ID: 1121013867

View in Genome Browser
Species Human (GRCh38)
Location 14:90536604-90536626
Sequence GGTTGCTCACACATGGAGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 268}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121013867 Original CRISPR GGTTGCTCACACATGGAGCT GGG (reversed) Exonic
900897159 1:5491468-5491490 GGTAACACACACGTGGAGCTCGG - Intergenic
901015225 1:6225542-6225564 GGGAGCTCACACCTGGAGGTGGG - Intronic
902809444 1:18879910-18879932 GGTTGGTCACACTTGGAGCCTGG - Intronic
902840110 1:19068967-19068989 TGTTGCTCAGTCTTGGAGCTTGG - Intergenic
907372741 1:54013806-54013828 GGTTGTTCACCCCTGAAGCTGGG + Intronic
907771785 1:57472696-57472718 AATTGCTCACCCAGGGAGCTTGG + Intronic
907932962 1:59017223-59017245 GATTTCTCACACAGGGAGCTTGG - Intergenic
908058349 1:60317621-60317643 TGTAGCTCACACATGGTGGTAGG - Intergenic
909428304 1:75553956-75553978 GGTTGCTCCCCCATGAAACTGGG + Intronic
910598444 1:89005111-89005133 AATTGCTCACTCAGGGAGCTCGG + Intergenic
910811539 1:91242494-91242516 AATTGCTCACTCAGGGAGCTTGG - Intergenic
912445323 1:109731746-109731768 AATTGCTCACTCAGGGAGCTCGG - Intronic
913659799 1:120996469-120996491 GGTTGTTTACACATCGAGTTAGG - Intergenic
915630670 1:157151947-157151969 GGTTGCTAGCACATGAGGCTGGG + Intergenic
916080771 1:161230743-161230765 GGTTGGTGAAACATTGAGCTTGG - Intronic
919776966 1:201200469-201200491 GGTGCCTCACACCTGGAGGTGGG + Intronic
920417515 1:205808710-205808732 GGTTGTTCCTACATGGAGGTTGG - Intronic
922667786 1:227487650-227487672 GGTGGCTTACACATGGTGTTGGG - Intergenic
922681082 1:227596370-227596392 AATTGCTCACTCAGGGAGCTCGG - Intronic
922694150 1:227719552-227719574 AATTGCTCACTCAGGGAGCTTGG + Intergenic
922717189 1:227883872-227883894 GGATGCGCACACAGGGAGCTAGG - Intergenic
922717193 1:227883894-227883916 GGATGGGCACACAGGGAGCTAGG - Intergenic
922928861 1:229373364-229373386 GCCGGCTCACACATGCAGCTGGG - Intergenic
923127598 1:231046184-231046206 AATTGCTCACTCGTGGAGCTTGG - Intergenic
923970706 1:239200209-239200231 GATTGCTCACTCCAGGAGCTCGG + Intergenic
924779457 1:247132891-247132913 AATTGCTCACTCAGGGAGCTTGG + Intronic
1062859043 10:795476-795498 AATTGCTCACTCAGGGAGCTTGG + Intergenic
1065931406 10:30482298-30482320 AATTGCTCACTCAGGGAGCTCGG + Intergenic
1066619219 10:37326156-37326178 AGATGCTCACAGATGAAGCTAGG - Intronic
1067535526 10:47107097-47107119 CTTTGCTGACACATGCAGCTTGG - Intergenic
1068505760 10:57897593-57897615 AATTGCTCACTCAGGGAGCTCGG - Intergenic
1068515305 10:58018406-58018428 AATTGCTCACTCAGGGAGCTCGG + Intergenic
1068626534 10:59254861-59254883 GGTGGCTCACACCTGTAACTGGG - Intronic
1068671324 10:59726627-59726649 AATTGCTCACTCAGGGAGCTCGG - Intronic
