ID: 1121021849

View in Genome Browser
Species Human (GRCh38)
Location 14:90585074-90585096
Sequence GGCCGAGGGAAGCTCAGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 345}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121021849_1121021862 24 Left 1121021849 14:90585074-90585096 CCTACCCTGAGCTTCCCTCGGCC 0: 1
1: 0
2: 1
3: 49
4: 345
Right 1121021862 14:90585121-90585143 CCCCAAATTGAGCACAGCCCAGG 0: 1
1: 0
2: 0
3: 20
4: 170
1121021849_1121021856 -8 Left 1121021849 14:90585074-90585096 CCTACCCTGAGCTTCCCTCGGCC 0: 1
1: 0
2: 1
3: 49
4: 345
Right 1121021856 14:90585089-90585111 CCTCGGCCAGGCCCCATGCTGGG 0: 1
1: 0
2: 10
3: 36
4: 362
1121021849_1121021865 30 Left 1121021849 14:90585074-90585096 CCTACCCTGAGCTTCCCTCGGCC 0: 1
1: 0
2: 1
3: 49
4: 345
Right 1121021865 14:90585127-90585149 ATTGAGCACAGCCCAGGCTCTGG 0: 1
1: 0
2: 0
3: 28
4: 245
1121021849_1121021854 -9 Left 1121021849 14:90585074-90585096 CCTACCCTGAGCTTCCCTCGGCC 0: 1
1: 0
2: 1
3: 49
4: 345
Right 1121021854 14:90585088-90585110 CCCTCGGCCAGGCCCCATGCTGG 0: 1
1: 1
2: 6
3: 28
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121021849 Original CRISPR GGCCGAGGGAAGCTCAGGGT AGG (reversed) Intronic
900432926 1:2611460-2611482 GGGCGGGGCAAGGTCAGGGTGGG + Intronic
901667643 1:10835704-10835726 GGCCGAGGGAGGCACAGGGGAGG + Intergenic
904461004 1:30679772-30679794 TGCTGAGGGCAGCTCAGGGCTGG + Intergenic
904497029 1:30892909-30892931 TGCCGGGGGAGGCTCAGGGGAGG - Intronic
905345983 1:37311506-37311528 GGCCAAGGCGAGCTGAGGGTGGG + Intergenic
906376912 1:45303651-45303673 GGCCGAGGGCGGAGCAGGGTGGG + Intronic
907285623 1:53377705-53377727 TGCCCAGGGCAGCTCAGGGCAGG - Intergenic
907860217 1:58345706-58345728 GCACGAGGGAAGCTCAGGAGAGG - Intronic
911052113 1:93680559-93680581 GGCCGAGGGAAGGTCATTTTGGG - Intronic
911123592 1:94319815-94319837 GTCTGAGGGAAGCGAAGGGTGGG - Intergenic
912008575 1:104932843-104932865 GGCTGAAGGCAGCTCAGTGTGGG + Intergenic
912391470 1:109306192-109306214 GGCGGCAGGAAGCTCGGGGTTGG + Intronic
913957855 1:143320458-143320480 GGCTGAGGCAAGATCAGGGAAGG + Intergenic
914052164 1:144145816-144145838 GGCTGAGGCAAGATCAGGGAAGG + Intergenic
914127033 1:144820725-144820747 GGCTGAGGCAAGATCAGGGAAGG - Intergenic
914246852 1:145892559-145892581 GGAGGAGGGAAGCAGAGGGTGGG + Exonic
914490381 1:148147477-148147499 GGCCCAGGCAAGCACAGGGCTGG - Intronic
915062245 1:153195838-153195860 GGCTGTGGGGTGCTCAGGGTGGG - Intergenic
915734726 1:158077549-158077571 GGCAGAGGGAAGCCCAAGGCAGG - Intronic
916693696 1:167216255-167216277 GGCAGAGGGAAGCACAGGACTGG - Intergenic
920262923 1:204701992-204702014 GGCAGAGGGATGCCCAGGCTGGG + Intergenic
921097764 1:211901747-211901769 GGCTGAGGGCAGCTCAGCATTGG + Intergenic
921161902 1:212478850-212478872 GCCCGTGGGATGCTCAGGCTGGG - Intergenic
921766979 1:218983638-218983660 TGCTGAGGGCAGCTCAGCGTAGG - Intergenic
924787307 1:247210538-247210560 GGCCAGGGGAAGCTGAGGGCCGG + Intergenic
1062969508 10:1635578-1635600 GACGGAGGGAAGCTCAGAGTGGG - Intronic
1065941203 10:30565448-30565470 GGGTGAGGGCAGCTAAGGGTGGG - Intergenic
1066961802 10:42232626-42232648 GGCTGAGGCAAGGTCAGGGAAGG + Intergenic
1067214838 10:44293223-44293245 GGCCCACGGAAGCTCCGTGTTGG + Intronic
1067796862 10:49327163-49327185 GGGCGAGGGAAGAGCAGGGTGGG - Exonic
1069059084 10:63874770-63874792 GGCTGAGGGAAGGATAGGGTGGG + Intergenic
1069853369 10:71424875-71424897 GGCTGAGAGGAGCTCAGGGAAGG + Intronic
1069885470 10:71620774-71620796 GGCCAAGGTGACCTCAGGGTTGG - Intronic
1071483572 10:86082727-86082749 GGCAGAGGGAGGCGTAGGGTGGG - Intronic
1071872451 10:89810193-89810215 GGCTGAGGGAAGCCCAGGTAAGG + Intergenic
