ID: 1121013369

View in Genome Browser
Species Human (GRCh38)
Location 14:90534572-90534594
Sequence CTGTCGGCCTTGAGAGGTGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121013361_1121013369 -2 Left 1121013361 14:90534551-90534573 CCTCACTGGGCAATGCCCACCCT 0: 1
1: 0
2: 3
3: 15
4: 211
Right 1121013369 14:90534572-90534594 CTGTCGGCCTTGAGAGGTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 147
1121013360_1121013369 -1 Left 1121013360 14:90534550-90534572 CCCTCACTGGGCAATGCCCACCC 0: 1
1: 0
2: 0
3: 14
4: 188
Right 1121013369 14:90534572-90534594 CTGTCGGCCTTGAGAGGTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 147
1121013359_1121013369 0 Left 1121013359 14:90534549-90534571 CCCCTCACTGGGCAATGCCCACC 0: 1
1: 0
2: 1
3: 16
4: 198
Right 1121013369 14:90534572-90534594 CTGTCGGCCTTGAGAGGTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121013369 Original CRISPR CTGTCGGCCTTGAGAGGTGG TGG Exonic
900588007 1:3442719-3442741 CTGTTGGCCTGGGGAGCTGGAGG + Intergenic
902555880 1:17246314-17246336 CTGTTGTCCCTGAGAGATGGAGG - Intergenic
902868374 1:19296313-19296335 CTGTTGAACTTGGGAGGTGGAGG - Intergenic
903682553 1:25106891-25106913 CTGTCCTCCTTGGGAGATGGTGG - Intergenic
904856292 1:33500427-33500449 CTCTCAGCTTTGAGAAGTGGGGG - Intergenic
918212044 1:182359786-182359808 CTGTTGACCCTGAGAGGAGGAGG - Intergenic
919258893 1:195163224-195163246 GTGACAGTCTTGAGAGGTGGTGG + Intergenic
922013952 1:221623837-221623859 CTGTCAGCCTTGGGAAGCGGAGG - Intergenic
924368982 1:243327077-243327099 CTGTAGGTCTTGAGAAGTTGGGG - Intronic
1064000335 10:11658466-11658488 GTTTGAGCCTTGAGAGGTGGAGG + Intergenic
1066157449 10:32693064-32693086 CTATTGGACATGAGAGGTGGAGG - Intronic
1067100934 10:43334023-43334045 CTTTGGGCTTTGGGAGGTGGAGG + Intergenic
1069769735 10:70890571-70890593 CTCACGGGCTTGGGAGGTGGTGG - Intergenic
1070727047 10:78799620-78799642 CTGTCGCCCTTGACAGGTGCAGG + Intergenic
1076495594 10:130895532-130895554 CTGTGGGACAGGAGAGGTGGGGG + Intergenic
1076904383 10:133354951-133354973 CTGGAGGCCTTGAGAGGGGTGGG - Intergenic
1078427324 11:11262290-11262312 CTGACAGCCTTGTGTGGTGGAGG + Intergenic
1081629141 11:44676395-44676417 CTGTTGGACCTGGGAGGTGGAGG - Intergenic
1081712210 11:45224627-45224649 CTGTCGGCCTTGAATGATGAAGG - Exonic
1083937472 11:65877563-65877585 ATGTCAGCCCTCAGAGGTGGAGG - Intergenic
1087294254 11:96351269-96351291 CGGTTGACCTTGGGAGGTGGAGG + Intergenic
1088411469 11:109539358-109539380 CTGTGGGCCTGGAGCTGTGGTGG - Intergenic
1089286017 11:117408656-117408678 CTGTCGCCCTTGTGATGTGTGGG - Intronic
1090069464 11:123530907-123530929 CTGTTTGCCTTGGGTGGTGGTGG + Intronic
1092477042 12:8828375-8828397 CTGTGGGCCTGGAGTAGTGGTGG - Intronic
1093125496 12:15322973-15322995 CTGGTGGTCTTGAGAGGTAGGGG + Intronic
1096702989 12:53399444-53399466 CTGTCAGCCTTGAGAGTAGCTGG + Intronic
1097237799 12:57551558-57551580 CTGTAGGGCTTGAGGGGTGCTGG + Intronic
1097869000 12:64584686-64584708 CGGTCACCCTTGGGAGGTGGAGG + Intergenic
