ID: 1121022377

View in Genome Browser
Species Human (GRCh38)
Location 14:90588175-90588197
Sequence CACCAGAGGTTGCATCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 183}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121022377_1121022386 0 Left 1121022377 14:90588175-90588197 CCCTGCTGATGCAACCTCTGGTG 0: 1
1: 0
2: 2
3: 17
4: 183
Right 1121022386 14:90588198-90588220 CCTGGGAGGAGTCTGGGCAAAGG 0: 1
1: 1
2: 3
3: 48
4: 421
1121022377_1121022392 27 Left 1121022377 14:90588175-90588197 CCCTGCTGATGCAACCTCTGGTG 0: 1
1: 0
2: 2
3: 17
4: 183
Right 1121022392 14:90588225-90588247 AGGCCAGGCCAGGCCAGGCCAGG 0: 8
1: 20
2: 103
3: 380
4: 1954
1121022377_1121022389 17 Left 1121022377 14:90588175-90588197 CCCTGCTGATGCAACCTCTGGTG 0: 1
1: 0
2: 2
3: 17
4: 183
Right 1121022389 14:90588215-90588237 CAAAGGCGCCAGGCCAGGCCAGG 0: 1
1: 0
2: 5
3: 34
4: 421
1121022377_1121022390 22 Left 1121022377 14:90588175-90588197 CCCTGCTGATGCAACCTCTGGTG 0: 1
1: 0
2: 2
3: 17
4: 183
Right 1121022390 14:90588220-90588242 GCGCCAGGCCAGGCCAGGCCAGG 0: 1
1: 4
2: 33
3: 155
4: 994
1121022377_1121022387 7 Left 1121022377 14:90588175-90588197 CCCTGCTGATGCAACCTCTGGTG 0: 1
1: 0
2: 2
3: 17
4: 183
Right 1121022387 14:90588205-90588227 GGAGTCTGGGCAAAGGCGCCAGG 0: 1
1: 0
2: 0
3: 14
4: 208
1121022377_1121022384 -6 Left 1121022377 14:90588175-90588197 CCCTGCTGATGCAACCTCTGGTG 0: 1
1: 0
2: 2
3: 17
4: 183
Right 1121022384 14:90588192-90588214 CTGGTGCCTGGGAGGAGTCTGGG 0: 1
1: 0
2: 0
3: 78
4: 856
1121022377_1121022388 12 Left 1121022377 14:90588175-90588197 CCCTGCTGATGCAACCTCTGGTG 0: 1
1: 0
2: 2
3: 17
4: 183
Right 1121022388 14:90588210-90588232 CTGGGCAAAGGCGCCAGGCCAGG 0: 1
1: 0
2: 4
3: 32
4: 403
1121022377_1121022393 28 Left 1121022377 14:90588175-90588197 CCCTGCTGATGCAACCTCTGGTG 0: 1
1: 0
2: 2
3: 17
4: 183
Right 1121022393 14:90588226-90588248 GGCCAGGCCAGGCCAGGCCAGGG 0: 2
1: 2
2: 33
3: 145
4: 1394
1121022377_1121022383 -7 Left 1121022377 14:90588175-90588197 CCCTGCTGATGCAACCTCTGGTG 0: 1
1: 0
2: 2
3: 17
4: 183
Right 1121022383 14:90588191-90588213 TCTGGTGCCTGGGAGGAGTCTGG 0: 1
1: 0
2: 1
3: 68
4: 793

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121022377 Original CRISPR CACCAGAGGTTGCATCAGCA GGG (reversed) Intronic
900893763 1:5468685-5468707 CAGCAGAGGCTGGATGAGCAAGG + Intergenic
903223298 1:21880840-21880862 CACAACAGGGTGGATCAGCACGG + Intronic
904550345 1:31311608-31311630 CTCCAGAGGATGCAGCAGGAAGG - Intronic
904988913 1:34575820-34575842 CTCCAGAGGGTGCAGCAACAAGG + Intergenic
905558660 1:38908638-38908660 CCCCAGAGGTTTGAGCAGCAGGG - Intronic
906473829 1:46153504-46153526 CAGCAGAGGTGGCAGCAGCCAGG - Intronic
906510996 1:46410478-46410500 CACCAGAGGCTTCACCAGGAAGG - Exonic
