ID: 1121023634

View in Genome Browser
Species Human (GRCh38)
Location 14:90598460-90598482
Sequence ATGGGGGTAAGGAGGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1955
Summary {0: 1, 1: 0, 2: 6, 3: 144, 4: 1804}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121023619_1121023634 16 Left 1121023619 14:90598421-90598443 CCAGGGTTTCCTTCTAGGCTCCT 0: 1
1: 0
2: 3
3: 68
4: 1034
Right 1121023634 14:90598460-90598482 ATGGGGGTAAGGAGGGGGGAAGG 0: 1
1: 0
2: 6
3: 144
4: 1804
1121023621_1121023634 -4 Left 1121023621 14:90598441-90598463 CCTCTCTCCATCACCATGCATGG 0: 1
1: 0
2: 0
3: 18
4: 248
Right 1121023634 14:90598460-90598482 ATGGGGGTAAGGAGGGGGGAAGG 0: 1
1: 0
2: 6
3: 144
4: 1804
1121023620_1121023634 7 Left 1121023620 14:90598430-90598452 CCTTCTAGGCTCCTCTCTCCATC 0: 1
1: 0
2: 6
3: 72
4: 517
Right 1121023634 14:90598460-90598482 ATGGGGGTAAGGAGGGGGGAAGG 0: 1
1: 0
2: 6
3: 144
4: 1804

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121023634 Original CRISPR ATGGGGGTAAGGAGGGGGGA AGG Intronic
900051717 1:602214-602236 AGAGGGGGATGGAGGGGGGATGG - Intergenic
900129580 1:1081695-1081717 CTGGGGGCAAGGAGGTGGGACGG - Intergenic
900141629 1:1141356-1141378 ATGGGGGTAAGGATGGGGGCAGG - Intergenic
900141652 1:1141415-1141437 ATGGGGGTAAGGATGTGGGTGGG - Intergenic
900526845 1:3133556-3133578 ATCTTGGTAAGGAGGAGGGAAGG - Intronic
900681808 1:3920548-3920570 AGGGAGGGAGGGAGGGGGGAAGG - Intergenic
900829197 1:4952213-4952235 TGGGGGGTAGGGATGGGGGATGG + Intergenic
900932894 1:5747829-5747851 ATGGAGGGAGGGAGGAGGGAGGG + Intergenic
900993181 1:6107163-6107185 ATGGAGGGAAGGTGGAGGGATGG + Intronic
901011002 1:6202012-6202034 ATGGGAGTGAGGATGGAGGATGG - Intronic
901262152 1:7880411-7880433 AGTGGGGTGGGGAGGGGGGAGGG + Intergenic
901518304 1:9764234-9764256 ATGGGGGTGAGGTGGTGGGGTGG - Intronic
901740317 1:11338017-11338039 AAGAGGGGGAGGAGGGGGGAAGG - Intergenic
902190290 1:14758150-14758172 ATGGAGGGAGGGAGGGAGGAAGG - Intronic
902252520 1:15163826-15163848 TTGGGGGGGGGGAGGGGGGAGGG + Intronic
902461067 1:16577281-16577303 ATGGGGGCAGGCAGGGGGGCAGG - Intronic
902497466 1:16883702-16883724 TTGGGGGGTGGGAGGGGGGAAGG + Intronic
902551702 1:17223363-17223385 GTGGGGGAAAGGTGGAGGGATGG - Intronic
902712523 1:18250054-18250076 AAGGGGGGAGGGAGGAGGGAGGG - Intronic
902951950 1:19891596-19891618 TTGGAGGTGAGGAGGGGAGAGGG + Intronic
902976452 1:20092154-20092176 ATGGGGGTCAGGTGGGAGGCAGG + Intergenic
903139866 1:21332840-21332862 ATGGGGGTGGGGTGGGCGGATGG + Intronic
903331712 1:22600058-22600080 AAGGGGGGATGGAGGGAGGAAGG + Intronic
903423321 1:23234464-23234486 AGGGAGGAAAGGAGGGGGCAAGG - Intergenic
903604185 1:24562914-24562936 AAGGGCATAAGGAGGGGGAAGGG - Intronic
903639610 1:24849315-24849337 AAGGAGGGAGGGAGGGGGGAGGG - Intergenic
903834976 1:26197890-26197912 GTGGGGGTAATGAGGAGGGAAGG + Intronic
903884805 1:26534997-26535019 ATGAGGGTTTGGAGTGGGGAAGG + Intronic
904009509 1:27381856-27381878 ATGGGAGTCAGGGGGTGGGAAGG - Intronic
904203474 1:28836921-28836943 ATGGGGGCAGGGTGGGGGAACGG + Intronic
904308189 1:29604180-29604202 AAGGGGGAAAGAAGGGTGGAAGG - Intergenic
904322742 1:29707612-29707634 AGGGGAGGAGGGAGGGGGGACGG + Intergenic
904603351 1:31685573-31685595 GCGGGGCTAAGGAGAGGGGAGGG - Intronic
904803756 1:33116824-33116846 ATGGGGGAAAGTAGGAGGTATGG + Intronic
904898338 1:33835506-33835528 GTGGGGGTAGGGGGGAGGGATGG + Intronic
905171611 1:36113129-36113151 ACGGGGGTAAGGAGAGGGCCAGG + Intronic
905199316 1:36305854-36305876 ATGGGGGTAGAGAGTGGGTACGG + Intergenic
905247533 1:36625475-36625497 GTAGGGGTAAGGATGGGGGTAGG - Intergenic
905753411 1:40486393-40486415 AGGGAGGAAAGGAGGGAGGAAGG - Intronic
905869570 1:41395353-41395375 CTGGGAGTGAGGAGCGGGGAGGG - Intergenic
905891961 1:41523375-41523397 ATGGGGGAAAGGCAGTGGGAGGG + Intronic
905913311 1:41668620-41668642 ATGGGGGATAGGAGGAGGAAGGG - Intronic
906185215 1:43857518-43857540 AGGGAGGGAAGGAGGAGGGAAGG - Intronic
906534231 1:46543003-46543025 GTGGGGGTGGGGAGGGGGGCAGG - Intergenic
906545308 1:46616071-46616093 ATGGGGGCTAGGACGGGGAACGG - Intronic
