ID: 1121006511

View in Genome Browser
Species Human (GRCh38)
Location 14:90494130-90494152
Sequence GAGTCCCGTGTCTCTGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121006511_1121006517 5 Left 1121006511 14:90494130-90494152 CCTACCCCAGAGACACGGGACTC No data
Right 1121006517 14:90494158-90494180 GATCTTATATGGTCATGTGATGG No data
1121006511_1121006516 -6 Left 1121006511 14:90494130-90494152 CCTACCCCAGAGACACGGGACTC No data
Right 1121006516 14:90494147-90494169 GGACTCTTCAGGATCTTATATGG No data
1121006511_1121006519 14 Left 1121006511 14:90494130-90494152 CCTACCCCAGAGACACGGGACTC No data
Right 1121006519 14:90494167-90494189 TGGTCATGTGATGGATATGTGGG No data
1121006511_1121006518 13 Left 1121006511 14:90494130-90494152 CCTACCCCAGAGACACGGGACTC No data
Right 1121006518 14:90494166-90494188 ATGGTCATGTGATGGATATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121006511 Original CRISPR GAGTCCCGTGTCTCTGGGGT AGG (reversed) Intergenic
No off target data available for this crispr