906513314 1:46423854-46423876 CAGCAGAAGTAGCATCATCAGGG - Intergenic
907108071 1:51901911-51901933 CTCCAGAGGTTGCGGCAACAAGG + Intergenic
913978830 1:143489206-143489228 CATCAGAGACTGCCTCAGCATGG + Intergenic
914073236 1:144314855-144314877 CATCAGAGACTGCCTCAGCATGG + Intergenic
914105918 1:144651505-144651527 CATCAGAGACTGCCTCAGCATGG - Intergenic
917354437 1:174111533-174111555 CTCCAGAGGATGCAGCAACAAGG + Intergenic
918529487 1:185502547-185502569 GTCCAGAGTTGGCATCAGCAGGG - Intergenic
919663441 1:200270041-200270063 CTCCAGAGGTGGCAGCACCAGGG + Intergenic
919788543 1:201275579-201275601 CCGCAGAGCTGGCATCAGCATGG - Intergenic
1065605759 10:27415861-27415883 CTCCAGAGGGTGCAGCAACAAGG + Intergenic
1067267762 10:44761315-44761337 CACAAGAGTTTGCACCAGAAAGG + Intergenic
1072058549 10:91786146-91786168 CTCCAGAGGATGCAGCAACAAGG + Intergenic
1073945061 10:108740875-108740897 CAGCAGAGGCTGCAGTAGCAGGG - Intergenic
1074349639 10:112723604-112723626 AACCACAGGTTTGATCAGCAGGG - Intronic
1075810013 10:125218499-125218521 CAGAAGAGGGAGCATCAGCAGGG - Intergenic
1077608150 11:3626166-3626188 CAGCAGTGTCTGCATCAGCAAGG + Intergenic
1078406214 11:11072078-11072100 CACCTGAGGTTGCATAGTCAGGG + Intergenic
1079767029 11:24406593-24406615 CACTAGAGGTTTCAGCAGCAGGG + Intergenic
1079938223 11:26643904-26643926 CTCCAGAGGATACAGCAGCAAGG + Intronic
1079982226 11:27163368-27163390 CTCCAGAGGATGCAGCAACAAGG + Intergenic
1084306775 11:68290683-68290705 CTCCAGAGGATGCAGCAGCAAGG + Intergenic
1086307187 11:85493979-85494001 CTCCAGAGGATGCAGCAACAAGG - Intronic
1088220954 11:107569819-107569841 CCCTAGAGGTTGGAGCAGCAGGG - Intergenic
1093044291 12:14424470-14424492 CACCAGAGGTGGCATCACCAGGG - Exonic
1094802931 12:34058641-34058663 CTCCAGAGGATGCAGCAGTAAGG + Intergenic
1095669691 12:44844047-44844069 CTCCAGAGGCTGCAGCAACAAGG - Intronic
1096548000 12:52354451-52354473 CTCCAGATGCTGCCTCAGCATGG + Intergenic
1098010547 12:66046164-66046186 CCCCAGAGGTGGAACCAGCAGGG + Intergenic
1098416621 12:70242794-70242816 CACCAGTGGTTTCATCAGAGGGG + Intergenic
1100194924 12:92234622-92234644 CAGCAGCAGTTGCATCAGCCAGG - Intergenic
1104346956 12:128008966-128008988 CGCCAGAGGTTGCAAATGCATGG - Intergenic
1105065457 12:133193511-133193533 CTCCAGAGGATGCAGCAACAAGG - Exonic
1105220502 13:18322184-18322206 CATCAGAGACTGCCTCAGCATGG - Intergenic
1107975462 13:45683968-45683990 CAGCAGAGGGAGCAGCAGCAGGG - Intergenic
1111813502 13:93121031-93121053 CAGCAGAGGTTCCAAAAGCATGG + Intergenic
1114482428 14:23044101-23044123 CTCCAGAGGGAGCATCAGGAAGG - Exonic
1114710729 14:24775321-24775343 CACCAGCGGAGGCATAAGCAAGG + Intergenic
1116386812 14:44341112-44341134 GATGAGAGGTTGCATAAGCATGG - Intergenic
1117211352 14:53503735-53503757 CACCAGTAGTTGCATGAGCCAGG + Intergenic
