ID: 1121022806

View in Genome Browser
Species Human (GRCh38)
Location 14:90591832-90591854
Sequence ACTTTTGCATAAGGGAGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 203}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121022801_1121022806 4 Left 1121022801 14:90591805-90591827 CCATCAGAGTTCTCAGCCAGGAA 0: 1
1: 1
2: 0
3: 21
4: 254
Right 1121022806 14:90591832-90591854 ACTTTTGCATAAGGGAGCTGTGG 0: 1
1: 0
2: 1
3: 14
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121022806 Original CRISPR ACTTTTGCATAAGGGAGCTG TGG Intronic
904973178 1:34434997-34435019 ACTTCTGCAAAGGGTAGCTGAGG - Intergenic
907983231 1:59505496-59505518 ACTTTGGCAAAACTGAGCTGGGG + Intronic
909139184 1:71841958-71841980 ATTTTTGGATGAGGAAGCTGAGG + Intronic
911200673 1:95040310-95040332 ACATATGAGTAAGGGAGCTGTGG - Intronic
911273067 1:95827010-95827032 AGTTTTGCCTAAGGTAGCTCAGG - Intergenic
911420255 1:97632120-97632142 AGGTTTTCATAAGGAAGCTGTGG + Intronic
912100062 1:106193017-106193039 ACTTTTCCATAGGGCTGCTGTGG - Intergenic
914256355 1:145963162-145963184 AGGTCTACATAAGGGAGCTGAGG - Intronic
915606814 1:156957384-156957406 ACATCTGCAGAGGGGAGCTGGGG - Intronic
916578249 1:166086086-166086108 TTTTTTGCATAAAGGAGCTGAGG + Intronic
917259102 1:173148176-173148198 ACTTTTCCGTAAGGCTGCTGGGG + Intergenic
917520320 1:175742941-175742963 ACTGTTGCATAAGACAGGTGAGG - Intronic
919149766 1:193680893-193680915 TCTTATGGATGAGGGAGCTGAGG - Intergenic
920322099 1:205132151-205132173 CCTTTTGCCTAAGAGACCTGAGG - Intergenic
920794267 1:209123630-209123652 ACTTTCTCCTAAGGGAGCTCTGG - Intergenic
924668043 1:246094037-246094059 ACTTGGCCATAAGGGAGGTGGGG + Intronic
1063923742 10:10957082-10957104 ACTCTTGCACAAGGGAGCTCTGG + Intergenic
1064575104 10:16737072-16737094 AGTTTTGTATAAGTGACCTGTGG + Intronic
1064701261 10:18023924-18023946 ACTTTTCCATAAGGCAACTGTGG + Intronic
1069014215 10:63409906-63409928 CCTTTTGCATAAGGAGTCTGGGG + Intronic
1069251426 10:66271925-66271947 ACTTTTGACTAAGGGAGCAGAGG - Intronic
1070768567 10:79069802-79069824 ACTTTTGTAAATGGGAGGTGGGG + Intronic
1071937990 10:90551726-90551748 ACATTTGAATCAGTGAGCTGGGG + Intergenic
1072800403 10:98388771-98388793 ACATTTGCGTTTGGGAGCTGTGG - Intronic
1073244368 10:102079049-102079071 TCTTTTACATCTGGGAGCTGAGG + Intergenic
1073802952 10:107063774-107063796 ACTTTGGTATAAGAGAGCTAAGG - Intronic
1074653830 10:115558905-115558927 GCATCTGCAAAAGGGAGCTGGGG - Intronic
1075596030 10:123729749-123729771 TCATTTGCATAATGGAGCTGAGG + Intronic
1075893861 10:125978066-125978088 ACTTTTCCATAGGGCTGCTGTGG + Intronic
1076876024 10:133215898-133215920 CCGTTAGCAAAAGGGAGCTGCGG + Intronic