1072216007 10:93287808-93287830 GGCTGAAGGCACCTCAGGGTTGG - Intergenic
1073148976 10:101298830-101298852 GGGGTAGGGAAGCTCAGTGTGGG + Intergenic
1073845039 10:107544976-107544998 GGCTGAGGGCAGCTCAGCGTGGG + Intergenic
1075256113 10:120926966-120926988 GGCAGAGGGAAACTCAGGGAGGG + Intergenic
1075857187 10:125639607-125639629 GGGTGGGGGAAGCTGAGGGTGGG + Intronic
1076581756 10:131516802-131516824 GGCCCAGAGCAGCCCAGGGTGGG - Intergenic
1076840641 10:133043600-133043622 GGCCTGGGGAAGGTCAGGTTTGG + Intergenic
1077430584 11:2514079-2514101 AGCTGAGGGCAGCTCAGGTTGGG - Intronic
1078171265 11:8930826-8930848 GGCTGAGGGCAGCTCAGCATGGG - Intronic
1078345578 11:10544918-10544940 CGCTGAGGGCAGCTCAGTGTGGG - Intergenic
1078541691 11:12218246-12218268 GGCCCAGGGAGGCTCTGGGATGG - Intronic
1081022245 11:37960542-37960564 GGCTGAGGGCAGATCAGGTTTGG + Intergenic
1081872474 11:46389729-46389751 AGCCGAGGGCAGCTCTGGGGCGG - Intergenic
1082848673 11:57746057-57746079 GGGAGAGGCCAGCTCAGGGTGGG - Exonic
1083235196 11:61346581-61346603 GGCCGGGGGAAGGTGAGGGTTGG - Exonic
1083269589 11:61565080-61565102 GGAGGAGGCAAGCTCAGGATGGG - Intronic
1083944348 11:65915773-65915795 GCCCTGGGGAAGCTCAGGGTGGG + Intergenic
1083954610 11:65976585-65976607 AGCCGAGGGAAGCAGAGGGCGGG - Intronic
1085448398 11:76616186-76616208 GGCAGAGGGAACCACAGGGCGGG - Intergenic
1086208741 11:84292819-84292841 GGCCCAGGGAAGCCAAGGATTGG - Intronic
1086330176 11:85746099-85746121 GGCCAGGGGATGCTCAGGGCAGG + Intronic
1088470188 11:110181988-110182010 GGCCGAGGGAGGAACAGGGAGGG - Intronic
1088741023 11:112766823-112766845 AGCAGAGGGAAGCTCAGAGAGGG - Intergenic
1088746313 11:112807784-112807806 GGTCCAGGGAAGCACAGGGATGG - Intergenic
1088904087 11:114140926-114140948 GGGCGCGGGAGGCTCAGCGTGGG - Intronic
1091001910 11:131916902-131916924 GTCCATGGGAAGATCAGGGTAGG - Intronic
1094484683 12:30915083-30915105 GCCAGAGGGCAGTTCAGGGTAGG + Intergenic
1094499647 12:31010469-31010491 GGCTGGGGTAGGCTCAGGGTGGG + Intergenic
1095444127 12:42267780-42267802 GGCTGAGGGTGGCTCAGTGTTGG - Intronic
1096174331 12:49502560-49502582 GGACTAGGGAGGCTGAGGGTGGG - Intronic
1096262060 12:50099186-50099208 GGCAAAGGGAAGCTGGGGGTGGG - Exonic
1096575758 12:52551874-52551896 GGGGGAGGGAAGCTCAGGGGAGG - Intronic
1096866817 12:54569377-54569399 GGCAGAGGGAGGCTGAGTGTGGG - Intronic
1097253660 12:57655809-57655831 GGCCAACGCAAGTTCAGGGTGGG + Intergenic
1097684201 12:62676744-62676766 GGCTGAGGGTGGCTCAAGGTGGG + Intronic
1097826199 12:64177095-64177117 TGCCAAGGAATGCTCAGGGTTGG - Intergenic
1099478696 12:83140351-83140373 GGCCGTGGGGAGCCCATGGTGGG - Intergenic
1099557544 12:84128690-84128712 GGCTGAGGGCAGCTCAGCATGGG + Intergenic
1099806360 12:87525155-87525177 GGCTGAGGGTAGGTCAGAGTTGG - Intergenic
1100581240 12:95942673-95942695 AGCCGAGGGAACCTGGGGGTGGG - Exonic
1102006892 12:109594947-109594969 GGACGAGGCAGGCTCAGGGGTGG + Intronic
1102997862 12:117363354-117363376 GGCCAAAAGAAGCTCAGAGTAGG + Intronic
1104048826 12:125183272-125183294 TGCAGAAGGAAGGTCAGGGTGGG - Intergenic
1105409570 13:20160830-20160852 GGCCGAGGGCAGCGCGGGGCGGG - Intronic
1105584677 13:21732909-21732931 GGCCTAGGGAAGATTATGGTGGG + Intergenic
1108118748 13:47160396-47160418 GGCCGAGGGCAGCTCAGCATGGG + Intergenic
1109653630 13:65361553-65361575 GGCAGAGAGAGGCTCAGGGGAGG + Intergenic
1111464784 13:88594782-88594804 GGATGAGGGAAGCTCAGCATGGG - Intergenic
1114344500 14:21781003-21781025 GGCCAAGGGAAGCTTGGTGTGGG + Intergenic
1116223160 14:42113588-42113610 GGCCGGGGGAAGCTCAGGCATGG + Intergenic
1117875010 14:60243272-60243294 GGCCGAGGGAAGCAAAAGATTGG + Intergenic
