ID: 1121019173

View in Genome Browser
Species Human (GRCh38)
Location 14:90568613-90568635
Sequence AGTCCTCGGTGAGGACAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 204}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121019166_1121019173 5 Left 1121019166 14:90568585-90568607 CCCATGAAGCTTCTGGGTCTGTG 0: 1
1: 0
2: 0
3: 12
4: 262
Right 1121019173 14:90568613-90568635 AGTCCTCGGTGAGGACAGGGTGG 0: 1
1: 0
2: 1
3: 21
4: 204
1121019164_1121019173 11 Left 1121019164 14:90568579-90568601 CCTGGGCCCATGAAGCTTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 273
Right 1121019173 14:90568613-90568635 AGTCCTCGGTGAGGACAGGGTGG 0: 1
1: 0
2: 1
3: 21
4: 204
1121019167_1121019173 4 Left 1121019167 14:90568586-90568608 CCATGAAGCTTCTGGGTCTGTGG 0: 1
1: 0
2: 1
3: 35
4: 260
Right 1121019173 14:90568613-90568635 AGTCCTCGGTGAGGACAGGGTGG 0: 1
1: 0
2: 1
3: 21
4: 204
1121019162_1121019173 12 Left 1121019162 14:90568578-90568600 CCCTGGGCCCATGAAGCTTCTGG 0: 1
1: 0
2: 1
3: 22
4: 208
Right 1121019173 14:90568613-90568635 AGTCCTCGGTGAGGACAGGGTGG 0: 1
1: 0
2: 1
3: 21
4: 204
1121019161_1121019173 16 Left 1121019161 14:90568574-90568596 CCTGCCCTGGGCCCATGAAGCTT 0: 1
1: 0
2: 0
3: 29
4: 219
Right 1121019173 14:90568613-90568635 AGTCCTCGGTGAGGACAGGGTGG 0: 1
1: 0
2: 1
3: 21
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121019173 Original CRISPR AGTCCTCGGTGAGGACAGGG TGG Intronic
900466286 1:2827027-2827049 AGGCCTGGGTGAGGACACGTTGG + Intergenic
900553970 1:3270612-3270634 AGTCCTGGATGAGGACAGTTGGG + Intronic
900585251 1:3429515-3429537 CGTCCTCAGAGTGGACAGGGAGG + Intronic
900703770 1:4063371-4063393 AGTCCTGGGTGTGTGCAGGGTGG - Intergenic
900721199 1:4176945-4176967 TTTCCTCTGTGAGGACAGGGTGG + Intergenic
900823794 1:4910388-4910410 AGTCATAGGTGAGGTCTGGGAGG + Intergenic
900970708 1:5991372-5991394 AGCCCTGGGTTAGGACCGGGAGG + Intronic
901396374 1:8985129-8985151 AGAGCTCGGTGAGAAAAGGGAGG - Intergenic
901526161 1:9824342-9824364 AGTCCTCGGGGTGGAGAAGGAGG - Exonic
903143151 1:21352161-21352183 CTTCCTCAGAGAGGACAGGGAGG - Intergenic
903768217 1:25748274-25748296 AGGGCTCGGTGAGGTCAGTGTGG - Intronic
904605344 1:31695088-31695110 CCTCCTGGGTGAGGACAAGGGGG - Intronic
905267704 1:36766107-36766129 TGTGGTGGGTGAGGACAGGGAGG - Intergenic
905562921 1:38941627-38941649 AGTCCTATGTCAGGACAAGGGGG - Intronic
906431045 1:45756011-45756033 AGTCCTGAGGGAGGAAAGGGTGG + Intergenic
907144443 1:52219613-52219635 AGTCCTGAGGGAGGAAAGGGTGG + Intronic
915522429 1:156455533-156455555 AGCACTCTGTGAGGCCAGGGCGG - Intergenic
924632276 1:245752313-245752335 GGGCCTCTGTGAGGGCAGGGAGG - Intronic
1063121533 10:3108188-3108210 ATTCCTCTGTAAGGACAGTGGGG - Intronic
1063513675 10:6672481-6672503 AGTGCAAGGTGAGGAGAGGGAGG - Intergenic
1066656351 10:37702233-37702255 AGGCCTGGCTGAGGACAGGGAGG - Intergenic