1068676097 10:59771128-59771150 AATTGCTCACTCAGGGAGCTTGG - Intergenic
1068776528 10:60873693-60873715 GGTTGTTCACACTTGGAATTTGG - Intronic
1070017123 10:72544244-72544266 AATTGCTCACTCAGGGAGCTCGG + Intronic
1071282708 10:84117071-84117093 AATTGCTCACTCAGGGAGCTCGG + Intergenic
1072335300 10:94392481-94392503 AATTGCTCACCCAGGGAGCTCGG + Intergenic
1076687185 10:132203503-132203525 GTTTGCACACACATGCAGATGGG + Intronic
1080746046 11:35109561-35109583 GGTGGCTTACACATGGTGATGGG + Intergenic
1081201518 11:40221890-40221912 AATTGCTCACTCAGGGAGCTTGG + Intronic
1081243840 11:40739218-40739240 GGTTGCTAGGACATGGAGTTTGG - Intronic
1081596408 11:44462514-44462536 GGGTGCTCACACAAGCAGCATGG - Intergenic
1083082502 11:60108616-60108638 AATTGCTCACTCAGGGAGCTCGG - Intergenic
1083085051 11:60134253-60134275 GGTGGCTTACACATGGTGTTGGG + Intergenic
1083196967 11:61093928-61093950 AATTGCTCACTCAGGGAGCTCGG + Intergenic
1083726691 11:64632108-64632130 GGTGGCTCACAGATGGGGCAAGG + Intronic
1084369076 11:68726368-68726390 GTTTGCTTCCACTTGGAGCTTGG - Intronic
1086125749 11:83346835-83346857 AATTGCTCACTCAGGGAGCTCGG - Intergenic
1086973790 11:93110521-93110543 AATTGCTCACTCAGGGAGCTCGG - Intergenic
1087894460 11:103572380-103572402 AATTGCTCACTCAGGGAGCTTGG + Intergenic
1087895229 11:103578995-103579017 AATTGCTCACTCAGGGAGCTTGG + Intergenic
1088040522 11:105375753-105375775 GGTGGCTTACACATGGAGTTAGG - Intergenic
1091228392 11:133972041-133972063 GTGTGCTCACACGTGGAGCTAGG - Intergenic
1092390499 12:8073333-8073355 AATTGCTCACTCAGGGAGCTCGG + Intergenic
1093693558 12:22135050-22135072 GGTTACTTTCACATTGAGCTAGG - Intronic
1094397612 12:30025019-30025041 GGTGGCTTACACATGGTGTTGGG - Intergenic
1096870859 12:54591181-54591203 GGTTGCTCACACACAGGCCTGGG + Intergenic
1097421635 12:59387941-59387963 AATTGCTCACTCAGGGAGCTCGG + Intergenic
1097913385 12:64994534-64994556 AATTGCTCACTCAGGGAGCTCGG + Intergenic
1098639117 12:72818409-72818431 AATTGCTCACTCAGGGAGCTCGG - Intergenic
1098747970 12:74264621-74264643 AGTTGCTCACTCAGGGAGCTCGG + Intergenic
1099009118 12:77270721-77270743 AATTGCTCACTCAGGGAGCTTGG - Intergenic
1099483746 12:83201187-83201209 AATTGCTCACTCAGGGAGCTCGG + Intergenic
1099621278 12:85005437-85005459 GGTGGCTTACACATGGTGTTGGG + Intergenic
1103791057 12:123471454-123471476 GGTTGCTCACAGATTGAGCGAGG - Exonic
1104869305 12:131983215-131983237 TTTTGCACTCACATGGAGCTAGG - Intronic
1105793201 13:23823448-23823470 GGGTGACCACACATGGAGGTGGG + Intronic
1106295406 13:28409021-28409043 TGTTTCCAACACATGGAGCTAGG + Intronic
1106642730 13:31601320-31601342 AGTTGCTCACTCTGGGAGCTCGG - Intergenic
