517-14360539 CATTAAAAAAAGGAGAAGGGAGG - Intergenic
970664889 4:18325657-18325679 TATTAAAAGATTAAGAAGGATGG - Intergenic
970815326 4:20149411-20149433 TGTTAAAAGAAGTAAAAGGCAGG + Intergenic
971192305 4:24439183-24439205 CTCTTAAAGAAGGAGAAGGATGG - Intergenic
972117649 4:35657399-35657421 AGTTAAAAAAAGAAGAAGTAGGG - Intergenic
972364520 4:38361760-38361782 CTTTATAAGAAGAAGAAGAGAGG + Intergenic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
972727842 4:41761147-41761169 TGTCAAAAAAAAAAGAAGGAAGG + Intergenic
973628448 4:52795507-52795529 AGGAAGAAGAAGAAGAAGGAAGG + Intergenic
974202599 4:58660702-58660724 GTTTAAAACAAGAAGAAAGAGGG - Intergenic
974421417 4:61681098-61681120 GGTGAGAAGAAGAAGAAAGATGG - Intronic
974543030 4:63263731-63263753 GATTAAAAGAAAAAGGAGGAGGG + Intergenic
976869550 4:89774475-89774497 GGTTAAGAGAAGCAGAAAGAAGG + Intronic
977129821 4:93222060-93222082 AAGTAAAAGAAGACGAAGGATGG - Intronic
978119869 4:105065518-105065540 CTGTGAAAGATGAAGAAGGAAGG + Intergenic
978291167 4:107142512-107142534 CTTTATAAGAAGAGGAAGAAAGG + Intronic
978660027 4:111114736-111114758 CTTCAAAAAAGGAAGAAGGAAGG - Intergenic
978823595 4:112993651-112993673 CATTAAAAGAAACAAAAGGAAGG + Intronic
979019562 4:115479007-115479029 TGTTATAGGAAGAAGAACGAGGG + Intergenic
979344744 4:119573926-119573948 CATTAAAAAAAGGAGAAGGGTGG + Intronic
979981331 4:127258885-127258907 AGTTCAAAGAGGAAGCAGGAGGG - Intergenic
980512161 4:133807827-133807849 TTTGAAAAGATGAAGAAGGATGG + Intergenic
980739638 4:136932433-136932455 CCTTAGTAGAACAAGAAGGAAGG + Intergenic
981369922 4:143948267-143948289 AGAGAGAAGAAGAAGAAGGAAGG - Intergenic
982105321 4:152006963-152006985 AGATAAAGGAAGAGGAAGGAAGG + Intergenic
982635444 4:157890177-157890199 CGTTAAAAATAAAACAAGGAAGG - Intergenic
982792130 4:159605371-159605393 CGTTAAAAAAAAGAGAAGTAGGG + Intergenic
983139514 4:164132190-164132212 CGTGAAACGAAGAAAGAGGAAGG - Intronic
983515480 4:168651706-168651728 CTTTACAAGAAGAAGAGGTAGGG + Intronic
983634519 4:169883522-169883544 CTTTATAAGAAGAAGAAGAGAGG + Intergenic
984078284 4:175211078-175211100 CCCCAAAAGAAGAAAAAGGAGGG + Intergenic
984364833 4:178785135-178785157 CTTTTGAAGAAGAAGTAGGAAGG - Intergenic
984886576 4:184455191-184455213 GGTTAGAAGAAGAAGGTGGAGGG - Intronic
984886609 4:184455287-184455309 AAAAAAAAGAAGAAGAAGGAAGG - Intronic
986009682 5:3700903-3700925 GAAGAAAAGAAGAAGAAGGAGGG - Intergenic
986342113 5:6799186-6799208 CATCAAAAAAAGGAGAAGGAAGG - Intergenic
986468506 5:8050689-8050711 CTGTATAAGAAGGAGAAGGAAGG + Intergenic
