ID: 1121010024

View in Genome Browser
Species Human (GRCh38)
Location 14:90514381-90514403
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121010024_1121010033 2 Left 1121010024 14:90514381-90514403 CCTCCTGGAACCCCAGGTACTGG No data
Right 1121010033 14:90514406-90514428 GCCGACTCCATGCCAGGCTGGGG No data
1121010024_1121010037 9 Left 1121010024 14:90514381-90514403 CCTCCTGGAACCCCAGGTACTGG No data
Right 1121010037 14:90514413-90514435 CCATGCCAGGCTGGGGAAATGGG No data
1121010024_1121010030 -4 Left 1121010024 14:90514381-90514403 CCTCCTGGAACCCCAGGTACTGG No data
Right 1121010030 14:90514400-90514422 CTGGCAGCCGACTCCATGCCAGG No data
1121010024_1121010032 1 Left 1121010024 14:90514381-90514403 CCTCCTGGAACCCCAGGTACTGG No data
Right 1121010032 14:90514405-90514427 AGCCGACTCCATGCCAGGCTGGG No data
1121010024_1121010031 0 Left 1121010024 14:90514381-90514403 CCTCCTGGAACCCCAGGTACTGG No data
Right 1121010031 14:90514404-90514426 CAGCCGACTCCATGCCAGGCTGG No data
1121010024_1121010038 10 Left 1121010024 14:90514381-90514403 CCTCCTGGAACCCCAGGTACTGG No data
Right 1121010038 14:90514414-90514436 CATGCCAGGCTGGGGAAATGGGG No data
1121010024_1121010035 8 Left 1121010024 14:90514381-90514403 CCTCCTGGAACCCCAGGTACTGG No data
Right 1121010035 14:90514412-90514434 TCCATGCCAGGCTGGGGAAATGG No data
1121010024_1121010041 19 Left 1121010024 14:90514381-90514403 CCTCCTGGAACCCCAGGTACTGG No data
Right 1121010041 14:90514423-90514445 CTGGGGAAATGGGGTGAGGATGG No data
1121010024_1121010040 15 Left 1121010024 14:90514381-90514403 CCTCCTGGAACCCCAGGTACTGG No data
Right 1121010040 14:90514419-90514441 CAGGCTGGGGAAATGGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121010024 Original CRISPR CCAGTACCTGGGGTTCCAGG AGG (reversed) Intergenic
No off target data available for this crispr