906567395 1:46810944-46810966 GTGGGGGTGAGGAGAGAGGATGG + Exonic
906591012 1:47023999-47024021 ATGGGAGGGAGGAGGGAGGAAGG + Intronic
906664664 1:47611858-47611880 ATGGGGGAAAGAATGTGGGATGG + Intergenic
906843562 1:49165684-49165706 ATGGAGGAAAGGAGGGAGGATGG + Intronic
906911679 1:49958693-49958715 GTGGGGTTGGGGAGGGGGGAGGG + Intronic
907308204 1:53525282-53525304 ATGGGGAGGAGGAGAGGGGAAGG + Intronic
907435443 1:54443096-54443118 TGGGGTGTAGGGAGGGGGGAGGG - Intergenic
907474910 1:54699256-54699278 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
907663450 1:56414496-56414518 ATGGGGCAGTGGAGGGGGGATGG - Intergenic
907673662 1:56499075-56499097 AAGGGGGGAAGGTGGGGGGGGGG - Intronic
907853683 1:58280795-58280817 ATGGGGGCAGGGAGTGGGGGTGG + Intronic
908000383 1:59673214-59673236 AAGGGGGTAAGGAGTGTTGAGGG + Intronic
908596038 1:65689870-65689892 ATAGAGGGAAGGAGGGGAGAAGG - Intergenic
908799421 1:67864170-67864192 ATGGGGGTTGGGAGGGGCGGTGG + Intergenic
909445217 1:75742145-75742167 CTGGGGGTGGGGAGGGGGGAAGG - Intronic
909488533 1:76200852-76200874 GTGGTGGTAAGGAGGCAGGATGG + Intronic
909760458 1:79279770-79279792 ATGGGGTGGAGGAGGAGGGAAGG + Intergenic
909786341 1:79618631-79618653 GTGGGGGTGAGGATGGGAGATGG + Intergenic
909843667 1:80362518-80362540 ATGGGGGGAAGGTGGGAAGAGGG - Intergenic
910004061 1:82373535-82373557 AGGGAGGGAGGGAGGGGGGAAGG - Intergenic
910097362 1:83538838-83538860 CCAGGGGTAAGGAGGGAGGAAGG + Intergenic
910263689 1:85315912-85315934 ATGAGGGTTTGGAGGGGGAAGGG + Intergenic
910292314 1:85611505-85611527 ATCAGAGTGAGGAGGGGGGAAGG + Intergenic
910342255 1:86201324-86201346 ATTGGGGAAAGCAGGGGTGAGGG + Intergenic
910363246 1:86436356-86436378 AGGGAGGTAGGGAGGGAGGAAGG - Intronic
910846797 1:91611922-91611944 ATGGGGGCAAGGAGGGAGGAGGG + Intergenic
910897932 1:92087307-92087329 ATGGGGGGAAGGAGGGTGGGAGG + Intronic
910937344 1:92495241-92495263 AGGGAGGAAAGGAGGGAGGAAGG - Intergenic
911160039 1:94674909-94674931 AGGGGGATAGGTAGGGGGGATGG + Intergenic
911665115 1:100543070-100543092 GTGGGGCTGAGGAAGGGGGAAGG + Intergenic
911744503 1:101425622-101425644 GTGGGGTGGAGGAGGGGGGAGGG - Intergenic
911876726 1:103174725-103174747 ATGATGGGGAGGAGGGGGGAGGG + Intergenic
911881960 1:103251233-103251255 TTGGGTGGAGGGAGGGGGGAGGG + Intergenic
911995212 1:104758069-104758091 AGGGGGATGGGGAGGGGGGATGG + Intergenic
912014471 1:105015990-105016012 ATGGTGGTAAAGTGTGGGGAAGG + Intergenic
912065552 1:105736472-105736494 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
912160983 1:106984971-106984993 ATGAGGGTGAGGAGAGAGGAGGG - Intergenic
912269360 1:108193327-108193349 AAGGGGGGAGGGAGGGAGGAGGG - Intronic
912355116 1:109048482-109048504 AGGGAGGGACGGAGGGGGGAAGG + Intergenic
912563925 1:110571610-110571632 ATGGGGGTCGGGAGGGGAGAGGG + Intergenic
912663873 1:111561505-111561527 ATTGGGGGAAGGAGGGAGGAAGG + Intronic
912758059 1:112341284-112341306 GTGGGTGGGAGGAGGGGGGAGGG + Intergenic
912813416 1:112810667-112810689 AAGGGGGAATGGAGGGCGGAAGG - Intergenic
912944655 1:114074916-114074938 TTGGGGGTAGGTAGTGGGGAGGG + Intergenic
913250653 1:116909994-116910016 AGGGAGGGAAGGAGGCGGGAGGG + Intergenic
913305423 1:117425162-117425184 AAGGGGGGAGGGAAGGGGGAAGG + Intronic
913556453 1:119971972-119971994 ATGAGGGAAATGAGGGAGGAAGG + Intronic
913640455 1:120807723-120807745 ATGGGGGCAGGCAGGGGGGCAGG + Intronic
913641228 1:120814007-120814029 ATGGGGGCAGGCAGGGGGGCAGG + Intronic
914084187 1:144437909-144437931 ATGGGGGCAGGCAGGGGGGCAGG - Intronic
914212060 1:145588901-145588923 ATGGGGGCAGGCAGGGGGGCAGG - Intergenic
914362266 1:146945083-146945105 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
914364784 1:146968564-146968586 ATGGGGGCAGGCAGGGGGGCAGG + Intronic
914393192 1:147240492-147240514 ATGGGTGTCAGGCTGGGGGACGG - Intronic
914486895 1:148118584-148118606 ATGGGGGCAGGCAGGGGGGCAGG - Intronic
914538302 1:148587265-148587287 ATGGGGGCAGGCAGGGGGGCAGG - Intronic
914587228 1:149073732-149073754 ATGGGGGCAGGCAGGGGGGCAGG - Intronic
914959587 1:152194651-152194673 GGAGGGGTGAGGAGGGGGGATGG - Intergenic