1106818564 13:33437350-33437372 AATTGCTCACTCAGGGAGCTCGG + Intergenic
1106880467 13:34123416-34123438 AATTGCTCACTCAGGGAGCTCGG + Intergenic
1107302133 13:38976852-38976874 GGTTCCACACCCATGCAGCTGGG - Intronic
1107685720 13:42896269-42896291 GGTGACTTAAACATGGAGCTTGG - Intronic
1109019769 13:57074379-57074401 GGTTGCTCACACCTGTATTTTGG + Intergenic
1109041917 13:57349364-57349386 GCTTGCCAACACTTGGAGCTGGG - Intergenic
1109940957 13:69363543-69363565 GGTTGCTCACAGTTGGAGATTGG - Intergenic
1110521169 13:76478541-76478563 AGTTGTTCACACATGGAGAAAGG - Intergenic
1114680482 14:24479990-24480012 GGTGGCTTACACATGGTGTTGGG - Intergenic
1116240579 14:42337888-42337910 AATTGCTCACTCAGGGAGCTCGG - Intergenic
1116327423 14:43548459-43548481 AGTTGCTTACACATTAAGCTAGG - Intergenic
1120590953 14:86372741-86372763 GGTGGCTTACACATGGTGTTGGG + Intergenic
1121013867 14:90536604-90536626 GGTTGCTCACACATGGAGCTGGG - Exonic
1122541102 14:102498032-102498054 GGGTGGGCACAGATGGAGCTGGG - Intronic
1123102131 14:105811432-105811454 GGTTGGTCACACAAGGGGATTGG - Intergenic
1124393795 15:29283003-29283025 CCATGCTCACACAGGGAGCTGGG + Intronic
1124808123 15:32906890-32906912 ACTTGCTCTCACATGGAGCATGG - Intronic
1126533078 15:49732148-49732170 AATTGCTCACTCAGGGAGCTCGG - Intergenic
1126946852 15:53831061-53831083 CATTGCTCACTCAGGGAGCTCGG - Intergenic
1127084914 15:55415533-55415555 AATTGCTCACTCAGGGAGCTAGG - Intronic
1129034291 15:72640345-72640367 GGGTGCTCACACATGGGGCACGG - Intergenic
1129215591 15:74096871-74096893 GGGTGCTCACACATGGGGCACGG + Intergenic
1129732727 15:77941200-77941222 GGGTGCTCACACATGGGGCACGG + Intergenic
1130409333 15:83631558-83631580 GGTGGCTTACACATGGTGTTGGG - Intergenic
1134369698 16:13611737-13611759 GTTTGTTGACACCTGGAGCTGGG - Intergenic
1134618602 16:15670737-15670759 TGTTGCTGACACTTGGTGCTTGG + Intronic
1134827146 16:17293979-17294001 GATTGCACAGCCATGGAGCTGGG - Intronic
1135069531 16:19339840-19339862 GGTTGCTCACTCTTGGGACTTGG + Intergenic
1137725034 16:50651246-50651268 GCTTGCCGACCCATGGAGCTGGG + Intergenic
1137822400 16:51458622-51458644 GGTTGTTCACACAAGGAGCCGGG + Intergenic
1138010172 16:53372192-53372214 TGTTGCTCACACATAAAACTAGG - Intergenic
1139100134 16:63756146-63756168 AATTGCTCACTCAAGGAGCTCGG - Intergenic
1139668551 16:68475370-68475392 GGCTGATCACACCTGGATCTTGG - Intergenic
1140110634 16:72001394-72001416 GGTGGCTCACACCTGCAGTTTGG - Intergenic
1141975166 16:87510894-87510916 GGTGGCTGACACATGGTGTTGGG - Intergenic
1142221187 16:88856086-88856108 GGTGGCTCCCACAAGGAGTTAGG + Intronic
1142588964 17:992669-992691 GGTGGCTCACGCCTGTAGCTGGG + Intergenic
1144324793 17:14168628-14168650 GGTTGCTTCCACATGGTGTTGGG - Intronic
