ID: 1121010034

View in Genome Browser
Species Human (GRCh38)
Location 14:90514407-90514429
Sequence TCCCCAGCCTGGCATGGAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121010034_1121010041 -7 Left 1121010034 14:90514407-90514429 CCGACTCCATGCCAGGCTGGGGA No data
Right 1121010041 14:90514423-90514445 CTGGGGAAATGGGGTGAGGATGG No data
1121010034_1121010042 12 Left 1121010034 14:90514407-90514429 CCGACTCCATGCCAGGCTGGGGA No data
Right 1121010042 14:90514442-90514464 ATGGTGCAATCCCTGCCTAGAGG No data
1121010034_1121010043 13 Left 1121010034 14:90514407-90514429 CCGACTCCATGCCAGGCTGGGGA No data
Right 1121010043 14:90514443-90514465 TGGTGCAATCCCTGCCTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121010034 Original CRISPR TCCCCAGCCTGGCATGGAGT CGG (reversed) Intergenic
No off target data available for this crispr