915013589 1:152712785-152712807 ATGGAGGTAAGGAGGGAGACAGG + Intergenic
915052347 1:153088827-153088849 ATGGGTGTCAGGCTGGGGGACGG + Intergenic
915073538 1:153291717-153291739 ACTGGGGTGAGGATGGGGGAAGG - Intergenic
915360463 1:155283547-155283569 ATGGGTGGGGGGAGGGGGGAGGG - Intronic
915446745 1:155978481-155978503 GTTGGGGGAAGGCGGGGGGAGGG + Exonic
915707495 1:157860617-157860639 ATGGGGTGGGGGAGGGGGGAGGG - Intronic
915755013 1:158250947-158250969 ATGGGGGTTAGGAGTGATGACGG + Intergenic
915819975 1:159012710-159012732 ATAGGGGTAATTAGGCGGGAAGG + Intronic
915878805 1:159643431-159643453 AAGGGGGAGGGGAGGGGGGAGGG + Intergenic
915895014 1:159805139-159805161 ATGGGGGTTAGGGGTGGAGATGG + Intronic
916236379 1:162592871-162592893 TTGGGGGTCTGGAGGGAGGATGG + Intronic
916686137 1:167148677-167148699 AGGGGGCTAGGGATGGGGGATGG + Intergenic
916700498 1:167288767-167288789 ATCTTGGTAAGGAGGGGGCAAGG - Intronic
916779436 1:168008888-168008910 AGGGAGGGAGGGAGGGGGGAGGG - Intronic
916841668 1:168607846-168607868 ATGGGGGTAGGGAGAGGAGCAGG + Intergenic
916961896 1:169896939-169896961 AAGGGGGTGAGGAGTGGGAATGG - Intergenic
917505994 1:175627685-175627707 GGGTGGGTAAGGATGGGGGATGG - Intronic
917512776 1:175681892-175681914 ATGGGGGTCTGAAGGGAGGAAGG + Intronic
917607364 1:176646540-176646562 GTGGGGGTCAGGTGGGGGGATGG - Intronic
917745500 1:178002938-178002960 ATAGGGGTAAGGAGGAGGAAAGG - Intergenic
917749493 1:178041215-178041237 ATGGGGGAATGGAGGGTGGAAGG - Intergenic
917797570 1:178542880-178542902 ATGGGGGTAAGGACGGGTGGCGG + Intronic
917904118 1:179572775-179572797 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
918122230 1:181550038-181550060 TTGGGGGTAATTAGGGAGGAAGG + Intronic
918282420 1:183020409-183020431 AAGGAGGGATGGAGGGGGGAGGG - Intergenic
918416775 1:184317459-184317481 AAGGGAGAAAGGAGAGGGGAGGG + Intergenic
918543268 1:185654444-185654466 ATAGGGGTAAGAAGGGAGGAAGG - Intergenic
918617087 1:186557465-186557487 AGGGAGGGAAGGAGAGGGGAAGG - Intergenic
918620755 1:186602069-186602091 GTGGGGGGAGGGCGGGGGGACGG - Intergenic
919102562 1:193112465-193112487 ATGGGGCTGAGGTGGGAGGATGG - Intergenic
919131325 1:193454578-193454600 ATGGGGGTAAGAGGAGAGGAGGG + Intergenic
919321013 1:196038339-196038361 GTGGGGGGAGGGAGGAGGGATGG - Intergenic
919641371 1:200048146-200048168 TTGGGGGTGGGGTGGGGGGAAGG - Intronic
919888794 1:201955157-201955179 AAGGGGGAAGGGAAGGGGGAAGG + Intergenic
919935230 1:202246361-202246383 ATGGATGGAGGGAGGGGGGATGG - Intronic
920037221 1:203074090-203074112 ATGGAGGTAGGGAGAAGGGAAGG + Intronic
920133753 1:203753260-203753282 ATGGAGGTGAGGAGGGTGGAGGG - Intergenic
920353898 1:205356392-205356414 ATGGGGGTCAGGAGGGACAAGGG - Intronic
920400140 1:205671048-205671070 ATTGGGGGAAGGGGAGGGGAAGG + Intronic
920706294 1:208252977-208252999 ATGGGGGTGGGGAGAGGGGAGGG - Intergenic
920708050 1:208269180-208269202 AAGGGGGTGAGGAGGGAGAAGGG + Intergenic
921019418 1:211222681-211222703 ATGGGTGTCGGGATGGGGGACGG + Intergenic
921329353 1:214020002-214020024 AAGGTGGTCAGGAGTGGGGAAGG - Intronic
921390945 1:214612915-214612937 ATGGGGGGCAGGAAGGGGAAGGG + Intronic
921490464 1:215769661-215769683 ATGGGGGTAGGGCTGGTGGAAGG + Intronic
921642960 1:217578078-217578100 ATGGGGGTGGGGCGGGGGGCGGG + Intronic
921885071 1:220297229-220297251 AAGGGAGTGAGGAGGAGGGAAGG - Intergenic
922032377 1:221813588-221813610 ATGGGGGTGAGGGTGGGGGTGGG + Intergenic
922501679 1:226101585-226101607 ACTGGGGTAAGGGGGAGGGATGG - Intergenic
922598824 1:226834497-226834519 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
922605397 1:226887019-226887041 ATGGTGGGAAGCAGGGTGGAGGG + Intronic
922946790 1:229523247-229523269 CTGGAGGAAAGGAGGGAGGATGG - Intronic
923332957 1:232942566-232942588 AAGGAGGGAAGGAGGGAGGAAGG + Intergenic
923482338 1:234397216-234397238 AGGAGGGGGAGGAGGGGGGAAGG + Intronic
923529594 1:234803128-234803150 AAGGGGAGGAGGAGGGGGGAAGG - Intergenic
923747009 1:236710880-236710902 TGGGGGGTAGGGAAGGGGGATGG - Intronic
924118863 1:240776371-240776393 GTGGAGGGAGGGAGGGGGGAAGG - Intronic
