ID: 1121010043

View in Genome Browser
Species Human (GRCh38)
Location 14:90514443-90514465
Sequence TGGTGCAATCCCTGCCTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121010034_1121010043 13 Left 1121010034 14:90514407-90514429 CCGACTCCATGCCAGGCTGGGGA No data
Right 1121010043 14:90514443-90514465 TGGTGCAATCCCTGCCTAGAGGG No data
1121010027_1121010043 29 Left 1121010027 14:90514391-90514413 CCCCAGGTACTGGCAGCCGACTC No data
Right 1121010043 14:90514443-90514465 TGGTGCAATCCCTGCCTAGAGGG No data
1121010029_1121010043 27 Left 1121010029 14:90514393-90514415 CCAGGTACTGGCAGCCGACTCCA No data
Right 1121010043 14:90514443-90514465 TGGTGCAATCCCTGCCTAGAGGG No data
1121010039_1121010043 2 Left 1121010039 14:90514418-90514440 CCAGGCTGGGGAAATGGGGTGAG No data
Right 1121010043 14:90514443-90514465 TGGTGCAATCCCTGCCTAGAGGG No data
1121010028_1121010043 28 Left 1121010028 14:90514392-90514414 CCCAGGTACTGGCAGCCGACTCC No data
Right 1121010043 14:90514443-90514465 TGGTGCAATCCCTGCCTAGAGGG No data
1121010036_1121010043 7 Left 1121010036 14:90514413-90514435 CCATGCCAGGCTGGGGAAATGGG No data
Right 1121010043 14:90514443-90514465 TGGTGCAATCCCTGCCTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121010043 Original CRISPR TGGTGCAATCCCTGCCTAGA GGG Intergenic
No off target data available for this crispr