1117717488 14:58595952-58595974 CTCCAGAGGTTGAAGCAGGAGGG - Intergenic
1119400396 14:74358651-74358673 CACCACAGGTTGGCTCAGCAAGG - Exonic
1120820402 14:88906947-88906969 CTCCAGAGGATGCAACAACAAGG - Intergenic
1120832338 14:89008525-89008547 CATCAGAGGTTGCATCTAGAGGG + Intergenic
1121022377 14:90588175-90588197 CACCAGAGGTTGCATCAGCAGGG - Intronic
1121713637 14:96057291-96057313 CTCCAGAGGGTGCAGCAGCAAGG + Intronic
1122284156 14:100640926-100640948 CTCCAGAGGCTTCCTCAGCAGGG - Intergenic
1122788677 14:104175427-104175449 CACCAGAGGCTGCATCCCCCAGG + Exonic
1122874415 14:104656941-104656963 CACCAGAGGTGGGCGCAGCAAGG + Intergenic
1124889118 15:33715718-33715740 CTCCAGAGGATGCAGCAACATGG - Intronic
1128589971 15:68887276-68887298 CTCCAGAGGTTGCTTCTTCAGGG + Intronic
1130199123 15:81808848-81808870 CACCAGAACTTGCATCCTCAGGG - Intergenic
1132320438 15:100920870-100920892 CAGCAGAGGCTGGATCAGCTGGG - Intronic
1132739228 16:1403058-1403080 CAGCAGAGCCTGCAGCAGCAGGG + Intronic
1133201161 16:4205518-4205540 CACCAGTGGTCTCAGCAGCACGG + Intronic
1133907018 16:10031670-10031692 CACCAGAGGATGCTTCTGGAAGG + Intronic
1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG + Intronic
1142189573 16:88711743-88711765 CACCAGAGGGAGGATCCGCAGGG - Intronic
1143848461 17:9791249-9791271 CAGCAGGGGGAGCATCAGCATGG + Exonic
1144354281 17:14429266-14429288 AACCAGAGCTTGCACCAGCCTGG + Intergenic
1144931025 17:18858543-18858565 CACCACAGGTCCCATCATCAGGG - Intronic
1148919628 17:51019136-51019158 CTCCAGAGGATGCAGCAACAAGG + Intronic
1150162485 17:62910431-62910453 CTCCAGAGGATGCAGCAACAAGG - Intergenic
1150630732 17:66878670-66878692 CACCAGATGTTCACTCAGCATGG + Intronic
1151403494 17:73871667-73871689 CACCTGAGCCTGCAGCAGCAAGG + Intergenic
1151416628 17:73970519-73970541 CAGCAGAGGCTGCATCAGGAGGG - Intergenic
1152538982 17:80965389-80965411 CAGCCGAGGTCGCATCAGCATGG - Exonic
1154074767 18:11189096-11189118 CACCTGAGGTTTCTTCATCAGGG + Intergenic
1154172137 18:12060142-12060164 CACCAGGGCTTGCATCTGCATGG + Intergenic
1158949269 18:62476845-62476867 CTCCAGAGGCTGCAGCAACAAGG - Intergenic
1158949337 18:62477671-62477693 CTCCAGAGGCTGCAGCAGCAAGG + Intergenic
1159639032 18:70841667-70841689 CACCAGCTGGTGCATCAGAATGG + Intergenic
1163364218 19:16867271-16867293 CACAAGAGGTTGCATTTGCCTGG + Intronic
1164534532 19:29075452-29075474 CAGCAGAGGCTGCAGCACCAAGG - Intergenic
1164770528 19:30804986-30805008 CACCATGGGTTGCATCACAAAGG - Intergenic
1164916292 19:32054872-32054894 CTCCAGAGGATGCAGCAGCAAGG - Intergenic
1166311644 19:41966619-41966641 AACCAGAGATGGCATCAGCCGGG + Exonic
1167486991 19:49768306-49768328 CTTCAGAGGCTGCATCCGCATGG + Intronic
925621019 2:5793020-5793042 AACCAGAGTTTGCATCAGGGAGG - Intergenic