1118312366 14:64703560-64703582 GGAGGAGGGAAGCCCAGAGTGGG - Intergenic
1119484370 14:74978349-74978371 GGCAGCGGGAACCTCAAGGTGGG + Intergenic
1119523939 14:75307437-75307459 GGAAGAGGGAAGCTGAGGGTGGG + Intergenic
1119659124 14:76438003-76438025 AGCTGGGGGATGCTCAGGGTTGG + Intronic
1119854280 14:77887519-77887541 GGCCAAGGGGACCTCAGGGAAGG + Intronic
1121021849 14:90585074-90585096 GGCCGAGGGAAGCTCAGGGTAGG - Intronic
1121317926 14:92973340-92973362 GGAGGAGGGAAGCCCAGTGTTGG + Intronic
1121587574 14:95073212-95073234 GGTACAGGGAAGCACAGGGTAGG + Intergenic
1121645257 14:95514146-95514168 GTCCCAGGGCAGCCCAGGGTTGG + Intergenic
1121645598 14:95515750-95515772 GTCCCAGGAAAGCCCAGGGTTGG + Intergenic
1121782592 14:96631475-96631497 GGCCCAGGGAAGCAGAGGGAAGG + Intergenic
1122113586 14:99517148-99517170 GGGCGAGGGCAGCTCAGGTGCGG + Exonic
1122444762 14:101760929-101760951 GGCCGAGGGAAGAGGAGGGGAGG + Intergenic
1122732126 14:103808361-103808383 GGCCCAGGGAAGCCCAAAGTTGG - Intronic
1202930529 14_KI270725v1_random:29638-29660 GGCTGAGGCAAGGTCAGGGAAGG - Intergenic
1123443751 15:20306981-20307003 GGCCAGGGCAAGGTCAGGGTAGG - Intergenic
1123667192 15:22617221-22617243 GGGGGAGGGAAGCACAGGGTTGG + Intergenic
1124291585 15:28457030-28457052 GGCCCAGGAAAGCGCAGGGCTGG + Intergenic
1124321032 15:28711788-28711810 GGGGGAGGGAAGCACAGGGTTGG + Intronic
1124481465 15:30083567-30083589 GGGGGAGGGAAGCACAGGGTTGG - Intronic
1124487920 15:30135663-30135685 GGGGGAGGGAAGCACAGGGTTGG - Intronic
1124522130 15:30413627-30413649 GGGGGAGGGAAGCACAGGGTTGG + Intronic
1124536535 15:30552591-30552613 GGGGGAGGGAAGCACAGGGTTGG - Intronic
1124543009 15:30604640-30604662 GGGGGAGGGAAGCACAGGGTTGG - Intronic
1124562969 15:30792083-30792105 GGGGGAGGGAAACACAGGGTTGG - Intergenic
1124755609 15:32402658-32402680 GGGGGAGGGAAGCACAGGGTTGG + Intronic
1124762118 15:32455001-32455023 GGGGGAGGGAAGCACAGGGTTGG + Intronic
1124776512 15:32594067-32594089 GGGGGAGGGAAGCACAGGGTTGG - Intronic
1125479543 15:40070549-40070571 GGACAAGGGAAACTCAGGGCAGG - Intergenic
1125484223 15:40101147-40101169 GGTGGAGGGAAGTTCAGGGGAGG + Intronic
1125718065 15:41830881-41830903 GGCTGAGGGCAGCTCAGTGCTGG + Intronic
1125786547 15:42323394-42323416 GGCCAAAGAAAGGTCAGGGTAGG + Intronic
1125859649 15:42986886-42986908 AGCCCAGGGAAGCTCCGGGTGGG - Intronic
1128261864 15:66238224-66238246 GGCCTAGATCAGCTCAGGGTGGG - Intronic
1128309633 15:66622188-66622210 GGCTGAGGGAAGCCCACGGCCGG - Intronic
1128344904 15:66847670-66847692 GGCCAAGGGAGGCTGGGGGTGGG - Intergenic
1131247572 15:90808870-90808892 GGCAGGAGGAAGCTGAGGGTGGG - Intronic
1132527699 16:425817-425839 GGCCGAGGGCAGCTGAGGCGCGG + Exonic
1132558768 16:584144-584166 GGTCCAGGGAAGCTCTGGGGGGG + Intergenic
1132835380 16:1950366-1950388 GGCTGTGGGAAGCTCAGGGTCGG + Intronic
1134030443 16:10988383-10988405 GGAGGAGGGAAGCCCAGGGAGGG - Intronic
1134254554 16:12600653-12600675 GGCTGAGGGCAGCTCAGCATGGG + Intergenic
1134474818 16:14564049-14564071 GGTAGTGGGAAGCTTAGGGTCGG - Intronic
1136474877 16:30506667-30506689 GGAGGAGGGAGGATCAGGGTGGG - Intronic
1136707194 16:32200640-32200662 GGCCCAGGCAAGCGCAGGGCTGG - Intergenic
1136722982 16:32339118-32339140 GGCTGAGGCAAGGTCAGGGAAGG + Intergenic
1136760716 16:32728777-32728799 GGCCCAGGCAAGCGCAGGGCTGG + Intergenic
1136807387 16:33141609-33141631 GGCCCAGGCAAGCGCAGGGCTGG - Intergenic
1136841302 16:33545117-33545139 GGCTGAGGCAAGGTCAGGGAAGG + Intergenic
1139150933 16:64381250-64381272 GGCTGAGGGCAGCTCAGTGTGGG + Intergenic
1139477624 16:67210541-67210563 GGCCGATGGAGCCTCAGGCTGGG + Exonic