1079213147 11:18481732-18481754 CTGTTTGTATAAGGGAGCTGTGG + Exonic
1080317897 11:30970775-30970797 ACCTTTTCATCAGGGACCTGGGG + Intronic
1080703826 11:34669275-34669297 GCTTTTTCATGAGGAAGCTGAGG - Intergenic
1080772254 11:35352587-35352609 TCCTTTGCAGAAGGGAACTGGGG - Intronic
1082103434 11:48193617-48193639 ACTTCTGCACCAAGGAGCTGGGG - Intergenic
1083438849 11:62662711-62662733 GCATTTGCACAAGGAAGCTGTGG + Intronic
1084218117 11:67662567-67662589 ACTTTCACATAAGGAAACTGAGG + Exonic
1086262541 11:84957930-84957952 ACTTGTGCATAAGGAGACTGAGG + Intronic
1086892511 11:92274051-92274073 ATTTTTTAATAAGGAAGCTGAGG - Intergenic
1087374739 11:97326697-97326719 GCTTTTGCATAGGGCTGCTGTGG + Intergenic
1088320484 11:108550237-108550259 ACTTCTGTATAAGGAAGCTTGGG + Intronic
1088564489 11:111153768-111153790 CATTTTGCATAAGAAAGCTGAGG + Intergenic
1089165966 11:116476887-116476909 AGTTTTGCTAAAGGGAGATGTGG + Intergenic
1091579888 12:1778530-1778552 ACTTTTGCATATGTGAGTTCGGG - Intronic
1093979656 12:25462051-25462073 ATTTTTGCAGGAGGGAGATGAGG + Intronic
1094291089 12:28851156-28851178 TTTTTTGCATAAGGGAAGTGAGG - Intergenic
1095176149 12:39094708-39094730 ACTTTTGCATTAGTCAGTTGTGG + Intergenic
1095835876 12:46638180-46638202 ACTTTTCCATAGGGCTGCTGTGG - Intergenic
1099785111 12:87252350-87252372 GCATTTGCATCAGGAAGCTGAGG - Intergenic
1103072266 12:117954659-117954681 AGATTGGCAGAAGGGAGCTGAGG - Intronic
1103450735 12:121026898-121026920 TCTTTTGGGTGAGGGAGCTGTGG + Intronic
1103760015 12:123242295-123242317 ACGTTTGAAGAAGGGAACTGGGG + Intronic
1107589939 13:41892687-41892709 AGTTTTGTACAAGGGACCTGAGG - Intronic
1109288889 13:60448502-60448524 ACTTTTGCATCAAGGTTCTGGGG - Intronic
1109480654 13:62947474-62947496 GCTTTTGCTTAGAGGAGCTGTGG - Intergenic
1110788572 13:79561479-79561501 ACTTTTCCATAGGGCTGCTGTGG - Intergenic
1111277903 13:85975532-85975554 ACATTTGAATAAGGAAGCAGAGG - Intergenic
1112098326 13:96159287-96159309 ACTCTTGCCTGAGGGAGCAGTGG + Intronic
1115755040 14:36520842-36520864 ACTTTTGCATGGCTGAGCTGCGG - Intronic
1115834270 14:37380209-37380231 ATTTTTGAACAAGGGAGATGGGG + Intronic
1117616334 14:57537155-57537177 ACTTTTCCATACAGCAGCTGGGG + Intergenic
1119314307 14:73678943-73678965 ACTTCTGGGCAAGGGAGCTGGGG + Intronic
1119729093 14:76939864-76939886 ACTTTTCCTTCAGGGAGCTCAGG - Intergenic
1121022806 14:90591832-90591854 ACTTTTGCATAAGGGAGCTGTGG + Intronic
1127504427 15:59584163-59584185 ACTTTTTCATAAGGAACCTCAGG + Intergenic
1128586291 15:68853073-68853095 AGTTTTGCATGAGGGAGGAGTGG + Intronic
1133995121 16:10742187-10742209 ATTTTTGGATAAGGAAACTGAGG - Intergenic