925621090 2:5793668-5793690 AACCAGAGTTTGCATCAGGGAGG - Intergenic
927187015 2:20489124-20489146 CAGCAGACTTTGCATGAGCAAGG + Intergenic
928707681 2:33968059-33968081 CACTGGAGGTTGCAGCAACAAGG - Intergenic
928760713 2:34578630-34578652 CATCAGAGGTTGCAGAAGAAAGG + Intergenic
929387517 2:41427237-41427259 CACCAGAGGTGACATCTGTAAGG + Intergenic
933967407 2:87441380-87441402 CAGCATTGGTTGCATCACCAAGG + Intergenic
934183554 2:89650287-89650309 CATCAGAGACTGCCTCAGCATGG + Intergenic
934293837 2:91724459-91724481 CATCAGAGACTGCCTCAGCATGG + Intergenic
934908915 2:98232811-98232833 CACCTCAGGTAGCACCAGCAGGG - Intronic
936286672 2:111186619-111186641 CCACAGAGTTTGCATCAACACGG - Intergenic
936326389 2:111509116-111509138 CAGCATTGGTTGCATCACCAAGG - Intergenic
936438905 2:112533255-112533277 CAGCAGAGATTGCATGGGCAGGG + Exonic
938671657 2:133592192-133592214 CACCTGAACTTTCATCAGCAAGG - Intergenic
938912877 2:135901509-135901531 CTCCAGAGGATGCAGCAACAAGG + Intergenic
939155819 2:138523770-138523792 CAAAGGATGTTGCATCAGCATGG - Intronic
939455983 2:142436032-142436054 CTCCAGAGGTTGCAGCAACGGGG + Intergenic
939544160 2:143532076-143532098 CACCAAAGATGGCATCACCAAGG + Intronic
940049888 2:149451185-149451207 CTCCAGAGGATGCAGCAGCAAGG - Intronic
941538133 2:166746127-166746149 CTCCAGAGGTGACATCAGGAAGG - Intergenic
941957383 2:171218661-171218683 CCCCAGAGGATGCAGCAACAAGG - Intronic
943812296 2:192202651-192202673 CATCAGAGGTTGCCTAAGCAAGG + Intergenic
945999883 2:216473170-216473192 GACCAGAGGTTGCTTGAGGATGG - Intronic
946097923 2:217291637-217291659 CACAAGGGGTTTCAGCAGCAGGG - Intronic
946842920 2:223836344-223836366 CACCAGATCTCTCATCAGCAGGG + Intronic
946986874 2:225283140-225283162 CCCCAGAGGTAGCCTCAGCTTGG - Intergenic
947995609 2:234524707-234524729 CTCCAGAGGATGCAGCAGCAAGG + Intergenic
1169140031 20:3222565-3222587 CACCAGAGGCTGCAAAAGCCTGG - Intronic
1169255039 20:4090827-4090849 CCCCAGATGTTCCAGCAGCATGG - Intergenic
1170725153 20:18919588-18919610 CAGCAGAGGTTGGAACAGCTTGG + Intergenic
1170916911 20:20635189-20635211 CTCCCGAGATTGCATCATCATGG + Intronic
1175646128 20:60673350-60673372 CACCAGGCGTGGCCTCAGCATGG + Intergenic
1177269283 21:18825001-18825023 CACCAGCCTTTGCATCAGCAAGG - Intergenic
1178767604 21:35469002-35469024 CACCAGTGTGTGCATCGGCAGGG + Intronic
1180888617 22:19268202-19268224 CTCCAGAGGATGCAGCAACAGGG + Intronic
1181040661 22:20191099-20191121 CCCCAGAGGTTTGAGCAGCAGGG + Intergenic
1182902243 22:33908106-33908128 CACTCGAGGTTTCATCAGAAAGG + Intronic
950368641 3:12508078-12508100 GACCAGAGCTAGCATCAGTATGG + Intronic
951024420 3:17814747-17814769 CTCCAGTGGATGCAGCAGCAAGG - Intronic
951636469 3:24783991-24784013 CTCCAGAGGATGCAACATCAAGG - Intergenic