986832207 5:11592326-11592348 AGAAAAAAGAAGAGGAAGGAAGG - Intronic
986834195 5:11616609-11616631 CATCAAAAAAAAAAGAAGGAAGG - Intronic
986883515 5:12205393-12205415 TGTCAAAAAAAAAAGAAGGAAGG - Intergenic
987598664 5:20036396-20036418 CTTAAAAAGAAGAAAAAAGAAGG + Intronic
987695300 5:21321004-21321026 TTTTAAAAGAAGAAGAAATATGG + Intergenic
988830881 5:34986251-34986273 GCTAAAAAGAAGAAGAAGGGTGG + Intergenic
988969748 5:36455270-36455292 CGATAAAGGAAGAAGAGGCAAGG + Intergenic
989384023 5:40836854-40836876 CCTTAAAAGTAGGAGAAGGATGG - Intergenic
989948500 5:50268930-50268952 CAGTAACAGAAGAAGAAGAAAGG + Intergenic
990023455 5:51157285-51157307 CCTTAAAAGAAAAAGAGGAAAGG - Intergenic
990703831 5:58504628-58504650 CTTTAAAAGAAGAAGAATTCAGG + Intergenic
990947951 5:61269249-61269271 AGTTAAAATAGAAAGAAGGAAGG + Intergenic
991043479 5:62198509-62198531 AGTTTAAAGAAGCAGTAGGAGGG + Intergenic
991544987 5:67771741-67771763 GGAAAAAAGAAGAAAAAGGATGG + Intergenic
991960058 5:72035354-72035376 CTTTGAAAGAAGGAGGAGGAGGG - Intergenic
992046441 5:72895349-72895371 CATTAAAAAAAAAAAAAGGAGGG - Intronic
992246377 5:74828341-74828363 CTTTAAAAAAAGAAAAAAGAAGG - Intronic
992553239 5:77879410-77879432 AGTAAAAAGATGAAGAAGGCAGG - Intergenic
993064037 5:83076835-83076857 AGTTAAGAGAAGAAGGTGGAAGG + Intronic
993728877 5:91398982-91399004 CGTTTACAGAAGAAGGAGAATGG + Intergenic
994842278 5:104941021-104941043 GGAGAAAAGAAAAAGAAGGAAGG + Intergenic
995149003 5:108820428-108820450 CTTCAAAAGAAGAACAAGAAAGG + Intronic
995590717 5:113697022-113697044 CCTCAAAAGAAAAAAAAGGAGGG + Intergenic
996236164 5:121132826-121132848 CATTAAAAAGAGAGGAAGGAGGG + Intergenic
997203653 5:132027884-132027906 ACTTGAAAGAAGAAGAAGGAGGG - Intergenic
997915456 5:137920395-137920417 CTTTAAAATTAGAAAAAGGAAGG + Intronic
998102756 5:139448018-139448040 AGTATAAAGAAGAAGAAGAAGGG + Intergenic
998274370 5:140738306-140738328 AATAAAAAGAAGAATAAGGAAGG - Intergenic
998397683 5:141829424-141829446 CGTCAAAAAAAAAAAAAGGAAGG + Intergenic
998514470 5:142740128-142740150 AGATAAAAGAAGAAAGAGGAAGG - Intergenic
998604069 5:143615613-143615635 TCTTAAAAGGAGAAGAAAGAAGG - Intergenic
999132547 5:149295578-149295600 CGAAAAAAGAAAAAGAGGGAGGG + Intronic
999327125 5:150650313-150650335 CGTTACTTGAAGCAGAAGGAAGG - Exonic
999363283 5:151004180-151004202 ATTTAAAAAAAGAAGAAGGCTGG + Intergenic
1000253130 5:159513948-159513970 CGCTAACAGACGAAGGAGGAAGG + Intergenic
1000828252 5:166072966-166072988 CAATAAAAGAAGAAAAAGAAAGG + Intergenic