1144642259 17:16944027-16944049 TGCTGCTCACACATGGCGCTTGG - Intronic
1145746064 17:27320761-27320783 AATTGCTCACTCAGGGAGCTCGG - Intergenic
1146400178 17:32495405-32495427 GGCTGCTCTCATCTGGAGCTGGG + Intronic
1147556902 17:41485531-41485553 GGGTGCTCAGACATGGAGTCTGG - Intergenic
1148015297 17:44517634-44517656 GGTTCCTCACACCTGGAACCTGG - Intergenic
1148195754 17:45711352-45711374 TGTTCCTCACACCTGGATCTGGG + Intergenic
1149320184 17:55474110-55474132 AATTGCTCACTCAGGGAGCTTGG + Intergenic
1150625282 17:66837296-66837318 GGTAGCTCACAGATTGAGCTTGG + Intronic
1152117725 17:78398973-78398995 GCGTGCTCCCTCATGGAGCTGGG + Intronic
1156078417 18:33307834-33307856 GGTAGCTTACACATGGTGTTGGG + Intronic
1160561935 18:79764431-79764453 GGTCACTCACACATGGGGTTGGG - Intergenic
1160561945 18:79764474-79764496 GGTCACTCACACATGGGGTTGGG - Intergenic
1160561955 18:79764517-79764539 GGTCACTCACACATGGGGTTGGG - Intergenic
1160561965 18:79764560-79764582 GGTCACTCACACATGGGGTTGGG - Intergenic
1160561975 18:79764603-79764625 GGTCACTCACACATGGGGTTGGG - Intergenic
1160561984 18:79764646-79764668 GGTCACTCACACATGGGGTTGGG - Intergenic
1160561993 18:79764689-79764711 GGTCACTCACACATGGGGTTGGG - Intergenic
1160562003 18:79764732-79764754 GGTCACTCACACATGGGGTTGGG - Intergenic
1160562012 18:79764775-79764797 GGTCACTCACACATGGGGTTGGG - Intergenic
1160562022 18:79764818-79764840 GGTCACTCACACATGGGGTTGGG - Intergenic
1160562031 18:79764861-79764883 GGTCACTCACACATGGGGTTGGG - Intergenic
1160562041 18:79764904-79764926 GGTCACTCACACATGGGGTTGGG - Intergenic
1160562050 18:79764947-79764969 GGTCACTCACACATGGGGTTGGG - Intergenic
1160562059 18:79764990-79765012 GGTCACTCACACATGGGGTTGGG - Intergenic
1160562078 18:79765076-79765098 GGTCACTCACACATGGGGTTGGG - Intergenic
1160562087 18:79765119-79765141 GGTCACTCACACATGGGGTTGGG - Intergenic
1160562097 18:79765162-79765184 GGTCACTCACACATGGGGTTGGG - Intergenic
1160562107 18:79765205-79765227 GGTCACTCACACATGGGGTTGGG - Intergenic
1160562116 18:79765248-79765270 GGTCACTCACACATGGGGTTGGG - Intergenic
1160562126 18:79765291-79765313 GGTCACTCACACATGGGGTTGGG - Intergenic
1160562135 18:79765334-79765356 GGTCACTCACACATGGGGTTGGG - Intergenic
1160562145 18:79765377-79765399 GGTCACTCACACATGGGGTTGGG - Intergenic
1160562155 18:79765420-79765442 GGTCACTCACACATGGGGTTGGG - Intergenic
1160562165 18:79765463-79765485 GGTCACTCACACATGGGGTTGGG - Intergenic
1160562175 18:79765506-79765528 GGTCACTCACACATGGGGTTGGG - Intergenic
1160562185 18:79765549-79765571 GGTCACTCACACATGGGGTTGGG - Intergenic
1160612248 18:80097437-80097459 GGTGGCTCACACCTGTAGCCGGG + Intergenic