1139854842 16:69972171-69972193 GGCCGCGGGAAGCACAGGGGTGG - Intergenic
1140368681 16:74400433-74400455 GGCCGCGGGAAGCACAGGGGTGG + Intergenic
1140459906 16:75131223-75131245 TGAGGAGGGAAGCTCAGGGAGGG + Intergenic
1141622758 16:85245827-85245849 GGACCAGGAAAGTTCAGGGTTGG - Intergenic
1141979429 16:87540911-87540933 GACTGAGGGAGGCTCAGGGGTGG - Intergenic
1203003449 16_KI270728v1_random:178646-178668 GGCTGAGGCAAGGTCAGGGAAGG - Intergenic
1203062868 16_KI270728v1_random:989091-989113 GGCCCAGGCAAGCGCAGGGCTGG + Intergenic
1203124499 16_KI270728v1_random:1562037-1562059 GGCTGAGGCAAGGTCAGGGAAGG - Intergenic
1203135057 16_KI270728v1_random:1715053-1715075 GGCTGAGGCAAGGTCAGGGAAGG - Intergenic
1203151467 16_KI270728v1_random:1845414-1845436 GGCTGAGGCAAGGTCAGGGAAGG + Intergenic
1142905201 17:3036688-3036710 GGAAAAGGGAAGCTGAGGGTGGG - Exonic
1144031904 17:11330618-11330640 ACCCCAGGGAAGCTCAGGGAAGG - Intronic
1144422367 17:15110020-15110042 GGCCAAGGGAAGCACTGGGAAGG - Intergenic
1145190973 17:20842080-20842102 GGCCCAGGCAAGCGCAGGGCTGG - Intronic
1146182962 17:30709135-30709157 GGCCGCGGGGAGCTCGGGTTGGG - Intergenic
1146836747 17:36117232-36117254 GGCTCAGAGAAGCTTAGGGTGGG - Intergenic
1148407484 17:47430111-47430133 GGCCCCATGAAGCTCAGGGTTGG - Intronic
1149567601 17:57651130-57651152 GGCTGAGAGAAGCCCAGGGTAGG + Intronic
1149648173 17:58255543-58255565 GGCCGGGGGAAGCAGAGGTTTGG + Intronic
1150284339 17:63946798-63946820 GGCAGAGGTAAGCTAAGGGCGGG + Intronic
1151340920 17:73470467-73470489 GGCAGGGGGAAGCTGAGGCTGGG - Intronic
1151350211 17:73527416-73527438 GGCAGAGGGAACAGCAGGGTAGG + Intronic
1151550990 17:74822369-74822391 GGCCCCGGGAGCCTCAGGGTGGG - Intronic
1151826691 17:76527789-76527811 GGCAGAGCGAAGTTCTGGGTGGG - Exonic
1152101043 17:78301869-78301891 GGGCGAGGGCAGGGCAGGGTGGG + Intergenic
1152337361 17:79706412-79706434 GGCCCAGGGGCGCTCAGGATGGG - Intergenic
1152453082 17:80395942-80395964 GGGAGGGGGAAGGTCAGGGTTGG - Exonic
1152460597 17:80440065-80440087 GGCCCAGGCAACCCCAGGGTAGG - Intergenic
1152625221 17:81385036-81385058 GGCGGATGGATGCCCAGGGTGGG + Intergenic
1154176525 18:12089431-12089453 GGCCAAGGCAAGGTCAGGGCAGG - Intergenic
1154414667 18:14170657-14170679 GGCCGAGGAAAGGCCAGGGCAGG + Intergenic
1154414976 18:14171661-14171683 GGCTGAGGCAAGGTCAGGGAAGG + Intergenic
1156847191 18:41680081-41680103 GGCAGCAGGAAGTTCAGGGTTGG - Intergenic
1157529227 18:48408139-48408161 GGCCGAGGGGAGCTGGGGGTGGG - Intronic
1157591914 18:48841348-48841370 CCCAGAGGGAAGCTCAGGGAGGG - Intronic
1159213810 18:65364129-65364151 GGCCCTGGGAAGCACAGGCTGGG + Intergenic
1160014138 18:75127746-75127768 GCCCGAGGGAAGCCCAAGGGAGG - Intergenic
1160560153 18:79751025-79751047 CGCCGAGGGCAGGTCAGGGAGGG + Intronic
1160932367 19:1576817-1576839 AGCCGAGGGAAGCTCCAGGTGGG - Exonic
1160995229 19:1879343-1879365 GGCCCAGGCAAGCGCAGGGCTGG + Intronic
1161318077 19:3627632-3627654 GGGCTAGGGGAGCTCAGGATGGG - Intergenic
1161573208 19:5041471-5041493 GGCCAGGGTGAGCTCAGGGTGGG - Intronic
1161660985 19:5546104-5546126 GGCTGAAGGAAGCCCAGCGTAGG + Intergenic
1161703503 19:5807002-5807024 GGGCTGGGGAAGCTCAGAGTGGG + Intergenic
1161846889 19:6716814-6716836 GGAGGGGGGACGCTCAGGGTGGG + Intronic
1162322066 19:9976433-9976455 TACTGAGGGAAGATCAGGGTTGG + Intronic
1162975834 19:14206633-14206655 GGCCGCGGGGAGCTCGGGTTGGG + Intergenic
1164684547 19:30158230-30158252 GGAAGAGGGAAGCTCCTGGTGGG - Intergenic
1164834610 19:31349443-31349465 GGGCGAGGGAGGCTCGGGGAGGG + Exonic
1164984398 19:32637962-32637984 GGCTGAGGGCAGCTCAGTGCAGG + Intronic
1165094946 19:33405206-33405228 GGCCCAGGGAGGGTCTGGGTGGG - Intronic