1000867454 5:166532539-166532561 TATTAAGAGAAGTAGAAGGAAGG + Intergenic
1001737804 5:174021087-174021109 AGAAAGAAGAAGAAGAAGGAAGG + Intergenic
1002660214 5:180786635-180786657 CGTTTTAGGAAGAAGGAGGAAGG - Intergenic
1002954748 6:1851165-1851187 AGATAAAAGAAGAAGAAGAATGG + Intronic
1003434944 6:6079438-6079460 CGTCAACTGAAGAAGAAGGGAGG + Intergenic
1003991714 6:11493042-11493064 CGATAAAAGAAGTAGAACGAAGG - Intergenic
1004158599 6:13193268-13193290 CTTTAAAGGAAAAACAAGGATGG - Intronic
1004410039 6:15372652-15372674 CCTTAAAAGAATAAGAAGAACGG - Intronic
1005489816 6:26337238-26337260 TGTTCAAAGCAGAAGAAGGATGG + Intergenic
1006056988 6:31392418-31392440 GGTATAAAGAAGCAGAAGGATGG + Intergenic
1006621196 6:35365439-35365461 TGTTAAAAAAAAAAGAATGAGGG - Intronic
1006683582 6:35814435-35814457 TGTTAACAGAAGGAGAAGGGAGG + Intronic
1007930884 6:45689756-45689778 CAAAAAAAGAAGAGGAAGGAAGG - Intergenic
1008260601 6:49361782-49361804 CTTAAAAAGAAGAAAAAGGTAGG - Intergenic
1008995586 6:57654624-57654646 CATTTAAAGCAAAAGAAGGAAGG - Intergenic
1009184113 6:60553402-60553424 CATTTAAAGCAAAAGAAGGAAGG - Intergenic
1009311376 6:62157053-62157075 TCTTAAAAGAATAAGAATGAGGG + Intronic
1009803984 6:68578702-68578724 AGGAAAAAGAAAAAGAAGGAAGG + Intergenic
1010928358 6:81770663-81770685 CTTTATAAGAAGAAGAGTGAGGG - Intergenic
1010964661 6:82190433-82190455 AGTTACAAGAAAAGGAAGGATGG + Intronic
1011052073 6:83163136-83163158 TTTTTAAAGAAGAAAAAGGAAGG + Intronic
1011266231 6:85522322-85522344 CTTTAGAAGAAGAACAAGGTTGG - Intronic
1012328044 6:97948505-97948527 GAATAAAAGAAGAGGAAGGAAGG + Intergenic
1013639141 6:112056428-112056450 CATCAAAAGAAGGAGGAGGAGGG - Intronic
1013874461 6:114806321-114806343 AAATAAAAAAAGAAGAAGGAAGG - Intergenic
1014265062 6:119268276-119268298 CTTTTAAAGAAGAAGAAGTCTGG - Intronic
1014503538 6:122224610-122224632 CTTTAAAAGAAGAGAAAGAAAGG - Intergenic
1014906489 6:127035783-127035805 CTTTAAAGTAAGAAGCAGGAAGG - Intergenic
1015592746 6:134838213-134838235 AGTTAAAAAAAAAAGAAGTATGG - Intergenic
1016467117 6:144336710-144336732 CTTTAAAAAAAAAAGAAAGAGGG - Intronic
1016694482 6:146976758-146976780 AGAAAAGAGAAGAAGAAGGATGG - Intergenic
1018240914 6:161773821-161773843 CAGAAAAAGAAGAAGAAGAAGGG + Intronic
1018539949 6:164868391-164868413 AGTTAAAGAAAGAACAAGGATGG - Intergenic
1018592003 6:165436450-165436472 GGTTAAATGAACAAGGAGGAAGG + Intronic
1018679324 6:166251519-166251541 CTTAAAAAGAAGAAGAAAAACGG - Intergenic
1019495860 7:1340372-1340394 GGTTAAAAAAAGAAGAAGAAAGG + Intergenic