1162647576 19:12061083-12061105 AATTGCTCACTCAGGGAGCTCGG + Intergenic
1164221693 19:23200573-23200595 AATTGCTCACTCAGGGAGCTCGG + Intergenic
1164264296 19:23598458-23598480 AATTGCTCACTCAGGGAGCTCGG - Intronic
1166497451 19:43314352-43314374 AATTGCTCACTCAGGGAGCTCGG + Intergenic
1166526394 19:43513051-43513073 GGTGGCTTACACGTGGTGCTGGG + Intronic
1166707126 19:44914310-44914332 GATTGCTCACTCGGGGAGCTCGG + Exonic
1168399493 19:56076848-56076870 GATTGCTCACAGTTGGAGGTAGG - Intergenic
1168425234 19:56234798-56234820 AATTGCTCACTCGTGGAGCTCGG + Intronic
1202714643 1_KI270714v1_random:35533-35555 GGAGGCTCACAGATGGAGCTGGG + Intergenic
925041477 2:734496-734518 AATTGCTCACTCAGGGAGCTCGG + Intergenic
925090139 2:1148652-1148674 GGGTGATCACACAAGGAGCGGGG - Intronic
925553035 2:5096657-5096679 AATTGCTCACATCTGGAGCTAGG - Intergenic
925794956 2:7531222-7531244 GGTGGCTCCCACATGGTGTTGGG - Intergenic
926490966 2:13526056-13526078 AATTGCTCACTCAGGGAGCTCGG - Intergenic
926491791 2:13533197-13533219 AATTGCTCACTCAGGGAGCTTGG - Intergenic
926772820 2:16393258-16393280 AGTGGCTCACAAATGGAGTTTGG + Intergenic
927711981 2:25331859-25331881 GGTGCCTCCCACATGGAGCTGGG - Intronic
934932749 2:98441691-98441713 AATTGCTCACTCAGGGAGCTTGG - Intergenic
935721784 2:105986001-105986023 AATTGCTCACTCAGGGAGCTCGG - Intergenic
937499831 2:122466316-122466338 GGCAGCTCACACATGGGGATTGG + Intergenic
938498736 2:131818684-131818706 GGGTGCTCACAGATGGGGATGGG + Intergenic
939156979 2:138537253-138537275 AATTGCTCACTCAGGGAGCTCGG - Intronic
939428435 2:142071699-142071721 GGTTCCTCACACATAAAGTTAGG + Intronic
940485262 2:154289128-154289150 GGTGGCTTACACATGGTGTTGGG - Intronic
941539721 2:166767109-166767131 AATTGCTCACTCCTGGAGCTCGG + Intergenic
942522824 2:176821924-176821946 AGTGGCTAACACATGGAGCTAGG - Intergenic
943006554 2:182393226-182393248 GGTGGCTTACACATGGTGTTGGG - Intronic
943637392 2:190320946-190320968 GGTTTCACACACATGAAGCTAGG - Intronic
945290037 2:208117747-208117769 AGTTGCTCACTCGGGGAGCTCGG + Intergenic
946782225 2:223203753-223203775 AATTGCTCACTCAGGGAGCTCGG + Intergenic
947501443 2:230674224-230674246 AATTGCTCACTCAGGGAGCTCGG + Intergenic
948009126 2:234636668-234636690 GGTGGCTTACACATGGTGTTGGG + Intergenic
1169039153 20:2478870-2478892 GGTGGCTCACACCTGGTGCTGGG - Intronic
1171238102 20:23544335-23544357 GGTTGCATACCCACGGAGCTTGG - Intergenic
1174919702 20:54688516-54688538 TCTTGCTCCCACATGGTGCTGGG - Intergenic
1175635457 20:60579020-60579042 AATTGCTCACTCAGGGAGCTCGG + Intergenic
1177471274 21:21563803-21563825 GGTGGCTTACACATGGTGTTGGG - Intergenic
1178411053 21:32364090-32364112 GGTTGCTTGCTCATTGAGCTTGG - Intronic
