ID: 1121010563

View in Genome Browser
Species Human (GRCh38)
Location 14:90517770-90517792
Sequence CCTTTGAGAGAGCGGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121010563_1121010576 30 Left 1121010563 14:90517770-90517792 CCTGCCACCCGCTCTCTCAAAGG No data
Right 1121010576 14:90517823-90517845 TTTTTTTTTTCTTCGAGACAGGG No data
1121010563_1121010575 29 Left 1121010563 14:90517770-90517792 CCTGCCACCCGCTCTCTCAAAGG No data
Right 1121010575 14:90517822-90517844 CTTTTTTTTTTCTTCGAGACAGG No data
1121010563_1121010571 -9 Left 1121010563 14:90517770-90517792 CCTGCCACCCGCTCTCTCAAAGG No data
Right 1121010571 14:90517784-90517806 TCTCAAAGGGAAGGGCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121010563 Original CRISPR CCTTTGAGAGAGCGGGTGGC AGG (reversed) Intergenic
No off target data available for this crispr