1067054788 10:43044251-43044273 AGTGCCCTGTGAGGCCAGGGAGG + Intergenic
1067807627 10:49404199-49404221 AGGCCACGGGGAGGAGAGGGAGG - Intergenic
1068564884 10:58563361-58563383 AGTCCTCTGTGAGGACTGTGGGG + Intronic
1070248491 10:74753445-74753467 AGTCCTATGTGTGGACAGGCAGG - Intergenic
1071007148 10:80895855-80895877 AGTCCTCAGTGAAGAAAGGCTGG + Intergenic
1074801963 10:117008864-117008886 AGTACTCTGGGAGGCCAGGGCGG + Intronic
1076107625 10:127835816-127835838 AGACCTGTGTGGGGACAGGGTGG - Intergenic
1077098429 11:809973-809995 CGACCTCGGTGGCGACAGGGAGG - Exonic
1077198108 11:1291582-1291604 AGGGTTCAGTGAGGACAGGGTGG - Intronic
1077460094 11:2704765-2704787 ACTTCTGGCTGAGGACAGGGAGG + Intronic
1077502404 11:2915344-2915366 ACTCCTTGGTGGGGACATGGTGG + Intronic
1078778434 11:14414917-14414939 AGTCTTTGGTGGGGAAAGGGAGG - Intergenic
1080103544 11:28486913-28486935 AGTGCTAGGTGTGGACAGGCAGG + Intergenic
1083333640 11:61910806-61910828 AGTCCTCAGGTAGGACAGGATGG + Intronic
1084865528 11:72053231-72053253 AGTGCTCTGGGAGGACAAGGTGG - Intronic
1089764304 11:120751815-120751837 AGTCCTCGGTGCTGAGTGGGAGG + Intronic
1092370932 12:7916038-7916060 AGTGCTCGCTGGGGGCAGGGCGG + Intergenic
1096662765 12:53138692-53138714 AGTCCTCTGGGAGGCCAAGGTGG - Intergenic
1096966694 12:55633536-55633558 AGGCCTGGATGAGGACAGGGAGG + Intergenic
1097221067 12:57451435-57451457 AGGCCTGGATGAGGAGAGGGTGG + Intergenic
1098898058 12:76084844-76084866 AGTCCTCGGTGGGGGTATGGAGG - Exonic
1100551858 12:95653389-95653411 AGTACTTGGTGAGGCCAAGGTGG - Intergenic
1104727818 12:131088555-131088577 AGTCCGGGCAGAGGACAGGGTGG + Intronic
1107319425 13:39169683-39169705 ATTCCTGGGTGAGGCCTGGGCGG + Intergenic
1107404385 13:40098933-40098955 AGGCACCAGTGAGGACAGGGAGG + Intergenic
1114630306 14:24155270-24155292 TGTCATCGGTGAGGTCGGGGCGG - Exonic
1121019173 14:90568613-90568635 AGTCCTCGGTGAGGACAGGGTGG + Intronic
1122864053 14:104595570-104595592 CGTCCTGGGTCAGGACAGGGAGG - Intronic
1123123115 14:105927197-105927219 AGTGCTGGCTGAGGACAGGCGGG - Intronic
1126999221 15:54482193-54482215 AGTCCTCGGGAAGGACATAGGGG + Intronic
1127361121 15:58246015-58246037 AGGCCTTGGTGAAGACAGGCAGG + Intronic
1127604418 15:60572023-60572045 ACTCCCAGATGAGGACAGGGAGG + Intronic
1127951463 15:63811277-63811299 TGTACTGGGAGAGGACAGGGAGG + Intronic
1128713911 15:69893136-69893158 AGTCCTTGGTGAGGACGAGTGGG - Intergenic
1129190446 15:73934367-73934389 AGACGTCAGTGAGGCCAGGGAGG - Intronic
1129896072 15:79106865-79106887 AGTGCTGAGTGAGGAAAGGGTGG + Intergenic
1130844602 15:87733242-87733264 AGTGCGAGGTGAGGACAGGGAGG - Intergenic
1132239725 15:100248496-100248518 TGTCCTGGGTGAGAAGAGGGAGG - Intronic
1132467449 16:83952-83974 AGGAGTCGGTGAGGAAAGGGAGG + Intronic
1133336577 16:5010561-5010583 AGTTCCCGGTGGGGAGAGGGTGG + Intronic
1133775296 16:8890636-8890658 ACGACTGGGTGAGGACAGGGTGG + Intergenic