1178474842 21:32928743-32928765 GCTTGCCCCCAGATGGAGCTTGG - Intergenic
1179467721 21:41588850-41588872 AATTGCTCACTCAGGGAGCTCGG + Intergenic
1180078324 21:45474633-45474655 TGTTCCTCACACCTGGGGCTGGG - Intronic
1183993208 22:41612835-41612857 GGTGGCTCACGCCTGGAGGTGGG - Intronic
1184858302 22:47158514-47158536 GGTTCTTCACACATGGATCACGG + Intronic
1185386411 22:50533426-50533448 AATTGCTCACTCAGGGAGCTCGG - Intergenic
949231736 3:1757705-1757727 GTGTGCCTACACATGGAGCTGGG - Intergenic
950589309 3:13924810-13924832 GGTGGCTTACACATGGTGTTGGG + Intergenic
950893731 3:16428694-16428716 CGTTGTACACACATGGAGCTAGG - Intronic
952734480 3:36675117-36675139 AATTGCTCACTCAGGGAGCTCGG + Intergenic
953008871 3:39004958-39004980 AATTGCTCACTCAGGGAGCTCGG - Intergenic
954395318 3:50290336-50290358 CCTTGATCACACTTGGAGCTGGG + Intronic
955979192 3:64507730-64507752 GTTTGCTGACACATTGATCTTGG + Intergenic
956585455 3:70859868-70859890 AATTGCTCACTCAGGGAGCTCGG + Intergenic
957967408 3:87340176-87340198 GGTTGCTCAAACATGAACCCAGG + Intergenic
958853465 3:99356439-99356461 TTTTGCTCAAACATGGACCTTGG - Intergenic
959060613 3:101613025-101613047 AGTTGCTCACTCCGGGAGCTCGG - Intergenic
960499527 3:118419559-118419581 GGTTGCTTACACATGGTGTTGGG - Intergenic
962918463 3:139930096-139930118 GGATGCTCACATATGGAGGCTGG - Intergenic
963049458 3:141128635-141128657 GGGAGCTCACAGAAGGAGCTGGG + Intronic
964517464 3:157528172-157528194 TGTTGCTCACACAGGGTCCTGGG + Intronic
964886250 3:161486497-161486519 GGTTGTGGAGACATGGAGCTAGG + Intergenic
964932525 3:162044636-162044658 AATTGCTCACTCAGGGAGCTTGG - Intergenic
964933417 3:162052367-162052389 AATTGCTCACTCAGGGAGCTTGG - Intergenic
972217516 4:36913233-36913255 AATTGCTCACTCAGGGAGCTCGG + Intergenic
972422015 4:38896545-38896567 AGTTGCCCACACATGGAGCCAGG + Intronic
972664674 4:41153168-41153190 GTTTGCTTACACATAAAGCTTGG + Intronic
972941800 4:44204578-44204600 AATTGCTCACTCAGGGAGCTCGG + Intronic
974071435 4:57127668-57127690 GGTGGCTCACACGTGGGGTTGGG + Intergenic
974872492 4:67660493-67660515 GGTGGCTTACACATGGTGTTGGG + Intronic
975052567 4:69883806-69883828 GGTGGCTTACACATGGTGTTGGG - Intergenic
975066005 4:70064285-70064307 AGTTGCCCAAACTTGGAGCTAGG - Intergenic
977015987 4:91693730-91693752 GGTGGCTTACACATGGCGTTAGG - Intergenic
978264436 4:106805389-106805411 AATTGCTCACTCAGGGAGCTTGG + Intergenic
979693331 4:123583914-123583936 ATTTGCTTTCACATGGAGCTGGG + Intergenic
980118493 4:128704279-128704301 AGTTGCTCACCCGGGGAGCTCGG + Intergenic
981260287 4:142710635-142710657 GATTGCTCATTCATGAAGCTTGG - Intronic
983114329 4:163793880-163793902 AATTGCTCACTCAGGGAGCTTGG + Intronic