1139232455 16:65297090-65297112 AGATTTGCAGAATGGAGCTGTGG - Intergenic
1141483295 16:84321433-84321455 CCTTTTCCAAAAGAGAGCTGTGG + Intronic
1142270929 16:89088881-89088903 GTGTTTGCATCAGGGAGCTGGGG + Intronic
1145357908 17:22180273-22180295 GCTTTTGCTTAGAGGAGCTGTGG + Intergenic
1146633801 17:34489424-34489446 ATTTTTACATAAGGAAACTGAGG - Intergenic
1147461154 17:40569707-40569729 ACTTTTCCATAAAGCTGCTGTGG - Intergenic
1148108306 17:45130980-45131002 GCTCTTGCATTAGAGAGCTGAGG - Intronic
1150973687 17:70059629-70059651 CCTTTTGCATATGGTACCTGGGG - Intronic
1151228023 17:72661144-72661166 GCTTTGGACTAAGGGAGCTGAGG - Intronic
1152749915 17:82057904-82057926 ACTTTTGCACACGCGTGCTGAGG + Exonic
1156112646 18:33745975-33745997 ACTTCTGCATTAGGGAGAGGTGG - Exonic
1156702511 18:39842138-39842160 CCTTTTGCAAAAAGGAGCGGGGG + Intergenic
1157001536 18:43532236-43532258 ACTTTTGCATAAAACAGATGAGG - Intergenic
1158245457 18:55427368-55427390 ACTATTTCTCAAGGGAGCTGAGG - Intronic
1158816368 18:61102240-61102262 ACTTTTGAATAAAGAAGCTTTGG + Intergenic
1160353290 18:78204028-78204050 CCTTTTGCATAACAGAGCAGGGG + Intergenic
1161637426 19:5397681-5397703 CCTTCTGGATAAGGAAGCTGAGG + Intergenic
1167530782 19:50014911-50014933 GCTTCTGCATAAGAGAGGTGAGG + Intronic
924984387 2:255787-255809 AATTTTGCATAAAGTATCTGTGG - Intronic
926386761 2:12342976-12342998 CCTTTTGCCTAAGTTAGCTGGGG - Intergenic
926987343 2:18639306-18639328 ACTCTTCCATAGGGCAGCTGTGG + Intergenic
930580347 2:53203677-53203699 ACTATTGCATAAGAGTTCTGAGG - Intergenic
930662904 2:54072862-54072884 ACTTTTAAAAAAGGTAGCTGGGG - Intronic
930792239 2:55345987-55346009 ACTTTTACAAAAGGGATCTATGG - Intronic
933043243 2:77497508-77497530 AGTGTGGCATAAGGGAGATGTGG - Intronic
933819450 2:86096746-86096768 ACTTTTGTAGAGGGGAGCAGTGG - Intronic
937244659 2:120484943-120484965 ACTTTTAGATGAGGGAACTGAGG + Intergenic
938789370 2:134663240-134663262 ATTTTTGCTTAAGGCAGCTCAGG + Intronic
941492068 2:166154770-166154792 TCTATTTCATAAGGGAGCTGAGG + Intergenic
943957532 2:194211636-194211658 AGTTTTGAAAAAGGGATCTGGGG - Intergenic
946567921 2:220987960-220987982 TTTTTTGCAGAAGGCAGCTGAGG + Intergenic
948408060 2:237737521-237737543 GCTTTTGCTTAGGGAAGCTGGGG + Intronic
948546252 2:238730793-238730815 CTTTTTGCAGAGGGGAGCTGAGG - Intergenic
948953128 2:241267920-241267942 TTTTTCACATAAGGGAGCTGTGG - Intronic
1170470245 20:16661444-16661466 ACTTTAGCATTAGGGGTCTGTGG + Intergenic
1171139616 20:22729544-22729566 ATTTTGGCATATGGGAGATGGGG - Intergenic
1174181993 20:48680731-48680753 ACTTTTGAATAGGGGAGATGGGG - Intronic
1174945388 20:54979826-54979848 CCGTGTGCATAAAGGAGCTGAGG + Intergenic