1138986447 16:62334559-62334581 AGTGCTTTGTGAGGCCAGGGTGG - Intergenic
1142027560 16:87822749-87822771 AGGTCTGGGTGAGGACACGGTGG - Intergenic
1142348290 16:89568189-89568211 AGCCCACAGTGAGGACAGCGAGG - Intergenic
1144894760 17:18521673-18521695 AGTGCTAGATGAAGACAGGGAGG + Intergenic
1145205538 17:20983255-20983277 AGTCCTGGGTGGGGGCGGGGTGG + Intergenic
1145867052 17:28248123-28248145 AGCTCTCTGTGAGGACAGAGTGG - Intergenic
1146218349 17:30997046-30997068 AGTCCACAGTGAGAACATGGAGG + Intronic
1146920462 17:36706693-36706715 AGTCCTCAGTGAGCAAAGGTAGG - Intergenic
1146946696 17:36878227-36878249 ATTCCTGGGAGAGGACAGGAAGG - Intergenic
1147371823 17:39997724-39997746 AGCCCTGGGGGAGGTCAGGGTGG - Exonic
1147458511 17:40553689-40553711 AGGCCTGGGAGAGGGCAGGGAGG + Intergenic
1147869645 17:43578354-43578376 AGGCCTCAGTGAGGGCTGGGAGG + Intronic
1148125826 17:45236281-45236303 AGCCCCCAGTGAGGACAGGCTGG - Intronic
1148873105 17:50670026-50670048 AGTACTCTGGGAGGCCAGGGTGG - Intronic
1148905308 17:50908194-50908216 AGTGCCCAGTGAGGACATGGGGG - Intergenic
1151195850 17:72430731-72430753 TGTCCGCGGTGAGGACAGTGAGG - Intergenic
1151344463 17:73493123-73493145 AGTCCTTGGGGAGGGGAGGGTGG - Intronic
1151499527 17:74480092-74480114 TGTCCCAGGTGGGGACAGGGAGG + Intronic
1151922832 17:77170497-77170519 AGTCCTAAGAGAGGAAAGGGTGG + Intronic
1152252387 17:79218808-79218830 AGGCCTCGGTGCAGACATGGAGG + Intronic
1154134278 18:11762087-11762109 AGCCCCAGCTGAGGACAGGGAGG + Intronic
1155512183 18:26589156-26589178 AGACCTGGGGGAGGACAGGATGG + Intronic
1156268062 18:35506032-35506054 AGGCCTTGGTGGGGACAGGGTGG + Intergenic
1159995467 18:74960391-74960413 GGTCCTGAGTGAGGACTGGGTGG + Intronic
1159995582 18:74960931-74960953 GGTCCTGAGTGAGGACTGGGTGG + Intronic
1159995590 18:74960967-74960989 AGTCCTGAGTGAGGACTGGGTGG + Intronic
1159995599 18:74961003-74961025 GGTCCTGAGTGAGGACTGGGTGG + Intronic
1159995608 18:74961039-74961061 GGTCCTGAGTGAGGACTGGGTGG + Intronic
1160679741 19:407239-407261 AATCCTCGTTGAAGACGGGGCGG + Exonic
1160767603 19:815351-815373 AGGCCTCGGTGCCCACAGGGAGG + Intronic
1161290388 19:3490920-3490942 AGGCCTGGGTAGGGACAGGGTGG - Exonic
1161571015 19:5030954-5030976 AGCCCTCTGGGAGGACTGGGTGG - Intronic
1161818975 19:6517233-6517255 GGTCCTCTGTGGGTACAGGGTGG + Intergenic
1164499965 19:28810475-28810497 AGCCCTCTGGGAGGCCAGGGAGG + Intergenic
1164540175 19:29116027-29116049 CATCCTGGGGGAGGACAGGGAGG + Intergenic
1166293978 19:41879941-41879963 ACTCCTGGGTGAGGGCAGGAGGG - Intronic
1166391841 19:42412759-42412781 AGTCCTCTCTGGGGACAGAGAGG - Intronic
1166735078 19:45079272-45079294 GGACCTCGGTGAGTACAAGGTGG + Exonic
1167266997 19:48488199-48488221 GGGCCTCTGTGAGGACAGGGTGG - Intronic
1167312554 19:48745610-48745632 GGTCGTTGGTGAGGGCAGGGGGG - Exonic
1167514143 19:49913156-49913178 AGGCCTGTGTGAAGACAGGGAGG + Intronic