983264351 4:165492545-165492567 AATTGCTCACTCAGGGAGCTGGG - Intronic
983385964 4:167061544-167061566 GGTTTCTCACTCATACAGCTTGG + Intronic
983837907 4:172415692-172415714 AATTGCTCACTCAGGGAGCTCGG - Intronic
986210762 5:5669667-5669689 GATTGCTCAGACATGGGGCTGGG - Intergenic
986533388 5:8761792-8761814 GGTGGCTTACACATGGTGTTGGG + Intergenic
986717171 5:10533070-10533092 TGTTGCTGACACCTGGAGTTTGG + Intergenic
987208921 5:15658604-15658626 AGTTGCTCACTCAGGGAGCTCGG - Intronic
989096414 5:37785802-37785824 AGTTGCTCACTCAGGGAGCTCGG - Intergenic
989388054 5:40872690-40872712 AATTGCTCACTCAGGGAGCTCGG + Intergenic
989696913 5:44212440-44212462 GGTGGCTTACACATGGTGTTGGG + Intergenic
990217326 5:53548906-53548928 AATTGCTCACTCAGGGAGCTTGG + Intergenic
990800196 5:59593517-59593539 AGTTCCTCACATAAGGAGCTTGG + Intronic
992375670 5:76185557-76185579 GGTGGCTTACACATGGTGTTGGG - Intronic
993839205 5:92855921-92855943 GGTTGCTCTCATCTGGAGCAAGG - Intergenic
995723843 5:115165454-115165476 GGTGGCTTACACATGGTGTTGGG - Intronic
996040248 5:118801085-118801107 AATTGCTCACTCAGGGAGCTCGG + Intergenic
997036843 5:130202896-130202918 GGTGGCTTACACATGGTGTTGGG - Intergenic
999888965 5:155956441-155956463 GGCTGCTCATACCTTGAGCTTGG + Intronic
1003352827 6:5334930-5334952 GCTTGCCTACACATGGAGCTGGG - Intronic
1003872469 6:10413419-10413441 GGGCGCCCACACCTGGAGCTGGG + Intronic
1005462412 6:26081637-26081659 AATTGCTCACTCAGGGAGCTCGG + Intergenic
1005638637 6:27774248-27774270 AATTGCTCACTCAGGGAGCTCGG + Intergenic
1006570995 6:35004185-35004207 AATTGCTCACTCAGGGAGCTCGG + Intronic
1007522230 6:42459779-42459801 GGTTGCACACCCATGGAGCTCGG - Intergenic
1011031727 6:82931139-82931161 GGTGGCTTACACATGGTGTTAGG + Intronic
1012562364 6:100598638-100598660 GGTCCCACACACAGGGAGCTGGG - Intronic
1013997543 6:116325852-116325874 AATTGCTCACTCAGGGAGCTCGG - Intronic
1014247476 6:119083059-119083081 GGTGGCTTACACATGGTGTTGGG - Intronic
1014546409 6:122741616-122741638 AATTGCTCACTCAGGGAGCTCGG - Intergenic
1014883073 6:126746623-126746645 GGTGGCTTACACATGGTGTTTGG - Intergenic
1016368135 6:143341173-143341195 GTTTCCTAACTCATGGAGCTGGG + Intergenic
1017218200 6:151935059-151935081 GGAAGCTGACACATGAAGCTGGG - Intronic
1019276897 7:180425-180447 CGCCTCTCACACATGGAGCTGGG + Intergenic
1021471552 7:21008281-21008303 AATTGCTCACTCAGGGAGCTTGG + Intergenic
1021582859 7:22175435-22175457 AGTTGCTCTCACAAGGAGCTGGG + Intronic
1021848956 7:24789392-24789414 AATTGCTCACTCAGGGAGCTTGG - Intergenic
1025262768 7:57430799-57430821 AGTTGGTGACACATGGAGCTAGG - Intergenic
1028445543 7:90918422-90918444 GGATGCTCAAACATGGTGTTTGG - Intronic