1098306640 12:69109125-69109147 ATGGCTGCCTTCAGAGGTGGAGG - Intergenic
1098477291 12:70920392-70920414 GTGTTTGCATTGAGAGGTGGAGG + Exonic
1099024552 12:77448591-77448613 CTGTGGGCCTGGGGTGGTGGTGG + Intergenic
1103322745 12:120101407-120101429 TTGCCGGCCCTGAGAGGTGCGGG - Intronic
1104378335 12:128285057-128285079 TTGTTGACCTTCAGAGGTGGAGG + Intronic
1104929299 12:132329646-132329668 GGGGCGGCCTTGAGGGGTGGGGG - Intergenic
1105818113 13:24055411-24055433 CTGTCTGCCTAGGGAGATGGAGG + Intronic
1106761437 13:32872548-32872570 CTGACAGCCTGGAGAGGAGGTGG - Intergenic
1109198908 13:59409548-59409570 GTGTCCCCCTTGAGAGGTGGTGG - Intergenic
1112214415 13:97415400-97415422 CACTTGGACTTGAGAGGTGGAGG + Intergenic
1113535741 13:111064947-111064969 CTCTCAGCCTTGAAATGTGGAGG + Intergenic
1116192631 14:41679983-41680005 CTGAGGGCCTGGAGTGGTGGCGG + Intronic
1116193547 14:41690469-41690491 CTTGCGCCCTTGGGAGGTGGAGG + Intronic
1117008286 14:51444628-51444650 CTGTCTGCCTTGAATGGTGATGG + Intergenic
1118241113 14:64059928-64059950 CTGTGGGCCTGTAGTGGTGGTGG - Intronic
1121013369 14:90534572-90534594 CTGTCGGCCTTGAGAGGTGGTGG + Exonic
1123031870 14:105455817-105455839 CTGTCTGCCTGGAGAGATGTGGG - Intronic
1124081340 15:26501079-26501101 CTGTGGGCCTATAGTGGTGGTGG - Intergenic
1125404430 15:39337884-39337906 CTGAAGGCCTGGAAAGGTGGTGG - Intergenic
1133521619 16:6563740-6563762 CAGTAGGGCTTGGGAGGTGGAGG + Intronic
1135520418 16:23172695-23172717 CTGGCTGCCTTGTGAGCTGGAGG - Intergenic
1137665593 16:50247143-50247165 CTTTGGGCCCTGAGAGGAGGGGG + Intronic
1138562105 16:57807416-57807438 CAGTGGGCATGGAGAGGTGGTGG + Intronic
1140176751 16:72668432-72668454 AAGTAGGCCTGGAGAGGTGGTGG + Intergenic
1141869637 16:86775832-86775854 ATGTCGCCCTTGCAAGGTGGGGG - Intergenic
1143030805 17:3965973-3965995 CTCTTGGACCTGAGAGGTGGAGG - Intergenic
1143172854 17:4940012-4940034 GTGTCGGACCTGAGAGCTGGAGG - Exonic
1146025772 17:29319506-29319528 CACTTGACCTTGAGAGGTGGAGG + Intergenic
1146683212 17:34823359-34823381 CTGACAACCCTGAGAGGTGGTGG - Intergenic
1148134434 17:45283225-45283247 CTGTCCCTCTTGAGAGGTGGTGG - Intronic
1148338212 17:46855780-46855802 CTGTTGAACTTGGGAGGTGGAGG - Intronic
1149868239 17:60162249-60162271 GTGGCGGCCTCGGGAGGTGGGGG - Intronic
1150032360 17:61752974-61752996 GTGGCAGCATTGAGAGGTGGGGG + Intronic
1151922745 17:77169847-77169869 CTGTTGGAGTTGACAGGTGGAGG + Intronic
1152025616 17:77807178-77807200 CTGTGGGGCCTGAGAGGTTGGGG + Intergenic
1152225418 17:79090499-79090521 CTGTCTGTCTTGGGAGTTGGGGG + Intronic
1152240379 17:79157722-79157744 CTGCCAGCCTTAAGAGGTGGTGG - Intronic
1153183177 18:2459054-2459076 CTGTGGGCCTTGAGCTGTGCTGG - Intergenic
1155242682 18:23878702-23878724 CTTTGGACCTTGAGAGGTGGAGG - Intronic
1156382032 18:36571943-36571965 CTGTGGGTCATGAGAAGTGGTGG - Intronic
1157806454 18:50661561-50661583 CTGTTGGCATTCAGGGGTGGAGG + Intronic
1158992142 18:62879972-62879994 CTGGCGGCATTGGGGGGTGGGGG - Intronic