1165389896 19:35532793-35532815 AGCCAAGGGAAGCCCTGGGTGGG + Intergenic
1165950110 19:39469550-39469572 GTCTGAGTGCAGCTCAGGGTCGG + Intronic
1166108358 19:40608541-40608563 GGGCAAGGGAAGCTCAGGGCCGG - Exonic
1166699614 19:44874604-44874626 GGCTGAGGGGAGATGAGGGTTGG + Intronic
1167148486 19:47695981-47696003 GGCCGGGAGAAGCTCAGAGATGG + Intronic
1167259878 19:48452431-48452453 GGCAGAGGGAAGAGCAGGGGCGG + Intronic
1167769443 19:51505221-51505243 GGCTGTGAGAGGCTCAGGGTTGG + Intergenic
1202691563 1_KI270712v1_random:98240-98262 GGCTGAGGCAAGATCAGGGAAGG + Intergenic
925048153 2:790030-790052 GGCTGAAGGCAGCTCAGGGCTGG + Intergenic
925930648 2:8705200-8705222 GGCCCAGGGAAGCGAAAGGTTGG + Intergenic
926217872 2:10916132-10916154 GAGCGGGGGAAGCTCAGGGAGGG + Intergenic
928637845 2:33266309-33266331 AGCTGAGGGTAGCTCAGTGTGGG + Intronic
929323517 2:40576962-40576984 GACCGAGATTAGCTCAGGGTTGG + Intronic
930800526 2:55438352-55438374 GGCTGAGGGCAGCTCAGCATTGG + Intergenic
931728190 2:65130525-65130547 GGCCGACGGAGGCTGGGGGTCGG + Intergenic
931750347 2:65324690-65324712 GACCAAGGGAAGCTCAAGGAGGG + Intronic
931868936 2:66439391-66439413 GGCCGCGCGAAGCCCAGGCTCGG - Intronic
932222724 2:70012019-70012041 GGCCGAGGGAGGCTGATGGAGGG + Intergenic
932436049 2:71703111-71703133 GGCTGAGGCCAGCTCAGGGTAGG - Intergenic
932644679 2:73488210-73488232 GGCTGAGGGCAGCTCAGAGTGGG - Intronic
933042545 2:77487514-77487536 GGCTGAGGCCAGCTCAGCGTGGG + Intronic
933677186 2:85067210-85067232 GGCAGAAGCAAGCTCAGGGAGGG - Intergenic
933954828 2:87355710-87355732 GGCTGAGGCAAGATCAGGGAAGG - Intergenic
934239015 2:90251924-90251946 GGCTGAGGCAAGGTCAGGGAAGG - Intergenic
934274169 2:91564774-91564796 GGCTGAGGCAAGATCAGGGAAGG + Intergenic
934323142 2:91984487-91984509 GGCTGAGGCAAGGTCAGGGAAGG - Intergenic
934461458 2:94215278-94215300 GGCTGAGGCAAGGTCAGGGAAGG - Intergenic
934536695 2:95140132-95140154 GGGTGAGGGGAGCTGAGGGTGGG + Intronic
934706326 2:96484186-96484208 GGCGGAGGGAAGCTCACGACAGG + Intergenic
934771875 2:96912494-96912516 GGCCCTGGGAAGCCCAGGGAAGG + Intronic
938262156 2:129903856-129903878 GGCCGGGGGAAGCACATGGCTGG - Intergenic
938924663 2:136028219-136028241 GGCCGAGGGAAGCTCAGTAGTGG + Intergenic
941176122 2:162199408-162199430 GGCTCATGGAAGCTCAGGCTGGG + Intronic
942940253 2:181607235-181607257 GGTCCAGGGACTCTCAGGGTTGG - Intronic
943906094 2:193502548-193502570 GGGCGGGGGAAGCTCAGGCATGG + Intergenic
944901863 2:204223665-204223687 GACTGAGGGCAGCTCAGCGTTGG - Intergenic
945039744 2:205733799-205733821 GGAGGAGGGCAGCTCAGGGGTGG - Intronic
945291892 2:208135135-208135157 GGCTCAGAGAAGCTCAGGGCAGG - Intergenic
948459221 2:238121102-238121124 GGCCCAGGGAGGGTCAGGGCTGG - Intronic
948732895 2:239978368-239978390 GGCCGCAGGAAGGTCAGGGGTGG - Intronic
949012208 2:241687124-241687146 GGACGAGGGGAGCGCAGGGTCGG + Intergenic
1170327820 20:15176184-15176206 GGCTGAGGGCAGCTTAGTGTGGG + Intronic
1170458327 20:16554004-16554026 GGCTGAGGGCAGCTCAGCGCCGG + Intronic
1171112516 20:22497150-22497172 GGGAGAGGGTAGCTCAGGATTGG - Intergenic
1172838731 20:37889146-37889168 GGACCAGGGAAGCACAGGTTTGG + Intergenic
1173190981 20:40875424-40875446 GGGCGGGGGAAGCTCAGGGAGGG - Intergenic
1173645336 20:44629698-44629720 GGCCGGTGGAGGCTCAGGGGAGG + Intronic
1175138516 20:56842649-56842671 GGCTGAGGGCAGCTCAGCATAGG + Intergenic
1176592540 21:8658233-8658255 GGCTGAGGCAAGGTCAGGGAAGG - Intergenic
1176858354 21:13987597-13987619 GGCCGAGGAAAGGCCAGGGCAGG - Intergenic
1176866108 21:14056059-14056081 GGCTGAGGCAAGGTCAGGGAAGG + Intergenic
1178275124 21:31230056-31230078 GGCAGGTGGAAGCTCAGGGGCGG + Intronic