1179283354 21:39953795-39953817 GCTTTTGTATAAGGACGCTGGGG + Intergenic
1181380226 22:22496439-22496461 ACTTTTTCAAAAGTAAGCTGAGG - Intronic
1181938152 22:26453672-26453694 AGTATTGCATAAAGGAACTGTGG + Intronic
1183645208 22:39122122-39122144 ACTTTTACAAAATAGAGCTGCGG - Intronic
1184526750 22:45028525-45028547 ACTTTTGGATGAGGAAACTGAGG + Intergenic
949523214 3:4876257-4876279 ACTTTTTCATAAGAGTGTTGCGG + Intronic
950013264 3:9738762-9738784 ACTTTCTCACAAGTGAGCTGGGG + Intronic
952447134 3:33392139-33392161 ACTTATGGATAAGGGAGATCTGG - Intronic
955551599 3:60091037-60091059 GCTTCTGCATCAGTGAGCTGAGG - Intronic
957795651 3:85002965-85002987 ACTTTTTCATAATAGAGATGGGG + Intronic
959957307 3:112253050-112253072 ACTTTTTCGTAAGGATGCTGTGG - Intronic
961606805 3:128101715-128101737 ACCTTTCCGTAAGGGATCTGAGG + Intronic
962059249 3:131907788-131907810 CCTTTTACCTAAGGGAACTGAGG - Intronic
962399632 3:135047269-135047291 ACCTTTGCAGATGGCAGCTGGGG + Intronic
962575649 3:136752634-136752656 GCTTCTGGATAAGGGCGCTGTGG + Intergenic
962701690 3:138006960-138006982 ACATTTGCATAGGGAAACTGGGG + Intronic
962876682 3:139540509-139540531 ACATTTGCATAAAGCAGCAGTGG - Intergenic
963756099 3:149236109-149236131 ACTTTTCCATAGGGCTGCTGTGG - Intergenic
965086341 3:164103737-164103759 ACTTTTTCAGAAGGATGCTGAGG - Intergenic
965997056 3:174896714-174896736 ATTTTTGCTTAAGAGAGCTTTGG - Intronic
966332122 3:178826110-178826132 ACTTTGGAATAAGCGAGATGTGG - Intronic
966340956 3:178924365-178924387 ACTTTTCCATAGGGCTGCTGTGG - Intergenic
967353560 3:188542576-188542598 ACTTTTGTATATGTGAGATGTGG + Intronic
969188496 4:5498051-5498073 AGTTTTACATAAGAAAGCTGAGG + Intronic
971140072 4:23915426-23915448 ACTATTGAATAAGGGAGGTCAGG - Intergenic
971819287 4:31530670-31530692 GCTTTTCTATAAGGCAGCTGCGG + Intergenic
974199848 4:58623481-58623503 ACTTTTCCATAGGGCTGCTGTGG - Intergenic
974423725 4:61712504-61712526 TCTTGTGGATAAGGGATCTGAGG - Intronic
976742515 4:88370782-88370804 CCTTTTGCTTAAGTGAGCTTGGG + Intergenic
979179600 4:117708272-117708294 ACTCTTCCATAAGGCTGCTGTGG - Intergenic
980860156 4:138489794-138489816 GCTGTTGCATAGTGGAGCTGTGG - Intergenic
981176086 4:141685517-141685539 TTTTTTCCATGAGGGAGCTGAGG - Intronic
983068930 4:163246308-163246330 ACTTTGGCATAAAAGACCTGAGG + Intergenic
983709673 4:170698372-170698394 TCTATTGCATAAGGGACATGTGG - Intergenic
986476554 5:8139783-8139805 ACTGTGGCAGAAGAGAGCTGAGG - Intergenic
986808503 5:11331585-11331607 ACTTTTCCATAGGGAAGATGAGG - Intronic
988417768 5:30967912-30967934 ACTTTTTCATAAGGAATCTCAGG + Intergenic
989506364 5:42230875-42230897 ACTTTTCCATAAGGCAAATGTGG + Intergenic
989587198 5:43084153-43084175 ACTTTTTCATAAGGAATCTCAGG + Intronic