952002932 3:28808279-28808301 CACTAGAGGTTTGAGCAGCAGGG - Intergenic
952221501 3:31328138-31328160 CAGCAGAGGTTGGAAGAGCACGG - Intergenic
954996640 3:54887921-54887943 GACAAGAGGATGCTTCAGCAGGG - Intronic
958627538 3:96645658-96645680 TACCAGAGTTTGCTTCAGAATGG + Intergenic
958681625 3:97339328-97339350 CACCAAAGATTGCATCATCCTGG + Intronic
958832490 3:99106510-99106532 TCCCAGAGGATGCATCAACAAGG - Intergenic
959154781 3:102653534-102653556 CTCCAGAGGATGCAACAACAAGG + Intergenic
962597156 3:136957901-136957923 ACCCAGATGTTGCATCAGCAGGG - Exonic
966025534 3:175275939-175275961 CACCAGAAGTTACACCACCATGG + Intronic
975241576 4:72066157-72066179 CTCCAGAGGATGCAGCAACAAGG - Intronic
976425723 4:84901038-84901060 CTCCAGAGGATGCAGCAACAAGG - Intronic
976835206 4:89364370-89364392 CACCAGAGGTGGAGACAGCAGGG + Intergenic
976929805 4:90551974-90551996 CTCCAGAGGATGCAACATCAAGG - Intronic
978368001 4:108002678-108002700 CTCCAGAGCATGCAGCAGCAAGG + Intronic
979288284 4:118951281-118951303 CTCCAGAGGATGCAGCAACAAGG - Intronic
979899489 4:126200240-126200262 CAGGTCAGGTTGCATCAGCAAGG + Intergenic
980866134 4:138555354-138555376 CTACAGATGCTGCATCAGCAGGG + Intergenic
981645166 4:146991054-146991076 CACCAGTGGCTGCAGCAACAAGG + Intergenic
981744863 4:148042943-148042965 CACAAGAAATAGCATCAGCATGG - Intronic
984837702 4:184037443-184037465 TACCAGAGGTTGAATCTTCATGG - Intergenic
986268700 5:6212544-6212566 CACCAGACACTGCATCAGCCAGG + Intergenic
988136896 5:27184787-27184809 CAAGAGGGGTTGCAGCAGCAGGG - Intergenic
989954257 5:50338264-50338286 CTCCAGAGGATGCAGCAACAAGG - Intergenic
992038236 5:72802771-72802793 CTCTAGAGGTTTGATCAGCAGGG + Intergenic
992124471 5:73626386-73626408 CACCTGAGTTCGCATCCGCAGGG + Intronic
992370106 5:76135104-76135126 CTCCAGAGGTAGAGTCAGCAAGG + Intronic
993299089 5:86184267-86184289 CACCTGAGGCTGTATCAGGAAGG + Intergenic
996543959 5:124658164-124658186 CCCCTGAGCTTGCTTCAGCAAGG + Intronic
999308838 5:150538442-150538464 GACCAGAGGTGGCAGCAGCTTGG + Intronic
1001437263 5:171709731-171709753 CTCCAGAGGGCGCAGCAGCAAGG + Intergenic
1001619947 5:173075369-173075391 CAGCAGAGGTTGCCTATGCAAGG - Intronic
1001859303 5:175039285-175039307 TAACAGAGGTTCCATCAGCCTGG - Intergenic
1005401718 6:25440866-25440888 CACCAGAGGTACCCTAAGCAAGG - Intronic
1006408353 6:33857858-33857880 GACCAGAGGCTGACTCAGCAGGG + Intergenic
1007159029 6:39774134-39774156 CTCCAGAGGTCTCATCAGCAAGG + Intergenic
1007575367 6:42922239-42922261 CACCAGAGGCTGCCACAACAGGG + Intronic
1009059124 6:58375982-58376004 CACCAGAGACATCATCAGCATGG + Intergenic
1010553025 6:77246134-77246156 CACCAGAGGGCGCATCTGTAAGG + Intergenic
1014201949 6:118618151-118618173 CACCAGAGGCTCCCACAGCATGG + Intronic
1015962778 6:138668069-138668091 CACCACAGGTTAAACCAGCATGG + Intronic