924129818 1:240895429-240895451 ATGGGGTGGAGGAGGGGGGAGGG - Intronic
924275422 1:242381396-242381418 TTGGGGGTGAGGGAGGGGGAAGG + Intronic
924424095 1:243934189-243934211 ATGGAGGGAAGGGGAGGGGAGGG - Intergenic
924710433 1:246526618-246526640 ATGGGGCAAAGGAGGGAGCATGG + Intergenic
924728711 1:246692735-246692757 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
924795149 1:247287561-247287583 AGGGGTGTAAGGTGGCGGGATGG - Intergenic
924946297 1:248849149-248849171 ATGTGGGTATGGAGGTGGGTGGG + Exonic
1062773400 10:123639-123661 ATGGAGGGAAGGAAGGAGGAAGG + Intergenic
1063207569 10:3849110-3849132 AAGGGGGAGGGGAGGGGGGAAGG - Intergenic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1063668308 10:8079711-8079733 GTGGGGGTAGGGAAGGGCGAGGG - Intergenic
1063800272 10:9569036-9569058 ATGGGGGAAAGAAAGAGGGAAGG - Intergenic
1064102154 10:12473088-12473110 ATGTGGGGCAGGAGGGGAGAGGG + Intronic
1064114766 10:12568330-12568352 GAGGGGGAGAGGAGGGGGGAGGG - Intronic
1064121424 10:12623080-12623102 ATGGAGGAAGGGAGGGAGGAAGG - Intronic
1064142161 10:12799451-12799473 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1064149335 10:12849635-12849657 ATGGTGGTGAGCAAGGGGGAGGG + Intergenic
1064149382 10:12849947-12849969 ATGGGGGGAAGGAGGGAGGGAGG - Intergenic
1064526341 10:16260474-16260496 AGGGAGGAAAGGAAGGGGGAAGG + Intergenic
1064541975 10:16414559-16414581 ATGAGGGTGAGGAGGTGGGTGGG + Intergenic
1064563180 10:16612883-16612905 AGGGGGAAGAGGAGGGGGGAAGG - Intronic
1064603998 10:17019372-17019394 ATGGGGAAAAGGAAGGGGTAGGG - Intronic
1065117698 10:22498346-22498368 ATGGGGGTTGAGAGGGGTGAAGG + Intergenic
1065308395 10:24390447-24390469 ATGGGGGAAAAAAGGAGGGAGGG + Intronic
1065494976 10:26318535-26318557 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1065689134 10:28315339-28315361 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1065874186 10:29982977-29982999 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1065930621 10:30475713-30475735 AAGGAGGGAAGGAGGGAGGAAGG + Intergenic
1065966988 10:30778731-30778753 AGAAGGATAAGGAGGGGGGAAGG + Intergenic
1066334525 10:34462900-34462922 AAGGGGGAGAGGAGGGGAGAGGG + Intronic
1066671462 10:37844936-37844958 AAGGGGGGAGGGAAGGGGGAGGG - Intronic
1066761923 10:38763083-38763105 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1067481034 10:46597796-46597818 CGGGGGGTAGGGAGGGCGGAAGG - Intergenic
1067613717 10:47744026-47744048 CGGGGGGTAGGGAGGGCGGAAGG + Intergenic
1067765864 10:49085744-49085766 GTGGGGGAAAGGGGGAGGGATGG + Intronic
1068051614 10:51957182-51957204 AGGGAGGAAAGGAGGGAGGAAGG - Intronic
1068723148 10:60269638-60269660 TTGGGGGGGGGGAGGGGGGATGG - Intronic
1068906178 10:62325536-62325558 ATGGGAGTATGGAGGGTGGGAGG + Intergenic
1068945988 10:62729278-62729300 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1068969171 10:62945277-62945299 GTGGGGGAGAGGAGGAGGGAAGG - Intergenic
1068983040 10:63081432-63081454 AGGGAGGGAGGGAGGGGGGAGGG + Intergenic
1069278976 10:66629642-66629664 ATGGGGGTATGATGTGGGGATGG - Intronic
1069311544 10:67044087-67044109 TTGGGGGGAAAGAGGGAGGAGGG - Intronic
1069853754 10:71427306-71427328 CTGGGGGTAACGGGGAGGGAGGG - Intronic
1070219199 10:74422907-74422929 CTGGGAGTTAGGAGTGGGGAGGG + Intronic
1070356589 10:75646041-75646063 ATGGGGGTGAGGATGGAGGTGGG - Intronic
1070597904 10:77845589-77845611 ATGGAGGGAAGGAGGGAAGAAGG + Intronic
1070642413 10:78179318-78179340 CTGGGGAGAAGGAGGGGAGAAGG + Intergenic
1070657042 10:78278774-78278796 AGGGAGGTAAGGAGGGAGGAAGG - Intergenic
1070712944 10:78696693-78696715 AAGGGGGTGGGGTGGGGGGAGGG + Intergenic
1071187087 10:83058393-83058415 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1071204195 10:83255014-83255036 GTGGGGGAGGGGAGGGGGGAGGG - Intergenic
1071374665 10:84990454-84990476 TTGGGGGGGAGGAGGGGGAAAGG + Intergenic
1071629128 10:87203998-87204020 CGGGGGGTAGGGAGGGCGGAAGG + Intergenic
1071971919 10:90916115-90916137 ATGGGGGACAGGGAGGGGGAGGG + Intronic
1072474819 10:95750209-95750231 CTGTGGGAAAGGAGCGGGGATGG + Intronic