1019649657 7:2150007-2150029 GGTGAAGAGAAGAACAAGGATGG - Intronic
1020796847 7:12687009-12687031 CGCTGAATGAAGAAGAGGGAAGG + Intronic
1020799665 7:12718113-12718135 CTCAAAAAAAAGAAGAAGGAAGG - Intergenic
1022247144 7:28571353-28571375 AGTTACAAGAAGGAGAAGCAGGG - Intronic
1023570169 7:41563653-41563675 CATTAAAATAAAAAGTAGGAAGG - Intergenic
1024851459 7:53722505-53722527 TGTAAAAAGAAAAAGAGGGATGG + Intergenic
1025011923 7:55404307-55404329 ATTTAAAAGAAGAAGAAAGAAGG - Intronic
1027025505 7:74849111-74849133 CATTACAAGAAGAAGAAGAAGGG - Intronic
1027062259 7:75095008-75095030 CATTACAAGAAGAAGAAGAAGGG + Intronic
1027482796 7:78719605-78719627 CGTTGAAAGTAAAAGAAAGAGGG - Intronic
1027844943 7:83361063-83361085 CTTTATAAGAAGAGGAAGGGAGG - Intergenic
1028163294 7:87509893-87509915 TCTTAACTGAAGAAGAAGGAGGG + Intronic
1028536471 7:91893240-91893262 AGTTAAAAGAGGGAGAAGAAAGG - Intergenic
1028840306 7:95422620-95422642 CATAAAAAGAAAAAGATGGAAGG + Intronic
1029025009 7:97407186-97407208 GGGGAAAAGAAGAAGAAAGAGGG + Intergenic
1029090746 7:98046200-98046222 CCTTATAAGAAGAGGAATGAGGG + Intergenic
1029236860 7:99127316-99127338 TGTTAAAAGAAAAAGAGGGAGGG + Intronic
1029623979 7:101708188-101708210 CGTTAAAAGAGCAATAAGGCTGG - Intergenic
1030006783 7:105128015-105128037 CATTGAAAGAAAAAGAAGGTAGG - Intronic
1030058924 7:105607699-105607721 AATTAAAAAAAGAAGAAGAAAGG + Exonic
1030167156 7:106566819-106566841 CGTTGAAAGAGGGAGAAGAAGGG - Intergenic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1030874205 7:114793180-114793202 AGTAAAAAGAAGAAGAAAGGGGG + Intergenic
1030996885 7:116370507-116370529 CTTTATAAGAAGAAGAAGAGAGG + Intronic
1031419572 7:121534520-121534542 CATGAAAAAAATAAGAAGGAGGG - Intergenic
1032810847 7:135415263-135415285 CTATAAAAGAAGAAGAAATAAGG + Intronic
1032974495 7:137206772-137206794 AGAGAAAAGAAAAAGAAGGAAGG - Intergenic
1033115155 7:138618756-138618778 AGAAAAAAGAAAAAGAAGGAAGG + Intronic
1033639495 7:143247611-143247633 AGAGAAAAGAAGAAGGAGGAAGG + Intronic
1033672027 7:143502436-143502458 TGTTTAAAGAAGAAGAAGTGTGG + Intergenic
1033706172 7:143886661-143886683 CATTAAAAGAGCATGAAGGAAGG - Intronic
1033928047 7:146488320-146488342 CATTAAAGCAAGAGGAAGGAAGG - Intronic
1036190320 8:6664138-6664160 TGTTAAAAGAAATAAAAGGACGG + Intergenic
1036908916 8:12735489-12735511 ATTTAAAGGAGGAAGAAGGAGGG + Intronic
1037307390 8:17519887-17519909 GGTTCACAGAAGAAGAAGCAGGG - Intronic
1037660563 8:20922910-20922932 AGACAAAAGAAGAAAAAGGATGG - Intergenic