1178293721 21:31391121-31391143 GCCCGAGGGCAGCTCTTGGTGGG + Intronic
1179707827 21:43192552-43192574 GGCTGGCGGAAGCTCTGGGTTGG - Intergenic
1179707875 21:43192816-43192838 GGTTGATGGAAGCTCTGGGTTGG - Intergenic
1180006286 21:45022464-45022486 GGCTGAGGGGAGCTCTGGGCTGG + Intergenic
1180025835 21:45161556-45161578 GGCTGAGGGAAGCACAGCGCAGG + Intronic
1180275398 22:10635381-10635403 GGCTGAGGCAAGGTCAGGGAAGG - Intergenic
1180549889 22:16530364-16530386 GGCTGAGGCAAGGTCAGGGAAGG - Intergenic
1181121302 22:20669883-20669905 GGCCCAGGCAAGCGCAGGGCTGG + Intergenic
1181334258 22:22116908-22116930 GGCCCAGGCAAGCGCAGGGCTGG + Intergenic
1181339294 22:22165543-22165565 GAAAGAGGGAAGCTCTGGGTAGG - Intergenic
1181354789 22:22291478-22291500 GGCTGAGGCAAGGTCAGGGAAGG + Intergenic
1181610282 22:24007308-24007330 GGCCCAGGGAGGATCAGAGTTGG - Intergenic
1181802183 22:25354867-25354889 GCCCGAGGCAGGGTCAGGGTTGG - Intronic
1181969202 22:26677600-26677622 AGCCGATGGAGGCTCAGGGAAGG - Intergenic
1182356830 22:29726007-29726029 GGCCCAGGAAAGCTCCAGGTGGG + Intronic
1182459341 22:30472844-30472866 GGCCGAGGCTAGCCCGGGGTTGG - Intergenic
1183072102 22:35403346-35403368 AGCCCTGGGAAGCTCAGGGATGG - Intronic
1183172314 22:36197420-36197442 GGAGGAAGGAAACTCAGGGTTGG + Intronic
1183381124 22:37491065-37491087 GGTCTAGGAAGGCTCAGGGTGGG + Exonic
1183422088 22:37717935-37717957 GGCGGGGGGAAGCTCAGGCATGG + Intronic
1183723267 22:39574437-39574459 AGTCGTGGGGAGCTCAGGGTGGG + Intronic
1183726104 22:39590487-39590509 GGCAGAGGGAAGCGGAGGCTGGG - Intronic
1184460159 22:44633330-44633352 GACCCAGGGGAGCTCACGGTGGG - Intergenic
1185092440 22:48783487-48783509 GGGCGAGGGAAGCTTTGGGGAGG - Intronic
949871501 3:8593474-8593496 GGCTGGAGGAGGCTCAGGGTGGG - Intergenic
950469583 3:13176235-13176257 GGTTGAGGCAAGTTCAGGGTGGG - Intergenic
951451734 3:22847558-22847580 GGCCAAGGGAGGCACAGGGTAGG + Intergenic
951523591 3:23631896-23631918 GTCAGAGGGAAGCCCAGGCTGGG - Intergenic
952495705 3:33914050-33914072 AGCTGAGGTAATCTCAGGGTAGG - Intergenic
952961892 3:38597555-38597577 GAGGGAGGGAATCTCAGGGTCGG - Intronic
953484937 3:43286471-43286493 GGCCGCGGGAAGGGCAGGGCGGG - Intergenic
954132446 3:48567509-48567531 GGGGCAGGGAAGCTCATGGTCGG - Intronic
955004287 3:54954678-54954700 GGCCTGGGGAATCTCAGGGCAGG - Intronic
955303770 3:57809481-57809503 GGCTGAGGGAAGCTCAGCACTGG + Intronic
957486660 3:80870820-80870842 GGCTGAGGGAGGCTGAGGGAAGG + Intergenic
958141860 3:89571754-89571776 TGCTGAGGGCAGCTCAGAGTGGG - Intergenic
958195273 3:90235549-90235571 TGCTGAGGGCAGCTCAGTGTTGG + Intergenic
958584512 3:96069217-96069239 GGCTGAGGGCAGCTCAGTGTGGG - Intergenic
959037433 3:101383736-101383758 TGCTGAGGGCAGCTCAGTGTGGG + Intronic
961684544 3:128620596-128620618 GGCCGAGGCAAGAGCAGGGCAGG + Intronic
962609567 3:137062999-137063021 GGCCGAGGAAGACTCAGGGTTGG + Intergenic
963346240 3:144099195-144099217 GGCTGAGGGTGGCTCAGGGCAGG + Intergenic
965074003 3:163953575-163953597 GGCTGAGGGTGGCTCAGCGTGGG - Intergenic
965206190 3:165720990-165721012 CCCTGAGGGAAGCTCAGTGTAGG - Intergenic
965984694 3:174736846-174736868 GGCTGAGGGAAGCTCAGCATAGG - Intronic
967948273 3:194821039-194821061 GGTTGAGGGAAGCAGAGGGTGGG + Intergenic
968258447 3:197299060-197299082 GGCCGAGGGCGGCTCAGCTTCGG - Intronic
969527534 4:7711522-7711544 GGCCCAGGGAAGAGCAGGCTGGG + Intronic
970897270 4:21118432-21118454 GGCACAGGGAAGCTGAGGGCAGG - Intronic
970959608 4:21856952-21856974 GGCCAAGGGCAGCTCAGAGCTGG + Intronic
972931092 4:44072204-44072226 GGCTGAGGGCAGCTCAGTGCTGG - Intergenic
973982264 4:56316297-56316319 GGCCGGTGGAGGCCCAGGGTGGG - Exonic