1072537572 10:96375018-96375040 ATGGAGGTTGGGAGGGGGAAGGG + Intronic
1072662803 10:97373011-97373033 AGGGAGGGAAGGAGGGAGGAGGG - Intronic
1072899288 10:99393223-99393245 ATGGGTGTGGGGAGGTGGGAGGG - Exonic
1072987025 10:100149816-100149838 AGAGGGGCAAGGAGGGAGGATGG - Intergenic
1073062600 10:100741482-100741504 ATGGGGAGGAGGAGGGGGAAAGG + Intronic
1073153951 10:101331674-101331696 TTGGGGTGAGGGAGGGGGGAAGG + Intergenic
1073224096 10:101901738-101901760 ATGGGAGAAAGCAGGGGGGCTGG + Intronic
1073387828 10:103142139-103142161 CAGGGGGCAAGGATGGGGGAAGG + Intronic
1073852385 10:107635818-107635840 ACGGGGGGAAGGAGGGAGCAAGG + Intergenic
1073977948 10:109121678-109121700 ATGGAGGAAGGGAGGGAGGAAGG - Intergenic
1074033378 10:109712031-109712053 ACGGGGGAAAGGAGGGGTGGGGG - Intergenic
1074100799 10:110353721-110353743 TTGGGGGTGAGGTTGGGGGAGGG - Intergenic
1074284876 10:112088720-112088742 ATGGGGGTATGGAATGGGTAGGG - Intergenic
1074407380 10:113191053-113191075 ATGGAGATAAGGAAGGGCGAAGG + Intergenic
1074502614 10:114040578-114040600 GTGGGGTGAAGGTGGGGGGATGG + Intergenic
1074580847 10:114717926-114717948 AGGGGGGGAAGGGGAGGGGAGGG + Intergenic
1074815658 10:117139652-117139674 ATGGGGCGGAGGCGGGGGGAGGG + Intergenic
1074867013 10:117550652-117550674 ATGGGGGGAAAGAGGGGAGGTGG - Intergenic
1074883384 10:117675931-117675953 CTGGGGGTAGGGAGGAGAGAAGG - Intergenic
1074919476 10:117992981-117993003 GTGAGGGGAAGGAGCGGGGAGGG + Intergenic
1075026458 10:118987844-118987866 AGGGAGGGAAGGAGGGGGGAAGG + Intergenic
1075122654 10:119675775-119675797 AAGGGGGGAAGGGAGGGGGAGGG - Intronic
1075268316 10:121025549-121025571 GTGGGTGTAAGGAGGGGAGCAGG + Intergenic
1075400477 10:122158006-122158028 AAGGAGGGAAGGAGGGAGGAAGG - Intronic
1075805791 10:125187926-125187948 GTGGGGCTAAAGAGGGAGGAGGG - Intergenic
1075906473 10:126085994-126086016 ATGGGGGTAAGTGTGTGGGAGGG + Intronic
1076047999 10:127310258-127310280 GTGGGGGTAAGGGGGTGGGGTGG - Intronic
1076224742 10:128764990-128765012 CTGGGGGTAAGGGCTGGGGAGGG + Intergenic
1076354687 10:129843096-129843118 ATGGGGGGGAGGATGGGCGAGGG + Intronic
1076494912 10:130890753-130890775 AAGTGGGAAAGGAGGGGGAAGGG + Intergenic
1076555277 10:131317517-131317539 ATAGGGGCATGGAGGGTGGAGGG - Intergenic
1076736055 10:132459462-132459484 ATGGGGGTCAGGAGGCTGGGTGG + Intergenic
1076779471 10:132716221-132716243 ATGGGGTTCAGGATGGAGGACGG - Intronic
1076827295 10:132975454-132975476 CTGAGGATAAGGAGGGGGTAAGG - Intergenic
1076996355 11:299230-299252 GTGGGGGGAAGGGGGAGGGATGG - Intronic
1077061008 11:617881-617903 ACGGGGGACAGGAGAGGGGAGGG - Intronic
1077070304 11:667354-667376 ATGGAGGGAGGGAGGGAGGAAGG + Intronic
1077321059 11:1942134-1942156 AAGGTGGGAGGGAGGGGGGAGGG + Intergenic
1077391420 11:2302249-2302271 GTGGGGGTGAGCAGGGGTGAGGG + Intronic
1077455163 11:2673977-2673999 TTGGGGGTGGGGTGGGGGGAGGG + Intronic
1077518300 11:3015721-3015743 AGAGGGGTAGGGAGTGGGGAGGG + Intronic
1077595341 11:3527046-3527068 CTGGGGGAAAGGGGAGGGGATGG - Intergenic
1077717498 11:4596267-4596289 GTGGGGGGAAGGGGGAGGGATGG + Intergenic
1077806591 11:5596547-5596569 ATGGGGGAGGGGAAGGGGGAAGG - Intronic
1077891893 11:6424594-6424616 ATGGGGGTATGGGAGGGGCAGGG + Intergenic
1078004032 11:7518967-7518989 AGGGGCGTAAGGTGGCGGGATGG + Intronic
1078104575 11:8350647-8350669 GTGGGGGTCAGGAAGGGGAAAGG + Intergenic
1078309520 11:10226471-10226493 GTGGGGTTGGGGAGGGGGGAGGG - Intronic
1078362522 11:10680307-10680329 AGGGAGGGAGGGAGGGGGGAAGG + Intronic
1078387970 11:10909545-10909567 TTGGGGGTACTGGGGGGGGATGG + Intergenic
1078394645 11:10969915-10969937 ATGGGGGTGGGGAGTGGTGAGGG + Intergenic
1078396451 11:10986130-10986152 ACGGGGCTGAGGAGGGGTGATGG - Intergenic
1078807953 11:14725504-14725526 AAGGGGAGAAGGAGGGGGAAGGG - Intronic
1078859430 11:15233718-15233740 AAGGAGGGAAGGAGGGAGGAAGG - Intronic
1078941700 11:16013638-16013660 ATGGGAGTAAAGAGGGAGGGAGG - Intronic
1079097471 11:17520230-17520252 ATGGAGGTGAGGATGTGGGACGG + Intronic
1079116600 11:17644063-17644085 CTGGGGGCAAGGGAGGGGGAGGG + Intronic
1079135394 11:17773551-17773573 CTGGGGGCCGGGAGGGGGGAGGG + Intronic
