ID: 1121013877

View in Genome Browser
Species Human (GRCh38)
Location 14:90536677-90536699
Sequence GCTTAGACCAAGGGGCGTGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121013877_1121013884 2 Left 1121013877 14:90536677-90536699 CCTCCACGCCCCTTGGTCTAAGC 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1121013884 14:90536702-90536724 CATGGTCGCTGTGTGACAGCAGG 0: 1
1: 0
2: 0
3: 4
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121013877 Original CRISPR GCTTAGACCAAGGGGCGTGG AGG (reversed) Exonic