993858507 5:93104815-93104837 ACTTTATCCTAAGAGAGCTGGGG - Intergenic
994235179 5:97355206-97355228 ACTTTTCCATAGGGCTGCTGTGG + Intergenic
996425752 5:123312449-123312471 ACTTTTCCATAGGGCTGCTGTGG + Intergenic
998906128 5:146907261-146907283 ATTTTTGCACAAGCGAGCTGGGG + Intronic
999074486 5:148781367-148781389 ACTTTTCCATAAGGCTGCTGTGG - Intergenic
999371873 5:151060617-151060639 TCTTTTGTAGAAGGGAGATGTGG + Intronic
999729885 5:154468732-154468754 CCTTTTACAGAAGTGAGCTGTGG + Intergenic
1000112500 5:158122588-158122610 TCTTTTGGAGAAGGGAGCTCAGG - Intergenic
1000114055 5:158136412-158136434 GTTTTTGGGTAAGGGAGCTGAGG + Intergenic
1000749665 5:165078269-165078291 ACTTTTGCACCCTGGAGCTGAGG + Intergenic
1001122948 5:168995020-168995042 ATTTTTCCATAAGGAAACTGAGG + Intronic
1004095133 6:12546720-12546742 TCCTTTGCAAGAGGGAGCTGGGG + Intergenic
1004101810 6:12620261-12620283 TCTTGTACATAAGGGAGTTGGGG - Intergenic
1004158133 6:13189070-13189092 CCTTCTGCATAAGGTACCTGTGG + Intronic
1005390376 6:25326773-25326795 ACTTTTGTATATGGGAGCTGAGG + Intronic
1006574842 6:35037574-35037596 ACTTTAGATCAAGGGAGCTGGGG + Intronic
1006693669 6:35912342-35912364 ATTTTTGTTTAAGGGAGATGGGG - Intronic
1008973932 6:57402117-57402139 ACTTTTCCATAGGGCTGCTGTGG + Intronic
1009325753 6:62346051-62346073 ACTTTTCCATAGGGCTGCTGTGG - Intergenic
1009463745 6:63945555-63945577 ACTTTTGCATATGTGTGGTGAGG - Intronic
1010228799 6:73516700-73516722 ACTTTTACATATGGGAGGTCAGG + Exonic
1010287170 6:74092465-74092487 ACTTATGCATAAGTAAACTGGGG - Intergenic
1011805849 6:91071869-91071891 ATTTCTTCATACGGGAGCTGTGG + Intergenic
1011943920 6:92877322-92877344 ACTGTTGCATATGTTAGCTGTGG + Intergenic
1015103599 6:129509806-129509828 CCTTTTGCATAGGATAGCTGTGG + Intronic
1015151655 6:130045921-130045943 ACTTTTGCCTAAGCAAGCTTTGG + Intronic
1017536025 6:155348959-155348981 ACTTTTGCATAGGGCTGCTGTGG + Intergenic
1018078784 6:160240631-160240653 CCTTTTGCATAAGGATTCTGGGG + Intronic
1018281777 6:162193847-162193869 GCTGTTGCAGAAGGGAGCAGGGG + Intronic
1020671003 7:11112378-11112400 ACTTTTGCAGAAGGCCTCTGTGG - Intronic
1020731379 7:11885261-11885283 ACTTTTACATGAGGAAACTGAGG + Intergenic
1023250038 7:38249012-38249034 TATTTTGGATAATGGAGCTGAGG + Intergenic
1023251345 7:38265114-38265136 TATTTTGGATAATGGAGCTGAGG + Intergenic
1026420404 7:70230949-70230971 ACTTCTGCATCAGGAAGCAGGGG + Intronic
1031886408 7:127250500-127250522 GCTTTTGAATAAGGGATGTGGGG - Intronic
1033809061 7:144989262-144989284 ACTTTGGCATGAGTGAGATGGGG - Intergenic
1040087818 8:43364427-43364449 ACTTTTCCGTAGGGGGGCTGTGG - Intergenic