1079357475 11:19742139-19742161 AAGGGGCTCAGGAGGGGTGAAGG - Intronic
1079562445 11:21839141-21839163 GTGGGGGGGGGGAGGGGGGAGGG + Intergenic
1079986803 11:27208359-27208381 ATGGGAGCAAGGAGGAGGGACGG + Intergenic
1080383354 11:31796467-31796489 CTGGGGGGATGGAGGGTGGATGG + Intronic
1081171452 11:39874598-39874620 ATGGCGGGAAGGAGGCAGGAGGG - Intergenic
1081688706 11:45060419-45060441 ATGGTGGAAAGGAGGAAGGAAGG + Intergenic
1081813002 11:45923576-45923598 AGGAGGGTCAGGAGTGGGGAAGG + Intronic
1082132409 11:48506470-48506492 AAGGGGGAAGGGAAGGGGGAAGG - Intergenic
1082132415 11:48506482-48506504 AAGGGGGAAGGGAAGGGGGAAGG - Intergenic
1082132432 11:48506517-48506539 AAGGGGGAAGGGAAGGGGGAAGG - Intergenic
1083039076 11:59668904-59668926 AGGGGGGCAGGGAGCGGGGAGGG + Exonic
1083272399 11:61579068-61579090 ATGGGAGGAAAGAGGAGGGAGGG + Intronic
1083638375 11:64132428-64132450 CTGGGGGTGGGGCGGGGGGAGGG + Intronic
1083685238 11:64371465-64371487 GTGGGGATTAGGAGGGGGGCAGG - Exonic
1083805919 11:65073886-65073908 ATGGGTGTGAGGAGGGATGAAGG - Intronic
1083913042 11:65721012-65721034 GGAGGGGGAAGGAGGGGGGAGGG - Intergenic
1083967039 11:66049287-66049309 AGAGGGGAAAGGAAGGGGGACGG + Intergenic
1084177199 11:67429046-67429068 AGGGGGGAATGGAGTGGGGAAGG + Intronic
1084188679 11:67489000-67489022 GTGGGGGTGAGGAGGGGGTTAGG + Intronic
1084194770 11:67518219-67518241 ATGGAGTTAGGGAGGGAGGAAGG + Intergenic
1084232154 11:67760945-67760967 AAGGAGGAAAGGAGGGTGGAAGG - Intergenic
1084421849 11:69064279-69064301 CGGGGGATAGGGAGGGGGGAGGG - Intronic
1084678291 11:70649635-70649657 ATGGGAGGGAGGAGGGGGGCAGG + Intronic
1084812943 11:71626424-71626446 ACGGGGGTCAGGCTGGGGGACGG - Intergenic
1084821603 11:71695013-71695035 CTGGGGGAAAGGGGAGGGGATGG + Intergenic
1084870749 11:72097214-72097236 ATGAGAGTAAGATGGGGGGAAGG - Intronic
1084889223 11:72228559-72228581 GTGGGGTTGAGAAGGGGGGATGG - Intronic
1085299685 11:75450789-75450811 CTGGGGGTGTGGAGGGGGGTGGG - Intronic
1085439950 11:76551244-76551266 AAAGGGGTAAGGGGGTGGGAGGG + Exonic
1085658604 11:78340961-78340983 ATGGTAGTAGGGAGGTGGGAGGG - Intronic
1085775769 11:79365312-79365334 ATGGGCCTAAGGAGGAGGAAGGG - Intronic
1085858285 11:80201154-80201176 ATGTGTGTGAGGATGGGGGAGGG - Intergenic
1086306423 11:85485562-85485584 ATGTGAGTAAGGAGAGGGAAGGG + Intronic
1086307157 11:85493773-85493795 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1086307165 11:85493797-85493819 AAGGAGGGAAGGAGGGAGGAAGG + Intronic
1086416003 11:86589333-86589355 ATGGGGGTAGGGTTGGGGGAGGG + Intronic
1086518675 11:87645872-87645894 AAGGGGGAAAGGAAGGGAGAAGG - Intergenic
1086518714 11:87645982-87646004 AAGGGGGAAGGGAAGGGGGAAGG - Intergenic
1086598168 11:88600175-88600197 ATGGGAGGAAGGAGATGGGAAGG - Intronic
1086917488 11:92547625-92547647 CTGGGGGTGAGAAGGGGAGAGGG - Intronic
1087034889 11:93745236-93745258 ATGGGTGTCAGGCTGGGGGACGG + Intronic
1087088401 11:94243135-94243157 AGGGGGGTGAGAAGTGGGGATGG + Intergenic
1087091852 11:94281703-94281725 CTGGGGGTGAGGAGGGGAGGTGG + Intergenic
1087251495 11:95905155-95905177 ATGAGGTTAAGGAGGTGAGATGG - Intronic
1087603042 11:100339915-100339937 CTGGGGGTAGGGAGGGTGGAGGG - Intronic
1087774324 11:102243569-102243591 AAGGGGGAAGGGAAGGGGGAAGG + Intergenic
1087786223 11:102357247-102357269 GAGGGAGTAAGGAGGGAGGAGGG - Intronic
1088063388 11:105685140-105685162 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1088356027 11:108944660-108944682 GTGGGGGGAAGGAGGGAGGATGG + Intergenic
1088652641 11:111971973-111971995 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1088692159 11:112337406-112337428 AAGAGGGAAAGGAGGGAGGAAGG - Intergenic
1089310870 11:117557407-117557429 ACGGTGGTCAGGAGGGGGGCTGG - Intronic
1089432524 11:118436176-118436198 CTCGGGAAAAGGAGGGGGGAAGG - Intergenic
1089479429 11:118792230-118792252 CTGGGGGTGAGGCGGGGGCAGGG + Intergenic
1089500746 11:118929917-118929939 ATGGGGGTGGGGTGGGGGAAGGG - Intronic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1090640670 11:128726529-128726551 GTGGGGGTAGGGGGGTGGGAGGG - Intronic
