ID: 1121010575

View in Genome Browser
Species Human (GRCh38)
Location 14:90517822-90517844
Sequence CTTTTTTTTTTCTTCGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121010563_1121010575 29 Left 1121010563 14:90517770-90517792 CCTGCCACCCGCTCTCTCAAAGG No data
Right 1121010575 14:90517822-90517844 CTTTTTTTTTTCTTCGAGACAGG No data
1121010572_1121010575 0 Left 1121010572 14:90517799-90517821 CCACCAGGATCTACTGCCACACT No data
Right 1121010575 14:90517822-90517844 CTTTTTTTTTTCTTCGAGACAGG No data
1121010562_1121010575 30 Left 1121010562 14:90517769-90517791 CCCTGCCACCCGCTCTCTCAAAG No data
Right 1121010575 14:90517822-90517844 CTTTTTTTTTTCTTCGAGACAGG No data
1121010573_1121010575 -3 Left 1121010573 14:90517802-90517824 CCAGGATCTACTGCCACACTCTT No data
Right 1121010575 14:90517822-90517844 CTTTTTTTTTTCTTCGAGACAGG No data
1121010570_1121010575 21 Left 1121010570 14:90517778-90517800 CCGCTCTCTCAAAGGGAAGGGCC No data
Right 1121010575 14:90517822-90517844 CTTTTTTTTTTCTTCGAGACAGG No data
1121010569_1121010575 22 Left 1121010569 14:90517777-90517799 CCCGCTCTCTCAAAGGGAAGGGC No data
Right 1121010575 14:90517822-90517844 CTTTTTTTTTTCTTCGAGACAGG No data
1121010566_1121010575 25 Left 1121010566 14:90517774-90517796 CCACCCGCTCTCTCAAAGGGAAG No data
Right 1121010575 14:90517822-90517844 CTTTTTTTTTTCTTCGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121010575 Original CRISPR CTTTTTTTTTTCTTCGAGAC AGG Intergenic
No off target data available for this crispr