974420111 4:61662548-61662570 GGCTGAGGGTAGCTCAGCGTGGG + Intronic
975616517 4:76252258-76252280 GGCCAAGTGGAGCCCAGGGTTGG + Intronic
976569686 4:86594197-86594219 GGTCGAGGGGAGCTCGGGGTGGG + Intergenic
977606899 4:98993581-98993603 GGCCGGGGGAGGCTCAGGCATGG + Intergenic
978219772 4:106256332-106256354 GGCTGAGGGCAGCTCAGTGCTGG - Intronic
978385670 4:108173238-108173260 GGCCGAGGGACGCGGAGGGCCGG - Intergenic
983784537 4:171715408-171715430 GGCTGAGGGCAGCTCAGTGCTGG + Intergenic
985083641 4:186291843-186291865 GGAAGAGGGAAGCCCAGAGTTGG - Intergenic
985481254 5:112213-112235 GACTCAGGGAAGCTCAGGGCTGG - Intergenic
985485375 5:145739-145761 GGCAGATGGAAGCTCAGAGATGG + Intronic
985708977 5:1417676-1417698 GGCCCAGGGAAGGGCAAGGTGGG - Intronic
985729197 5:1537727-1537749 GCCCGAGTGAGCCTCAGGGTTGG + Intergenic
985780031 5:1865695-1865717 CGGTGAGGGAAGCTCAGGGGAGG - Intergenic
986912515 5:12574612-12574634 GGCGGGGGGAAGCTCAGGCATGG + Intergenic
987912765 5:24170174-24170196 TGCCGAGGGCAGGGCAGGGTGGG + Intronic
988940354 5:36139336-36139358 GGCTGAGGGCAGCTCAGCATGGG + Intronic
990393714 5:55354993-55355015 GGGCGAGGGAAGCTCTGAGAAGG + Intronic
991488197 5:67159673-67159695 GGCCGAGGGGGGCCCAGGGCAGG - Intronic
992515901 5:77492154-77492176 GGCCGAGGTAAACCCCGGGTGGG - Exonic
997427204 5:133811518-133811540 GGCCCAAGGCGGCTCAGGGTTGG - Intergenic
999695932 5:154189233-154189255 GGCTAAGCGAAGCTCAGGGCAGG + Intronic
1003836186 6:10074804-10074826 GGCGGGGGGAAGCTCAGGAATGG + Intronic
1005754209 6:28911074-28911096 GGCCTTGGGAAGCTCATGTTTGG - Intronic
1005803053 6:29446303-29446325 AGGCAAGGGAAGCTCAGGGAAGG - Intronic
1006101077 6:31686778-31686800 GCCTGAGGAAAGCTCAGGTTAGG + Intergenic
1007421871 6:41724516-41724538 AGCCCAGGGAGGCCCAGGGTTGG - Intronic
1009684275 6:66936350-66936372 GGCTGAGGGCAGCTCAGCATGGG + Intergenic
1011101510 6:83727875-83727897 GGCAGAGGGCAGCTCTTGGTGGG - Intergenic
1011284214 6:85706383-85706405 GGCTGAGGGCAGCTCAGTGTGGG - Intergenic
1013473490 6:110486841-110486863 GGCCAAGGGGAGGACAGGGTGGG - Intergenic
1015837725 6:137439781-137439803 GGCCTAGGGCAGGGCAGGGTGGG - Intergenic
1016138707 6:140581794-140581816 GGAAGAGGGAAGATCTGGGTTGG - Intergenic
1019505822 7:1390209-1390231 GGGAGAGAGAATCTCAGGGTTGG + Intergenic
1019610276 7:1933223-1933245 GGCCCAGGGATACTCCGGGTAGG + Intronic
1020070069 7:5221353-5221375 GGCTGATGGAAGGTCAAGGTGGG - Intronic
1020084998 7:5305415-5305437 GGCCTAGGGAAGCTATAGGTGGG - Exonic
1020087702 7:5320491-5320513 GGCCTCGGGAGGCTCGGGGTGGG - Intronic
1022009055 7:26292837-26292859 GGCCGAGGGACGCTGAGTGTTGG + Intronic
1022391848 7:29950367-29950389 GGCTGAGGGCAGCTCAGTGTGGG + Intronic
1022452177 7:30525659-30525681 GGGGGAGGGAAACACAGGGTTGG + Intronic
1023119544 7:36895247-36895269 GGGGTGGGGAAGCTCAGGGTGGG + Intronic
1023494462 7:40779600-40779622 GGCCAAGGGAAATTGAGGGTGGG + Intronic
1024153933 7:46601065-46601087 TGGCTAGGGAAGCTCAGGGAGGG - Intergenic
1025665328 7:63580252-63580274 GGCCTCGGGAGGCTCGGGGTGGG - Intergenic
1027232839 7:76282281-76282303 AACCGGGGGTAGCTCAGGGTGGG - Intronic
1027995754 7:85423777-85423799 TGCCGAAGGCAGCTCAGGGTGGG + Intergenic
1029218503 7:98969727-98969749 GGCTGCGGGAAGCTATGGGTGGG + Intronic
1029556913 7:101276721-101276743 GGCAGAAGGCAGCCCAGGGTTGG + Intergenic
1029664120 7:101983434-101983456 GGCCCAGGGCACCCCAGGGTGGG - Intronic
1030394512 7:108968794-108968816 GGGAGGAGGAAGCTCAGGGTTGG + Intergenic
1031837065 7:126691145-126691167 GGCTAAGGGCAGCTCAGTGTTGG - Intronic
1032000693 7:128263257-128263279 GGCCCTGGGAAGATTAGGGTAGG - Intergenic