1167713819 19:51128073-51128095 AGCCCTGGGGGAGGACAGGCTGG + Intronic
1168115537 19:54219916-54219938 CCTCCTGGGTCAGGACAGGGAGG + Intronic
1168118529 19:54239660-54239682 CCTCCTGGGTCAGGACAGGGAGG + Intronic
925270836 2:2606324-2606346 AGTCCCCAGTGTGGACAGTGGGG + Intergenic
925577647 2:5377134-5377156 AGTACACGGTGAGGACAGAGAGG - Intergenic
927193810 2:20534340-20534362 ACTACTGGGTGAGGAGAGGGAGG + Intergenic
927504162 2:23602475-23602497 AGTCCTGTGTGAGGCCAGTGGGG + Intronic
927713835 2:25340945-25340967 GGCCCGCGGTGGGGACAGGGAGG + Intronic
933233713 2:79840683-79840705 AGTCCCCGGGGAGGCCAAGGTGG + Intronic
934941481 2:98506169-98506191 AGACATGGGTGGGGACAGGGCGG + Intronic
935123281 2:100200231-100200253 GGCCCTCGGTGCGGTCAGGGAGG + Intergenic
935861411 2:107334567-107334589 AGTTCTTGGTGAGGATAGAGAGG + Intergenic
936662782 2:114560563-114560585 GGTCCTGGGTGAGGAGAGAGTGG + Intronic
937125591 2:119473358-119473380 GGCCCTGGGAGAGGACAGGGTGG - Intronic
937173561 2:119903012-119903034 AGCCCTCTGTGTGGACATGGAGG - Intronic
938140662 2:128791921-128791943 AGCCCTGTGTGGGGACAGGGAGG + Intergenic
938949292 2:136242498-136242520 CATCCTGGCTGAGGACAGGGTGG - Intergenic
942799751 2:179861466-179861488 GGTCCTCGGCCAGGCCAGGGGGG - Exonic
946437726 2:219669117-219669139 AGTCCTCTCTGAGGACAGGTAGG + Intergenic
947634613 2:231673596-231673618 AGTCCTCAGTGAGGAAACGGAGG + Intergenic
947698082 2:232209589-232209611 AGTCCTCGGGCAGGAAAGGCTGG + Intronic
947796063 2:232894741-232894763 AGTGAGCGGTGAGGACGGGGGGG - Exonic
1173578192 20:44126672-44126694 AGTCCTGGGTGGGGAGAGGAAGG - Intronic
1175917630 20:62434267-62434289 AGTCCTGGATGGGGACATGGCGG + Intergenic
1176037495 20:63046925-63046947 TGTCCTCGGAGAGGTGAGGGAGG - Intergenic
1176082160 20:63278982-63279004 AGTCCTCACCGAGTACAGGGAGG - Exonic
1177422653 21:20881225-20881247 AGTACTAGGTGACAACAGGGTGG - Intergenic
1179151056 21:38808435-38808457 AGTCCTATGAGAGGACAGAGAGG - Intronic
1179547982 21:42125062-42125084 ACTCCTTAGTGGGGACAGGGCGG + Intronic
1181742109 22:24929464-24929486 AGGCCTTGGAGAGGACAGAGGGG - Intergenic
1181802128 22:25354581-25354603 GGTCGTCGGTGAGTCCAGGGGGG - Exonic
1182357709 22:29729792-29729814 AGGCCAGGGTGGGGACAGGGTGG - Exonic
1183356833 22:37364244-37364266 AAGCCTCGGGGAGGCCAGGGTGG + Intergenic
1183361699 22:37386324-37386346 AGTCCTAGGTGAGCAGAGTGAGG - Intronic
1184604900 22:45567013-45567035 ATTCCACAGTGAGGACAGGGAGG + Intronic
1185206393 22:49541488-49541510 AGCCCGCGGAGAGGACAAGGAGG - Intronic
949860487 3:8500699-8500721 AATCCTCTGTCAGGGCAGGGGGG + Intergenic
950601805 3:14041625-14041647 AGTCCTGAGGGAGGAAAGGGTGG + Intronic
952270353 3:31825002-31825024 AGTCCCCAGTGAGGACAAGAAGG + Intronic
953435583 3:42874853-42874875 GGTCCTGGGTGAGGCCAGGCTGG - Exonic
954131711 3:48564418-48564440 AGTACCTGGTGAGGACAGGTTGG + Exonic
954698946 3:52441783-52441805 AGGCCAGGGTGAGAACAGGGAGG - Intronic