1018839269 6:167507056-167507078 AAGCAGAGGTTTCATCAGCCTGG + Intergenic
1019216352 6:170446515-170446537 CACCAGAGTTTGCATCAGGTGGG - Intergenic
1022421711 7:30229748-30229770 CTCCAGAGGATGCAGCAACAAGG - Intergenic
1022970630 7:35513730-35513752 CACCAGATTCTGCATCAACATGG + Intergenic
1027778533 7:82495938-82495960 CACCATAGGTTGATACAGCAAGG - Intergenic
1027783390 7:82549002-82549024 CACCATAGGTAGCAGAAGCAAGG + Intergenic
1029661169 7:101963103-101963125 CATCAGAGGTGGCATCAGCAGGG - Intronic
1031727255 7:125256170-125256192 CACCAGCTTTTGTATCAGCAAGG + Intergenic
1032773284 7:135082050-135082072 AACCAGAGGTTGGATGAGCCTGG - Intronic
1033956386 7:146854036-146854058 CAACAGAGTTTGCAGCAACAGGG + Intronic
1036026976 8:4919878-4919900 CTCCAGAGGGTGCAGCAACAAGG + Intronic
1036560617 8:9898196-9898218 CAGCAGCGGTTGCATTTGCAAGG + Intergenic
1043314532 8:78903791-78903813 CACCAGAGATGGCATAGGCAAGG - Intergenic
1043982242 8:86656776-86656798 AAACAGAAGTTGCATCACCAGGG + Intronic
1044383908 8:91564967-91564989 CACCAGCGGGTGCAGCAGAAGGG - Intergenic
1044944832 8:97380293-97380315 CTCCACAGGATGCCTCAGCAAGG + Intergenic
1045534108 8:103010952-103010974 CACCAGAGCTTTCTTCAGGAAGG - Intergenic
1045897147 8:107233263-107233285 GACGAGAAGTTGCACCAGCAGGG + Intergenic
1046262557 8:111788047-111788069 CTCCAGAGGATGCAGCAACAAGG - Intergenic
1051144125 9:14008103-14008125 CCCTAGAGGTTTCACCAGCAGGG + Intergenic
1051922876 9:22288274-22288296 CTCCAGAGGATGCAGCATCAAGG - Intergenic
1052270727 9:26625610-26625632 CACCAGAGGTGAGATCAGCATGG + Intergenic
1055376681 9:75656030-75656052 CTCCAGAGGGTGCAGCAACAAGG + Intergenic
1056755856 9:89381690-89381712 CAGCAGAGGATGCATGAGCCTGG + Intronic
1057373564 9:94497032-94497054 CCCAAAAGGTTGCAGCAGCAGGG - Intergenic
1060182112 9:121541510-121541532 AGCCAGAGGTTGAATGAGCAGGG - Intergenic
1061326533 9:129867978-129868000 AACCAGGGGCTGCATCAACAGGG - Intronic
1061658285 9:132109795-132109817 CATCACAGGTTACATCTGCATGG - Intergenic
1061797715 9:133098093-133098115 CACCAAAGATTCCATCATCAGGG - Exonic
1185922040 X:4104109-4104131 CACCAGAAGCTGCAGGAGCAAGG + Intergenic
1188249901 X:27879978-27880000 CTCCAGAGGATGCAGCAACAAGG - Intergenic
1189380097 X:40496500-40496522 CTCCAGAGGATGCAGCAACAAGG + Intergenic
1192053787 X:67751173-67751195 TGACAGAGGTGGCATCAGCAGGG + Intergenic
1192381881 X:70625815-70625837 AAGCAGAGGTTGCTTCAGCCTGG - Intronic
1192575678 X:72241393-72241415 CTCCAGAGGATGCAGCAACAAGG + Intronic
1194752270 X:97698211-97698233 CTCCAGAGGTTGCAGAAACATGG - Intergenic
1194752324 X:97698765-97698787 CTCCAGAGGATGCAGCAACATGG + Intergenic
1195320158 X:103715185-103715207 CACCAAAGGATGCTTCATCAGGG - Intronic
1198194315 X:134344684-134344706 CTCCAGAGGATGCAACAACAAGG + Intergenic