1034553491 7:151835736-151835758 GACCAATGGAAGCCCAGGGTGGG - Intronic
1035762999 8:2083667-2083689 GGGAGAGGGAAGCACAGGGGTGG - Intronic
1037764422 8:21763555-21763577 GGCAGTGGGGAGCTAAGGGTAGG - Intronic
1038228397 8:25677927-25677949 GTGCTATGGAAGCTCAGGGTAGG - Intergenic
1040418695 8:47219359-47219381 AGCAGAGGGGTGCTCAGGGTGGG + Intergenic
1042131898 8:65595481-65595503 GGCAGTGGGAAACTCAGGGTAGG - Intergenic
1042893729 8:73642724-73642746 GGCCTGGGGAATGTCAGGGTAGG + Intronic
1044449160 8:92313817-92313839 GGCCAAGGGAAGCTCAAACTGGG - Intergenic
1045337671 8:101223577-101223599 GGTCCAGGGTAGCTGAGGGTTGG + Intergenic
1048205798 8:132414307-132414329 AGCCCAGGGAAGCCCAGGGAGGG + Intronic
1049105225 8:140608591-140608613 GGCTGAGGGAAGGTCATGGCTGG + Intronic
1049195328 8:141312674-141312696 GGGCCAGGGAAGCTGAGGGCAGG - Intergenic
1049444450 8:142623610-142623632 GGGTCAGGGAAGGTCAGGGTGGG + Intergenic
1049455001 8:142682282-142682304 GGCCATGGGAGGGTCAGGGTGGG - Exonic
1049658613 8:143809800-143809822 GGCAGCGGGAAGCTCAGGGAAGG - Intronic
1050016166 9:1236719-1236741 GGCCGAGAGAGGCTCAGGTCAGG - Intergenic
1050426389 9:5516630-5516652 GGCTGAGGGTGGCTCAGGGCAGG - Intronic
1052982944 9:34462003-34462025 GGGTGAGGGAAGATCAGGGTTGG + Intronic
1053691935 9:40590931-40590953 GGCTGAGGCAAGGTCAGGGAAGG - Intergenic
1054272868 9:63046560-63046582 GGCTGAGGCAAGGTCAGGGAAGG + Intergenic
1054303192 9:63391897-63391919 GGCTGAGGCAAGGTCAGGGAAGG - Intergenic
1054401971 9:64718407-64718429 GGCTGAGGCAAGGTCAGGGAAGG - Intergenic
1054435577 9:65202722-65202744 GGCTGAGGCAAGGTCAGGGAAGG - Intergenic
1054494816 9:65818965-65818987 GGCTGAGGCAAGGTCAGGGAAGG + Intergenic
1054923379 9:70564085-70564107 GGGAGAGGGAAGCTCTGGGAAGG + Intronic
1059725715 9:117006318-117006340 TGCAGTGGGAAGGTCAGGGTTGG - Intronic
1060342940 9:122792868-122792890 GGCTGAGGCAAGGCCAGGGTGGG + Intergenic
1060995388 9:127872743-127872765 GTCCGAGGTCAGCTCAGGCTCGG - Exonic
1062339846 9:136089188-136089210 GGCAGGGGGAGGCTCTGGGTGGG - Intronic
1062585451 9:137247473-137247495 GGACAGGGGAAGCTCAGGGATGG - Intronic
1203622595 Un_KI270749v1:137067-137089 GGCTGAGGCAAGGTCAGGGAAGG - Intergenic
1185935943 X:4257305-4257327 GGCTGAGGGTGGCTCAGGGTGGG + Intergenic
1186223694 X:7375509-7375531 GGCTGAGGGCAGCTCTGTGTGGG - Intergenic
1186349332 X:8727364-8727386 GGTGTAGGGAAGATCAGGGTTGG + Intronic
1186437923 X:9559231-9559253 GGCCAAGAGAAGATCATGGTAGG - Intronic
1188727799 X:33607142-33607164 GGCTGAGGGCAGCTCAGTGAAGG - Intergenic
1190730837 X:53224644-53224666 GGCGGAGGGCAGCTCGAGGTGGG - Intronic
1190935996 X:54999896-54999918 GGCAAAGGGAAGTTCATGGTTGG - Intergenic
1191148863 X:57198737-57198759 TTCCCAGGGAAGCTCAGGGATGG - Intergenic
1191225418 X:58037745-58037767 GGCAGAGGGAATCACAGGGCTGG - Intergenic
1192284597 X:69721497-69721519 GGCAAAGGGAAGCTCAGGCCTGG + Intronic
1195178594 X:102334359-102334381 GGCTGAGGGCAGCTCAGTGCTGG + Intergenic
1195180270 X:102352724-102352746 GGCTGAGGGCAGCTCAGTGCTGG - Intergenic
1195365012 X:104116806-104116828 GGCCCAGGGAAGAGCAGAGTTGG - Intronic
1195454263 X:105051013-105051035 GTCCGAGGGAAGCCATGGGTGGG + Intronic
1195655732 X:107329806-107329828 AGCCAAGGGAAGATGAGGGTTGG + Intergenic
1198178176 X:134175456-134175478 GGCAGAGGAAAGCTCAAAGTGGG - Intergenic
1198332582 X:135635283-135635305 GGCAGAGCGAAGTTCAGGATGGG + Intergenic
1200282094 X:154785667-154785689 GGCAGAGGGAGGCTCAGTGTTGG + Intronic
1200749189 Y:6929285-6929307 GGCCAAGGGTAGCTCAGTGCAGG - Intronic
1201190565 Y:11439475-11439497 GGCTGAGGCAAGGTCAGGGAAGG - Intergenic
1201336542 Y:12887537-12887559 GGCAGAGAGAAGCTAAGGCTAGG - Intergenic