1040404587 8:47087374-47087396 ACTTTTCCATAGGGCTGCTGTGG + Intergenic
1041116758 8:54547404-54547426 ACTTTTCCATTGGAGAGCTGAGG - Intergenic
1042569188 8:70144118-70144140 ACATCTTCAAAAGGGAGCTGGGG + Intronic
1044795041 8:95888008-95888030 AATGTTGAACAAGGGAGCTGTGG - Intergenic
1047093452 8:121598288-121598310 ACTTTTGCCTAAGGGAGGGCAGG - Intergenic
1048225014 8:132576852-132576874 ACTTCTGCATCAGTGAGGTGGGG - Intronic
1048784223 8:138033529-138033551 ACTTTTACAAAAGGGACATGAGG - Intergenic
1049466643 8:142754031-142754053 TATTTTGCATAAGGGAACTGTGG + Intergenic
1049986049 9:952590-952612 ACTTATGCTTGAAGGAGCTGAGG + Intronic
1052074765 9:24127524-24127546 ACTTTAGAATAAGTTAGCTGAGG - Intergenic
1052626446 9:30982001-30982023 ACTTTTCCATAGGGATGCTGTGG - Intergenic
1055510223 9:76988851-76988873 ACTTTTGTATTAGGTTGCTGGGG - Intergenic
1058389103 9:104474014-104474036 CCTTATTGATAAGGGAGCTGAGG - Intergenic
1058973241 9:110102042-110102064 ATTTTCGGATAAGGAAGCTGAGG + Intronic
1058996203 9:110300966-110300988 ACTTTGGCATCATAGAGCTGGGG + Intergenic
1059139142 9:111835559-111835581 AATTTTGCATACTGGAGTTGAGG - Intergenic
1059743370 9:117177303-117177325 TTTTATGCATAAGGAAGCTGAGG + Intronic
1059957549 9:119534024-119534046 AGTTTTGCATAAGAAAACTGAGG + Intergenic
1060256419 9:122034937-122034959 CTTTTAGCAGAAGGGAGCTGGGG - Intronic
1189335420 X:40168225-40168247 CCTTTTGCATCAAGGAGCTCAGG + Intronic
1189381687 X:40506811-40506833 CCTCTTGCATAAGGAATCTGAGG + Intergenic
1190540564 X:51473700-51473722 ACTTCTGCAAAATGGCGCTGTGG + Intergenic
1192891874 X:75399113-75399135 ACTTTTTCATAGGGCTGCTGTGG - Intronic
1193440603 X:81535951-81535973 ACTTTTTCATAATGCAGCTGTGG + Intergenic
1193789153 X:85797479-85797501 ACTTTTCCATAAGGCTGCTGTGG + Intergenic
1194151274 X:90326956-90326978 ACCTTTCCATAAGGCTGCTGCGG - Intergenic
1194366364 X:93018946-93018968 ACCTTTTCATAGGGCAGCTGTGG - Intergenic
1194513736 X:94824771-94824793 ACTGTTGCCTCAGGGAGCAGAGG + Intergenic
1194801835 X:98283325-98283347 CTTTTTTCAGAAGGGAGCTGTGG + Intergenic
1194867549 X:99086804-99086826 ACTTTTCCATAGGGCTGCTGTGG - Intergenic
1195677757 X:107520279-107520301 ACTCTTCCCTAAGTGAGCTGAGG - Intergenic
1196152681 X:112392321-112392343 ACTTGTCCATAAGGCTGCTGTGG + Intergenic
1196974339 X:121142084-121142106 CGTTTTGCTTAAGGGACCTGGGG - Intergenic
1198145615 X:133853944-133853966 ATTTTTGGATAAGGAAACTGAGG - Intronic
1199560024 X:149151990-149152012 GCTTTTCCATAAGGCAGCTGTGG + Intergenic
1199713734 X:150491194-150491216 CCTTTTGCATGAGGAAACTGAGG + Intronic
1200674591 Y:6135208-6135230 ACCTTTTCATAGGGCAGCTGTGG - Intergenic
1201915302 Y:19175206-19175228 ATTTTTGAATAAGTGAGGTGTGG - Intergenic