1090730860 11:129572606-129572628 AGGGGTGGAGGGAGGGGGGAGGG - Intergenic
1090733474 11:129591467-129591489 ATGGTGGGAAGGGGAGGGGATGG - Intergenic
1090915443 11:131158638-131158660 ATAGGGGTAAGGAGAGAGGGAGG - Intergenic
1091503252 12:1039849-1039871 ATGGGAGTAAGAAGTGGAGAGGG + Intronic
1091571527 12:1691121-1691143 AGGGGGGAACGGAGGAGGGAGGG - Exonic
1091770855 12:3150351-3150373 ATGGGGGGCAGGAATGGGGAGGG + Intronic
1091879986 12:3969247-3969269 ATGGGGGAAAGGTGGGTGGGAGG - Intergenic
1091976157 12:4827267-4827289 AAGGAGGGAAGGAGGAGGGAAGG - Intronic
1092092196 12:5812326-5812348 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1092121034 12:6044135-6044157 ATGGGGGCATGGAGGAGGGGAGG - Intronic
1092125782 12:6074133-6074155 ATGGGGAAAAGGAGGAGGGATGG - Intronic
1092179172 12:6433599-6433621 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1092282600 12:7109013-7109035 GGGGGGGTAGGGTGGGGGGAGGG + Intronic
1092421498 12:8335820-8335842 CTGGGGGAAAGGGGAGGGGATGG - Intergenic
1092429797 12:8399190-8399212 ATGGGGGTGGGGAGGGGTGGTGG - Intergenic
1092474345 12:8806196-8806218 AAGGAGGAAAGGAGGGTGGAAGG - Intergenic
1092495964 12:8995476-8995498 ATAAGGGTAAAGAGTGGGGAGGG - Intronic
1092987253 12:13857730-13857752 AGGGGGGAAAGGAGTGGGAATGG - Intronic
1093322131 12:17724737-17724759 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1093841860 12:23912831-23912853 ATGGGGGTGGGGAGGGGAAATGG + Intronic
1093940799 12:25051815-25051837 ATGGGGTAAAGGTAGGGGGAGGG - Intronic
1094008471 12:25781571-25781593 ATGTTGGGAAGGAGGGAGGAGGG - Intergenic
1094166669 12:27450287-27450309 GTGGGGGCAGGGAGGGAGGAGGG - Intergenic
1094218900 12:27972912-27972934 CTGGGGGGACGGGGGGGGGAGGG - Intergenic
1094272897 12:28636964-28636986 ATGGAGGGATGGAGGTGGGAGGG + Intergenic
1094372123 12:29750172-29750194 GTGAGGGCAAGGAGGGGGCAGGG - Intronic
1094809442 12:34123556-34123578 ACTGGGGTGGGGAGGGGGGAGGG - Intergenic
1095228523 12:39704926-39704948 GTGGGGGGAGGGAGGAGGGATGG + Intronic
1095585916 12:43848939-43848961 ATGGGAGTAAGAAAGGGGAAAGG + Intronic
1095672419 12:44876381-44876403 GGCGGGGTAAGGAGGAGGGAGGG + Intronic
1095702470 12:45204525-45204547 ATGGGGGTCAAGAGAGGGAAAGG - Intergenic
1096109667 12:49021282-49021304 ATGGGGGTGAGGGTGGGGGCAGG + Exonic
1096203909 12:49706351-49706373 AAGGGGGGGAGGAGGCGGGATGG + Intronic
1096530087 12:52236865-52236887 ATGGGAGGAAGGATGGGGGCTGG + Intronic
1096602322 12:52738180-52738202 CGGGGGGTGGGGAGGGGGGAGGG + Intergenic
1096814005 12:54190148-54190170 ATGGGGGAATGGTGGGGGAATGG - Intergenic
1096976704 12:55703526-55703548 ATGGGGCCAAGGAGGGGATAGGG - Intronic
1097050630 12:56221281-56221303 GAGGGGGTGAGGAGCGGGGAAGG + Intronic
1097050716 12:56221642-56221664 CTGGGGTTCAGGAGGAGGGATGG - Intronic
1097119657 12:56721377-56721399 AGGAGAGCAAGGAGGGGGGAGGG + Exonic
1097236175 12:57541386-57541408 AAGGTGGTGAGGAGGGAGGATGG + Intronic
1097250842 12:57631706-57631728 ATGGGGATAAGGATGGGGATGGG - Intronic
1097280803 12:57844895-57844917 AGGGGGGAAGGGTGGGGGGAGGG - Intronic
1097323691 12:58252503-58252525 AGGGAGGGAAGGAGGAGGGAAGG - Intergenic
1097345563 12:58488420-58488442 GTGGAGGTTAGGAAGGGGGAAGG - Intergenic
1097474976 12:60042441-60042463 AGGGAGGAAGGGAGGGGGGATGG + Intergenic
1097542345 12:60956446-60956468 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1097626636 12:62010163-62010185 ATGGGGGAGAGGGAGGGGGAGGG - Intronic
1097723727 12:63050944-63050966 ATGGGGAAAAGAAGGAGGGAAGG - Intergenic
1098097167 12:66970679-66970701 GTGGTGGTAAGGAGTGGGGAAGG + Intergenic
1098230928 12:68371042-68371064 AAGGGGGTAAGCAAGGGTGAGGG + Intergenic
1098396950 12:70029060-70029082 ATGGGGTTAGGGAGGTGGCAGGG + Intergenic
1098830530 12:75355975-75355997 TTGGGGGTAGGGTGGGGAGAGGG + Intronic
1099438161 12:82668317-82668339 GTGGGGGGAAGGAGGGGAGGAGG - Intergenic
1099864422 12:88260882-88260904 AGGGGTGGGAGGAGGGGGGAGGG + Intergenic
1100001496 12:89842467-89842489 ATGTGGGTAAGAAGGCTGGAGGG + Intergenic
1100005606 12:89891412-89891434 GTGGGGTGAGGGAGGGGGGAGGG + Intergenic