1161046341 19:2136797-2136819 CTGGTGGGCTTGTGAGGTGGAGG - Intronic
1163273347 19:16267288-16267310 CACTTGACCTTGAGAGGTGGAGG + Intergenic
1163764314 19:19154055-19154077 CTGTGGGCCTTCTGAGCTGGAGG + Intronic
1164759557 19:30718875-30718897 CTGGTGCCCTGGAGAGGTGGAGG + Intergenic
1164790796 19:30978806-30978828 CTGGCAGCCTTGAGTTGTGGGGG + Intergenic
1165946108 19:39443609-39443631 CTCTTGAACTTGAGAGGTGGAGG - Intronic
1167169783 19:47823475-47823497 CTGCCGGCCATGAGACCTGGGGG - Intronic
925317995 2:2939974-2939996 CTGTCGGCCTTCTGAGCGGGCGG - Intergenic
926532653 2:14069793-14069815 CTGGCAGCCTCGAGAGGAGGTGG - Intergenic
930487701 2:52028052-52028074 CTGTTGAACTTGGGAGGTGGAGG - Intergenic
932005450 2:67922604-67922626 CTGTTGGCCTTGAGGGGAGAAGG + Intergenic
936141433 2:109945435-109945457 CTGTTGGCCTGGAGAAGTTGAGG + Intergenic
936178122 2:110243383-110243405 CTGTTGGCCTGGAGAAGTTGAGG + Intergenic
936203260 2:110426048-110426070 CTGTTGGCCTGGAGAAGTTGAGG - Intronic
936600317 2:113889398-113889420 AGGTCGGCCCTGGGAGGTGGGGG + Intergenic
938108373 2:128548561-128548583 CTGTGGGGCCTGAGGGGTGGAGG - Intergenic
939752755 2:146067838-146067860 CTGTGGTCCTTGAGAGAAGGAGG + Intergenic
943067567 2:183105208-183105230 CTGTGGGCCTGGAGCAGTGGTGG - Intergenic
944632730 2:201643320-201643342 GCGTCGGCCTCGAGAGGTGGCGG - Intronic
948891768 2:240910226-240910248 GTGACTGCCTTGAGGGGTGGGGG + Intergenic
948903422 2:240967126-240967148 CTGCAGGCCTGGGGAGGTGGAGG - Intronic
1175874589 20:62223388-62223410 AGGTGGGCCTTGGGAGGTGGGGG - Intergenic
1176635456 21:9188703-9188725 CTGTCCTCCTTGAGCTGTGGTGG + Intergenic
1177592269 21:23185716-23185738 CTGTGGGCCTGGAGTAGTGGTGG + Intergenic
1184376601 22:44117375-44117397 CTGTGGGCCATGGGGGGTGGGGG + Intronic
1184661124 22:45966041-45966063 CCGTCTGCCTTGGTAGGTGGTGG - Intronic
1185371835 22:50464566-50464588 CTCTCGGCCTTCACAGCTGGGGG + Exonic
960423869 3:117482358-117482380 CTGTGGGACTTGAGAGGAAGAGG + Intergenic
961451014 3:127002327-127002349 CTGTCGGCTGGGAGAGGGGGAGG - Intronic
961986278 3:131138280-131138302 CTGTAGGCCTGTAGTGGTGGTGG + Intronic
968481057 4:833258-833280 GTGTGAGCCATGAGAGGTGGCGG + Intergenic
968883010 4:3310716-3310738 CTGTGGGCACTGTGAGGTGGTGG + Intronic
969690500 4:8701577-8701599 CAGACGCCCTTCAGAGGTGGGGG + Intergenic
969959176 4:10925870-10925892 CTGGAGGCTTTGGGAGGTGGTGG + Intergenic
970254735 4:14155567-14155589 CAGTGGGCGTTGAGAGGAGGTGG + Intergenic
971244106 4:24912995-24913017 CTGGCGGCCGCGAGAGGCGGCGG - Intronic
974008414 4:56584215-56584237 CCCTCTGCCTTGAAAGGTGGAGG - Intronic
974801057 4:66818681-66818703 CTGTCGGGAGTGGGAGGTGGGGG + Intergenic
983912338 4:173253612-173253634 CAGTAGGCCTTGGGAGGTGATGG + Intronic
985321071 4:188711511-188711533 CTCTCTCCCTTGAGAGCTGGAGG - Intergenic
985641071 5:1063750-1063772 CTGTGGGCCTCGTGAGGTGGGGG - Intronic
989804682 5:45588539-45588561 GTGTCGGCATTTAGAGGAGGGGG - Intronic
991254149 5:64596311-64596333 CTGTCTGCCTTGAGAGATCATGG + Intronic