1037864727 8:22434484-22434506 CATTAAAAGAAAAAAAAAGAAGG + Intergenic
1038013842 8:23496849-23496871 TGTTAAAATAAAAAAAAGGAGGG + Intergenic
1038795226 8:30703747-30703769 AGGAGAAAGAAGAAGAAGGAAGG + Intronic
1038799176 8:30733693-30733715 CTTTAAAAGAAAAATAAGGCTGG - Intronic
1039023233 8:33229964-33229986 AAATAAAAGAAGAAGAAGTAGGG + Intergenic
1039146736 8:34455675-34455697 CCTTATAAGAAGAAGAAATATGG + Intergenic
1041121392 8:54590035-54590057 CTTTCATAGAAGCAGAAGGAAGG - Intergenic
1042089651 8:65144868-65144890 GTTGAAAAGAGGAAGAAGGAAGG - Intergenic
1042198980 8:66260842-66260864 TGTTAAAAGAAGGAGAAGAGAGG + Intergenic
1042263366 8:66883356-66883378 TCTTAAAAGGAGAAGAATGAGGG + Intronic
1042409068 8:68441493-68441515 ATTTTAAAGAAGAAGAAAGAAGG - Intronic
1042949804 8:74189211-74189233 AGGAAAAAGAAGAAGAAAGAAGG - Intergenic
1043671468 8:82890400-82890422 CTTAAAAAGAAGAAGATGGAGGG - Intergenic
1043839506 8:85086201-85086223 GTTTAAAAAATGAAGAAGGACGG + Intergenic
1044077848 8:87845709-87845731 CCTGAAAAGAAGAAAAAGGTTGG + Intergenic
1044971032 8:97620000-97620022 CATTAAAATAATAATAAGGATGG + Intergenic
1045648538 8:104322337-104322359 CATTAAACCAAGAAGAAGGCGGG - Intergenic
1046091526 8:109508475-109508497 CATTAAAATAAAAAGAAGGAGGG + Intronic
1046344134 8:112900724-112900746 CTTTAAAAGAAGAAGAATGAGGG + Intronic
1046705131 8:117441165-117441187 CTTTAAAAGTGGAAGAAGGTGGG - Intergenic
1046790257 8:118314270-118314292 AGTTAAAAAAAGAAGAAAGCTGG - Intronic
1046934964 8:119876643-119876665 AAAAAAAAGAAGAAGAAGGATGG + Intronic
1047127082 8:121974513-121974535 AGGAAAAAGAAGAAGAAGGAAGG - Intergenic
1047469616 8:125157114-125157136 CATTGACAAAAGAAGAAGGAGGG + Intronic
1047790882 8:128202466-128202488 TGTTAACACAAGAAGGAGGAAGG + Intergenic
1048285546 8:133138442-133138464 CCTTAAAAGTAGAAGAGGGAGGG + Intergenic
1049029052 8:140019850-140019872 CTTAAAAAGAAGAAAAATGACGG - Intronic
1049969056 9:805590-805612 TCTTAAAAAAAGAAAAAGGAAGG + Intergenic
1050754142 9:8978965-8978987 CATTAAAAAAAGAATAAAGATGG - Intronic
1050801960 9:9626538-9626560 TGGAAAAAGAAGAGGAAGGAAGG + Intronic
1051247515 9:15126686-15126708 GGAGAAAGGAAGAAGAAGGAAGG + Intergenic
1051356542 9:16244320-16244342 CCTTAAAAGAAGGAGAAGCTGGG - Intronic
1051972123 9:22901608-22901630 CCTTATAAGAAGAAGAAAGAGGG + Intergenic
1052172886 9:25423991-25424013 CTTTAAAATAAGAAAAACGAAGG + Intergenic
1052565443 9:30144071-30144093 TCTGAACAGAAGAAGAAGGAGGG - Intergenic
1052906971 9:33843769-33843791 AGTTAAAACAAGAAGTAGGCTGG - Intronic
