ID: 1121010571

View in Genome Browser
Species Human (GRCh38)
Location 14:90517784-90517806
Sequence TCTCAAAGGGAAGGGCCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121010557_1121010571 11 Left 1121010557 14:90517750-90517772 CCCTTCACACCCAGCCACTCCCT No data
Right 1121010571 14:90517784-90517806 TCTCAAAGGGAAGGGCCACCAGG No data
1121010563_1121010571 -9 Left 1121010563 14:90517770-90517792 CCTGCCACCCGCTCTCTCAAAGG No data
Right 1121010571 14:90517784-90517806 TCTCAAAGGGAAGGGCCACCAGG No data
1121010561_1121010571 -3 Left 1121010561 14:90517764-90517786 CCACTCCCTGCCACCCGCTCTCT No data
Right 1121010571 14:90517784-90517806 TCTCAAAGGGAAGGGCCACCAGG No data
1121010559_1121010571 2 Left 1121010559 14:90517759-90517781 CCCAGCCACTCCCTGCCACCCGC No data
Right 1121010571 14:90517784-90517806 TCTCAAAGGGAAGGGCCACCAGG No data
1121010562_1121010571 -8 Left 1121010562 14:90517769-90517791 CCCTGCCACCCGCTCTCTCAAAG No data
Right 1121010571 14:90517784-90517806 TCTCAAAGGGAAGGGCCACCAGG No data
1121010558_1121010571 10 Left 1121010558 14:90517751-90517773 CCTTCACACCCAGCCACTCCCTG No data
Right 1121010571 14:90517784-90517806 TCTCAAAGGGAAGGGCCACCAGG No data
1121010560_1121010571 1 Left 1121010560 14:90517760-90517782 CCAGCCACTCCCTGCCACCCGCT No data
Right 1121010571 14:90517784-90517806 TCTCAAAGGGAAGGGCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121010571 Original CRISPR TCTCAAAGGGAAGGGCCACC AGG Intergenic
No off target data available for this crispr