996017224 5:118553168-118553190 CTGTCAGCCTTCAGGGATGGTGG - Intergenic
996757374 5:126948924-126948946 TTGTCGGCCTACAGTGGTGGAGG + Intronic
1000064714 5:157684566-157684588 CTGTGGCCCTGGAGAGGAGGAGG - Intergenic
1002284311 5:178152094-178152116 CTGTAGTCCTGGAGAGGTGATGG - Intronic
1002544891 5:179934198-179934220 CTGGCGGCATGGAAAGGTGGTGG + Intronic
1007072639 6:39048554-39048576 CTGTCGGCGCTCAGAGCTGGTGG + Intergenic
1012930571 6:105311772-105311794 CTGTCAGCATTGATGGGTGGAGG - Intronic
1014048729 6:116926552-116926574 CTGGCGGCCCAGAGAGTTGGTGG + Intronic
1014855515 6:126396324-126396346 CTGTGGGCCTGAGGAGGTGGTGG - Intergenic
1019431185 7:1000606-1000628 CTGTCTGCCCTGAGAGATCGGGG + Intronic
1022493486 7:30838314-30838336 GGGGCTGCCTTGAGAGGTGGTGG + Intronic
1023630482 7:42158826-42158848 CTGACGGCCTTTAGAGGAAGAGG - Intronic
1025198124 7:56947486-56947508 CTGTGGCCCAGGAGAGGTGGGGG - Intergenic
1025673825 7:63629451-63629473 CTGTGGCCCAGGAGAGGTGGGGG + Intergenic
1025718245 7:63983624-63983646 CTGTGGGCTTTGGGTGGTGGTGG + Intergenic
1027405346 7:77854749-77854771 CTGTGGGCCTGGGGCGGTGGTGG - Intronic
1029251882 7:99242837-99242859 CTCTCTGCCTTGAGAGTTAGCGG - Intergenic
1029610092 7:101622201-101622223 CTGTGGGAGGTGAGAGGTGGGGG + Intronic
1030194530 7:106840635-106840657 CTGTAGGCCTGGAGATGAGGTGG - Intergenic
1031087069 7:117313044-117313066 CCGTCAGCCCTGGGAGGTGGGGG + Intronic
1033796573 7:144852083-144852105 CTGTGATCCTTGAGGGGTGGGGG - Intergenic
1038015114 8:23508232-23508254 ATGGCGGCCCAGAGAGGTGGAGG + Intergenic
1039464670 8:37776037-37776059 CTGTCTGCCTCGAGGGGTGGGGG + Intronic
1048136657 8:131752843-131752865 CTGTAGCCCCTGAGAAGTGGAGG + Intergenic
1048517243 8:135122290-135122312 CCCTCGGCCTTGGGAGGCGGAGG - Intergenic
1048966407 8:139618081-139618103 CTGTCTGGCTGGAAAGGTGGGGG + Exonic
1051307058 9:15721805-15721827 CTGTTGTCCTTGAGAGATTGAGG + Exonic
1052971558 9:34380150-34380172 CTCTCGGCCTGGAGAGGGGCGGG + Intronic
1056761562 9:89419100-89419122 GTGTCGGCCCCGAGGGGTGGGGG - Intronic
1059698115 9:116748056-116748078 CTGTCTTCCTTGAGTAGTGGAGG - Intronic
1060545077 9:124454703-124454725 CTGTAGCCCCTGAGAGTTGGCGG + Intronic
1061248644 9:129414118-129414140 CTGTAGGCCAGGAGAGGAGGGGG + Intergenic
1061944689 9:133902054-133902076 CTTTTGGCCCAGAGAGGTGGGGG - Intronic
1061951652 9:133939623-133939645 CTGTCGGCCTCGACATGTGCTGG - Intronic
1062025372 9:134337917-134337939 GTGCCAGCCCTGAGAGGTGGCGG + Intronic
1062239890 9:135531309-135531331 CTGTGCGGCTTGAGGGGTGGGGG - Intergenic
1186819156 X:13269025-13269047 GTGTTGGCCTTGAGGGGAGGTGG + Intergenic
1190602654 X:52108452-52108474 CTGTGGGCCTGGGGTGGTGGTGG - Intergenic
1192505599 X:71680294-71680316 CTGTGGGCCTGCAGTGGTGGTGG - Intergenic
1192521463 X:71804840-71804862 CTGTGGGCCTGCAGTGGTGGTGG + Intergenic
1193344344 X:80388005-80388027 CTGTGGGCCTGGGGAAGTGGTGG - Intronic
1198286317 X:135194981-135195003 CTGTCGCCACTAAGAGGTGGTGG + Intergenic