1053153699 9:35758963-35758985 GGGTAATAGAAGAGGAAGGAAGG - Intergenic
1055527783 9:77152745-77152767 CTCTCAAAGAAGAAGAAAGAAGG - Intergenic
1055725751 9:79226394-79226416 TTTTAAAAGGAGAAGGAGGAAGG - Intergenic
1055739230 9:79367664-79367686 GGATAAAATAAGAAGAAGAAAGG + Intergenic
1055925017 9:81500968-81500990 CGTGAAAAGAATAATAAGAATGG - Intergenic
1056472046 9:86915112-86915134 AGTAAAAAGAGAAAGAAGGAGGG + Intergenic
1056730089 9:89158040-89158062 GGTTAAAGCAAGCAGAAGGAAGG - Intronic
1057743276 9:97731348-97731370 TGTTATAAGAAGAATAAGTACGG - Intergenic
1057954232 9:99395166-99395188 AGATAAAAGAAGAATAAGAATGG - Intergenic
1059876946 9:118645443-118645465 TGTTGAAGAAAGAAGAAGGAAGG - Intergenic
1059905963 9:118986551-118986573 CGATGAAAGAAGAAGAACAAAGG + Intergenic
1060527866 9:124330657-124330679 TGCTCAAGGAAGAAGAAGGAAGG - Intronic
1060671049 9:125469951-125469973 TGTCAAAATAAGAAGAAGAAGGG - Intronic
1060760385 9:126242463-126242485 ACTTAAAAAAAGAAGAATGAAGG - Intergenic
1061617378 9:131789231-131789253 TGTCAAAAAAAGAAGAAGGAAGG - Intergenic
1186594858 X:10970007-10970029 AGGTATAAGAAGAACAAGGAGGG - Intergenic
1187526904 X:20062478-20062500 CTTTAAAAAAAAAAGAAGGAAGG + Intronic
1187613231 X:20965580-20965602 TTTTAAAAAAAGAAGAAGAAAGG + Intergenic
1187832691 X:23398901-23398923 CGTGGAAGGAAGAAGAAGGGAGG + Exonic
1188366801 X:29325862-29325884 GGTTAAGAGAGGAAGAATGAGGG + Intronic
1189366680 X:40394285-40394307 CCTCAAAAAAAAAAGAAGGAAGG + Intergenic
1190908379 X:54750197-54750219 ATTTAAAGGAGGAAGAAGGAGGG + Intronic
1191204198 X:57816941-57816963 GGTGAAAAGGAGAAGAGGGAGGG + Intergenic
1194894889 X:99428545-99428567 CTATAAAAGATGAAAAAGGATGG + Intergenic
1195176222 X:102317805-102317827 GGTAAAAAGAAGAAATAGGAGGG - Intronic
1195182642 X:102369288-102369310 GGTAAAAAGAAGAAATAGGAGGG + Intronic
1195336230 X:103857513-103857535 GGTGACAAGAAGAAGAAGGCGGG + Intergenic
1196313858 X:114199645-114199667 AGGAAAAAGAAAAAGAAGGAGGG + Intergenic
1197398863 X:125963951-125963973 GGTTATAACAAGAAGAAAGAAGG + Intergenic
1198428607 X:136543788-136543810 CATTAAAAGATGCAGAAAGAGGG + Intronic
1198896335 X:141459744-141459766 AGATGAAAAAAGAAGAAGGAAGG + Intergenic
1199497022 X:148464019-148464041 CATGAACAGAAGCAGAAGGAGGG - Intergenic
1199751592 X:150824495-150824517 AGAAAGAAGAAGAAGAAGGAAGG + Intronic
1200174303 X:154101786-154101808 CGAAAAAAGAAAGAGAAGGAAGG + Intergenic
1200312440 X:155091791-155091813 CGTTAAAAAAAAAAAAAGCAAGG + Intronic
1200513274 Y:4107463-4107485 AGATAAAAGAAGAAGAGGTAGGG - Intergenic