ID: 1121010576

View in Genome Browser
Species Human (GRCh38)
Location 14:90517823-90517845
Sequence TTTTTTTTTTCTTCGAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121010570_1121010576 22 Left 1121010570 14:90517778-90517800 CCGCTCTCTCAAAGGGAAGGGCC No data
Right 1121010576 14:90517823-90517845 TTTTTTTTTTCTTCGAGACAGGG No data
1121010569_1121010576 23 Left 1121010569 14:90517777-90517799 CCCGCTCTCTCAAAGGGAAGGGC No data
Right 1121010576 14:90517823-90517845 TTTTTTTTTTCTTCGAGACAGGG No data
1121010566_1121010576 26 Left 1121010566 14:90517774-90517796 CCACCCGCTCTCTCAAAGGGAAG No data
Right 1121010576 14:90517823-90517845 TTTTTTTTTTCTTCGAGACAGGG No data
1121010563_1121010576 30 Left 1121010563 14:90517770-90517792 CCTGCCACCCGCTCTCTCAAAGG No data
Right 1121010576 14:90517823-90517845 TTTTTTTTTTCTTCGAGACAGGG No data
1121010573_1121010576 -2 Left 1121010573 14:90517802-90517824 CCAGGATCTACTGCCACACTCTT No data
Right 1121010576 14:90517823-90517845 TTTTTTTTTTCTTCGAGACAGGG No data
1121010572_1121010576 1 Left 1121010572 14:90517799-90517821 CCACCAGGATCTACTGCCACACT No data
Right 1121010576 14:90517823-90517845 TTTTTTTTTTCTTCGAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121010576 Original CRISPR TTTTTTTTTTCTTCGAGACA GGG Intergenic
No off target data available for this crispr