1029485779 7:100839342-100839364 AATTGCTCACTCAGGGAGCTCGG + Intronic
1031340021 7:120588454-120588476 GGTTGCTCAGACAAGAATCTAGG + Intronic
1031763483 7:125743919-125743941 GTTTGCTCACCCACAGAGCTTGG - Intergenic
1035119958 7:156558953-156558975 GGCTGCTCACACCAGAAGCTGGG - Intergenic
1038090098 8:24242771-24242793 AATTGCTCACTCAGGGAGCTCGG + Intergenic
1039586901 8:38714456-38714478 GGCTGCACACACATGGACATCGG - Intergenic
1040103438 8:43524936-43524958 AATTGCTCACTCAGGGAGCTCGG - Intergenic
1040743974 8:50617635-50617657 GATTGCTCACTCGGGGAGCTCGG - Intronic
1042327288 8:67541593-67541615 AATTGCTCACTCAGGGAGCTCGG + Intronic
1043518558 8:81019564-81019586 GGTGGCTTACACATGGTGTTGGG + Intronic
1045894835 8:107202464-107202486 GGTGGCTTACACATGGTGTTGGG + Intergenic
1048200504 8:132370257-132370279 TGTTGCTCAAACATTGTGCTGGG - Intronic
1049490338 8:142895931-142895953 AATTGCTCACTCAGGGAGCTTGG - Intronic
1049634537 8:143680266-143680288 AATTGCTCACTCAGGGAGCTCGG + Intergenic
1051743902 9:20276796-20276818 GGTGGCTTACACATGGTGTTGGG - Intergenic
1052008866 9:23382765-23382787 GGTGGCTTACACATGGTGTTGGG + Intergenic
1052666053 9:31496791-31496813 GGTGGCTTACACATGGTGTTGGG - Intergenic
1053303420 9:36967695-36967717 GGTTGCTCATTCAGGGAGGTAGG + Intronic
1055438572 9:76317099-76317121 AGTGGCTCACACATGTAACTGGG + Intronic
1056703749 9:88933974-88933996 AATTGCTCACTCAGGGAGCTCGG - Intergenic
1056762040 9:89422559-89422581 GGATGCGCACGCATGGTGCTCGG - Intronic
1058079718 9:100689115-100689137 AATTGCTCACTCAGGGAGCTCGG + Intergenic
1061060971 9:128250451-128250473 GGTGGCTCCCACCTGGAGCGAGG + Intronic
1061223389 9:129265699-129265721 GGTGGCTCACAAATGGGGCGTGG + Intergenic
1185909152 X:3966192-3966214 AATTGCTCACTCAGGGAGCTCGG + Intergenic
1185910451 X:3976064-3976086 AATTGCTCACTCAGGGAGCTCGG + Intergenic
1187491491 X:19755978-19756000 AATTGCTCACTCAGGGAGCTCGG + Intronic
1187574754 X:20542441-20542463 GGTGGCTCACACCTGGTGTTGGG + Intergenic
1190270778 X:48861673-48861695 AATTGCTCACTCAGGGAGCTCGG + Intergenic
1190425350 X:50330102-50330124 AATTGCTCACTCAGGGAGCTCGG - Intronic
1190426506 X:50338360-50338382 AATTGCTCACTCAGGGAGCTCGG - Intronic
1191917480 X:66218652-66218674 AATTGCTCACTCAGGGAGCTCGG - Intronic
1192066427 X:67890031-67890053 CATTGCTCACACTGGGAGCTGGG + Intergenic
1193600600 X:83505028-83505050 GCTTGCTCTCTCATGCAGCTGGG - Intergenic
1194580050 X:95660852-95660874 AATTGCTCACTCAGGGAGCTCGG + Intergenic
1198566062 X:137906715-137906737 GGTGGCTAACACATGGTGTTGGG + Intergenic
1199394758 X:147322657-147322679 GGATGCCCTCACCTGGAGCTTGG - Intergenic
1201554570 Y:15255035-15255057 AATTGCTCACTCAGGGAGCTTGG + Intergenic