959737978 3:109682864-109682886 AGTTCTCGGTCAGCATAGGGAGG + Intergenic
963882645 3:150546037-150546059 AGACCTCGGTAAGGAAAGAGCGG - Exonic
967809461 3:193744725-193744747 AGGCCTGGGTGAGGTCAGGACGG - Intergenic
968044462 3:195616282-195616304 AGGCCACGGTGAGCACAGGCAGG - Intergenic
968060251 3:195722333-195722355 AGGCCACGGTGAGCACAGGCAGG - Intronic
968657193 4:1783706-1783728 AGGCCTCTGTGGGGCCAGGGAGG + Intergenic
968862598 4:3184606-3184628 ATTTCAGGGTGAGGACAGGGTGG + Intronic
968870535 4:3239776-3239798 ACTCCCAGGTGAGGACAGGGAGG + Intronic
969123764 4:4930685-4930707 AGACCTTTGTGAAGACAGGGAGG - Intergenic
969671860 4:8594093-8594115 CCTGCTGGGTGAGGACAGGGTGG - Intronic
975979265 4:80137817-80137839 ACTCTTCTATGAGGACAGGGAGG - Intergenic
976138973 4:81970620-81970642 AGTCCTAGCTGAAGCCAGGGTGG + Intronic
978608594 4:110510475-110510497 ATTCCACTGTGAGGATAGGGTGG + Intronic
981010290 4:139918353-139918375 AGCCCTCGGAGAGGCCAGCGCGG - Intronic
981657715 4:147130848-147130870 AGTCCTCTGTGAAGCCTGGGTGG + Intergenic
985524561 5:395367-395389 AGTCCCGGGAGAGGACAAGGTGG + Intronic
985572320 5:654839-654861 AGTCCCAGATGGGGACAGGGAGG - Intronic
985771938 5:1817354-1817376 AGCCCTCGGTGTGGGGAGGGAGG + Intergenic
987031129 5:13977786-13977808 AGTCCTTGGTGGGGGCTGGGAGG + Intergenic
990210957 5:53480902-53480924 AGGCTTGGCTGAGGACAGGGGGG + Intronic
991990434 5:72333271-72333293 AGACCTCAGTGAGGTCAAGGAGG - Intronic
994847672 5:105010912-105010934 AGTCCTGTGAGAGGACAGTGAGG + Intergenic
998102227 5:139443931-139443953 AGTCCTGTGTGAGAAAAGGGAGG + Intronic
998351568 5:141505316-141505338 AGCCCTGGGAGAGGACAGGAGGG + Intronic
998526139 5:142844977-142844999 AGCCCTCTGTGAGGACTGGAGGG + Intronic
999006957 5:147992110-147992132 AGTGGTCCCTGAGGACAGGGAGG + Intergenic
1002089319 5:176795094-176795116 AGGCCTCGGTGGGCAAAGGGAGG + Intergenic
1002316420 5:178347096-178347118 AGTGCGCGGTGAGGACAGGGAGG - Intronic
1002326940 5:178415864-178415886 GGTACTGGGTGAGGCCAGGGAGG + Intronic
1002342682 5:178527179-178527201 GGCCCTCGGTGAGGAGAGTGGGG + Intronic
1004215063 6:13694733-13694755 ATTCCCAGGTGGGGACAGGGCGG - Intronic
1005393195 6:25354749-25354771 AGTCTTCGATGAGGTCAGGCTGG - Intronic
1006461456 6:34161643-34161665 AGACCTGGGTGAGGGCAGGGAGG + Intergenic
1007166531 6:39832315-39832337 AGTCCTCGGAGGGCTCAGGGAGG - Intronic
1007320008 6:41021290-41021312 AATCCTCAGTGAGTACACGGAGG - Intergenic
1008326213 6:50185133-50185155 AGTCCTCAGGGAGGACAGGAAGG - Intergenic
1011852506 6:91647637-91647659 AGTCCTCTGTGAGTCCAGAGCGG + Intergenic
1011852633 6:91649441-91649463 AGTCCTCTGTGAGTCCAGAGTGG + Intergenic
1015250721 6:131124761-131124783 AGTCCTGAGGGAGAACAGGGAGG + Intergenic
1018025246 6:159800488-159800510 GGGCCTCGGGAAGGACAGGGGGG + Intronic
1021100478 7:16583467-16583489 AGTACTGGGTGGGGACAGGCAGG + Intergenic
