ID: 1121010041

View in Genome Browser
Species Human (GRCh38)
Location 14:90514423-90514445
Sequence CTGGGGAAATGGGGTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121010028_1121010041 8 Left 1121010028 14:90514392-90514414 CCCAGGTACTGGCAGCCGACTCC No data
Right 1121010041 14:90514423-90514445 CTGGGGAAATGGGGTGAGGATGG No data
1121010026_1121010041 16 Left 1121010026 14:90514384-90514406 CCTGGAACCCCAGGTACTGGCAG No data
Right 1121010041 14:90514423-90514445 CTGGGGAAATGGGGTGAGGATGG No data
1121010024_1121010041 19 Left 1121010024 14:90514381-90514403 CCTCCTGGAACCCCAGGTACTGG No data
Right 1121010041 14:90514423-90514445 CTGGGGAAATGGGGTGAGGATGG No data
1121010029_1121010041 7 Left 1121010029 14:90514393-90514415 CCAGGTACTGGCAGCCGACTCCA No data
Right 1121010041 14:90514423-90514445 CTGGGGAAATGGGGTGAGGATGG No data
1121010034_1121010041 -7 Left 1121010034 14:90514407-90514429 CCGACTCCATGCCAGGCTGGGGA No data
Right 1121010041 14:90514423-90514445 CTGGGGAAATGGGGTGAGGATGG No data
1121010027_1121010041 9 Left 1121010027 14:90514391-90514413 CCCCAGGTACTGGCAGCCGACTC No data
Right 1121010041 14:90514423-90514445 CTGGGGAAATGGGGTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121010041 Original CRISPR CTGGGGAAATGGGGTGAGGA TGG Intergenic
No off target data available for this crispr