1022500137 7:30877575-30877597 AGCCCTCGGTGAGCTCATGGAGG - Intronic
1022513182 7:30955796-30955818 TGATCTCGGTGAGGGCAGGGGGG + Intronic
1023878046 7:44301382-44301404 AGTGCTTTGGGAGGACAGGGTGG - Intronic
1026786284 7:73303702-73303724 AGGCCTCGGTGGGGCCAGGCAGG + Exonic
1029403095 7:100357421-100357443 AGTCCTCAGAGAGGAGAAGGAGG - Intronic
1030604307 7:111623035-111623057 AGTCCTAGGTGAGGTGAGGTGGG - Intergenic
1034429850 7:151035809-151035831 AGTCCAGGATGGGGACAGGGAGG - Intronic
1034624099 7:152479226-152479248 AGTACTTTGGGAGGACAGGGTGG - Intergenic
1034896329 7:154878627-154878649 GCTCCTCGGTGAGGATATGGTGG - Intronic
1035161891 7:156956891-156956913 TGTCCTCTAGGAGGACAGGGAGG - Intronic
1035392869 7:158517162-158517184 GGTCCTCACTGAAGACAGGGCGG + Intronic
1035403989 7:158586995-158587017 AGCCCCCAGTGAGGACAGAGAGG + Intronic
1036703471 8:11029538-11029560 AGTTCTTGGTGAGGACGGGAGGG - Intronic
1037868840 8:22472006-22472028 AGTCCCAGCTGAGGACTGGGAGG + Intronic
1038547595 8:28437623-28437645 AGTGCTCGGGGAGGCCAAGGCGG + Intronic
1038901637 8:31850718-31850740 GGTCACAGGTGAGGACAGGGAGG - Intronic
1039979095 8:42391666-42391688 AGGGCTCGGTGTGGACAGTGAGG - Intronic
1040778300 8:51073872-51073894 AATTCTTGGTGAGAACAGGGAGG - Intergenic
1040983554 8:53269519-53269541 AATCCTCAGGGAGGAGAGGGTGG + Intergenic
1041739784 8:61145891-61145913 AGTTCTGGGTGAGGAAACGGAGG + Intronic
1046619186 8:116509683-116509705 AGTGCTAGGTGAGGTGAGGGAGG + Intergenic
1048749060 8:137650247-137650269 AGTCCTCAGCCAGGACAGGATGG - Intergenic
1049805422 8:144536630-144536652 GGTCCTGGGTGAGGCCAGGCTGG + Intronic
1052915920 9:33924281-33924303 AGTCCTAGGAGAGACCAGGGAGG + Exonic
1056606860 9:88093091-88093113 AGTGCTCAGTGAGGAAAGGGGGG - Intergenic
1057561203 9:96129271-96129293 AGTCCTGGTTGAGGTGAGGGTGG - Intergenic
1058733507 9:107873310-107873332 GGTTCTGGCTGAGGACAGGGTGG - Intergenic
1060175319 9:121493315-121493337 AGCCCTCGGTGGGCACAGGTAGG - Intergenic
1060989737 9:127841574-127841596 AGTCCTCGTAGAGGGCAGGGCGG + Intronic
1061015358 9:127978175-127978197 AATCTCCGGTGTGGACAGGGTGG - Intronic
1061092783 9:128435898-128435920 AGCTCTAGGTGAGGCCAGGGCGG + Exonic
1061529499 9:131198919-131198941 AGTCCTGGCTTTGGACAGGGAGG + Exonic
1061579814 9:131530090-131530112 AGTCCTCAGAGAGGCCAGTGTGG - Intronic
1061829323 9:133280743-133280765 AGTCCTGAGGGAGGAAAGGGTGG + Intergenic
1062325808 9:136012019-136012041 AGTACACTGTGAGGACGGGGCGG + Exonic
1186506975 X:10101324-10101346 GGACCGGGGTGAGGACAGGGTGG - Intronic
1190700977 X:52989714-52989736 GGCCCTGGGAGAGGACAGGGTGG + Intronic
1192440737 X:71171570-71171592 AGTCCAAGGTGAGGGCAGGGTGG - Intergenic
1196122233 X:112063621-112063643 AGTCCCCTGTGAGGAAAGGGGGG - Intronic
1200094201 X:153649711-153649733 AGGCCTTGGGGAGGACAGGAGGG - Intronic
1200802371 Y:7398488-7398510 AGTCCTGAGGGAGGAAAGGGTGG - Intergenic