1100167260 12:91929871-91929893 ATGGGGGGAGGCAGTGGGGAGGG + Intergenic
1100209006 12:92381891-92381913 ATGGAGGGAGGGAGGGAGGAAGG + Intergenic
1100209013 12:92381903-92381925 AGGGAGGAAGGGAGGGGGGATGG + Intergenic
1100209026 12:92381930-92381952 AGGGAGGAAGGGAGGGGGGATGG + Intergenic
1100272823 12:93042656-93042678 AGGGAGGGAAGGAGAGGGGAGGG + Intergenic
1100410231 12:94310379-94310401 ATGGGGGTGAGTAGGAGGGTAGG - Intronic
1100421837 12:94442360-94442382 CTGGGGGGAAGGAGGGAGGGGGG + Intronic
1100722206 12:97371051-97371073 ATGAGAGGATGGAGGGGGGATGG - Intergenic
1100891064 12:99126499-99126521 AGCAGGGTAAGGTGGGGGGAGGG - Intronic
1101038338 12:100727813-100727835 AAAGGGGTAAGGATGGGGTAGGG - Intronic
1101623754 12:106417863-106417885 AATGGAGTAAGGAGGGGGAAAGG + Intronic
1101638305 12:106565878-106565900 AAGGGGGTAGGGAGGGAGGAAGG + Intronic
1101706297 12:107224138-107224160 CTGGGGGTGAGGAGTGGAGAGGG + Intergenic
1101925622 12:108969232-108969254 AGGGAGGGAAGGAGGAGGGAAGG - Intronic
1101952416 12:109187066-109187088 ATGGAGGGAGGGAGGGAGGAAGG + Intronic
1102072321 12:110031017-110031039 CTGGGGGAGAGGCGGGGGGATGG + Intronic
1102390179 12:112543318-112543340 AGGGAGGGAGGGAGGGGGGAGGG - Intergenic
1102425086 12:112837874-112837896 AAGGAGGGAGGGAGGGGGGAAGG - Intronic
1102451506 12:113045083-113045105 AGTGGGGGAAGGAGGGAGGAAGG + Intergenic
1102553597 12:113711023-113711045 ATGGAGGTAAGAAAGGAGGAAGG - Intergenic
1102691270 12:114763015-114763037 GTGGGGGCAGGGAGGGTGGAAGG - Intergenic
1102877321 12:116458526-116458548 ATGGGGGTATGGGGGGTGGGGGG - Intergenic
1102880581 12:116481900-116481922 GTGGGGGTCAGGGGGTGGGATGG - Intergenic
1103238915 12:119397805-119397827 AAGGGGGGAGGGAGGGGGGAGGG + Intronic
1103425457 12:120830292-120830314 GGAGGGGGAAGGAGGGGGGAGGG + Intronic
1103425480 12:120830334-120830356 GAGGTGGAAAGGAGGGGGGAGGG + Intronic
1103698346 12:122835056-122835078 CTGGGTGGAAGGAGGAGGGAGGG + Intronic
1103812908 12:123630129-123630151 ATGGTGGTAAGGAGGAGCAACGG - Intronic
1103842865 12:123879471-123879493 ATGGGGCAAAGGAGGGTGGGTGG + Intronic
1104081416 12:125433661-125433683 ATGGGTGGGGGGAGGGGGGAGGG - Intronic
1104191110 12:126482521-126482543 AGGGAGGGAGGGAGGGGGGAAGG - Intergenic
1104207108 12:126649723-126649745 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1104463260 12:128971609-128971631 AAGGGAGGAGGGAGGGGGGAAGG - Intronic
1104463264 12:128971616-128971638 AGGGGGGAAGGGAGGAGGGAGGG - Intronic
1104463270 12:128971628-128971650 AAGGGAGGAGGGAGGGGGGAAGG - Intronic
1104463274 12:128971635-128971657 AGGGGGGAAGGGAGGAGGGAGGG - Intronic
1104463280 12:128971647-128971669 AAGGGAGGAGGGAGGGGGGAAGG - Intronic
1104463284 12:128971654-128971676 AGGGGGGAAGGGAGGAGGGAGGG - Intronic
1104463290 12:128971666-128971688 AAGGGAGGAGGGAGGGGGGAAGG - Intronic
1104463294 12:128971673-128971695 AGGGGGGAAGGGAGGAGGGAGGG - Intronic
1104463300 12:128971685-128971707 AAGGGAGGAGGGAGGGGGGAAGG - Intronic
1104463304 12:128971692-128971714 AGGGGGGAAGGGAGGAGGGAGGG - Intronic
1104463310 12:128971704-128971726 AAGGGAGGAGGGAGGGGGGAAGG - Intronic
1104463314 12:128971711-128971733 AGGGGGGAAGGGAGGAGGGAGGG - Intronic
1104463320 12:128971723-128971745 AAGGGAGGATGGAGGGGGGAAGG - Intronic
1104463329 12:128971742-128971764 AAGGGAGGAGGGAGGGGGGAAGG - Intronic
1104463333 12:128971749-128971771 AGGGGGGAAGGGAGGAGGGAGGG - Intronic
1104463339 12:128971761-128971783 AGGGAGGAAGGGAGGGGGGAAGG - Intronic
1104546185 12:129714955-129714977 ATGGGGGTGAGGATGGGGAGCGG - Intronic
1104714399 12:131006696-131006718 ATGAGGGAAATGAGGAGGGAGGG + Intronic
1104737970 12:131151511-131151533 ATGGGGGTAATGTGTGGGGTAGG + Intergenic
1104785129 12:131444206-131444228 ATGGGGGGCAGGTGTGGGGAGGG - Intergenic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105214764 13:18277719-18277741 CTGGGGGTGGGGCGGGGGGAGGG + Intergenic
1105330728 13:19412817-19412839 ATGGGGGAAGGGAGGGGGCACGG - Intergenic
1105852439 13:24347820-24347842 TTGGGGGGGTGGAGGGGGGAGGG + Intergenic
1106030842 13:26001022-26001044 GTGGGGGAAAGGAAGTGGGAAGG - Intronic
1106135036 13:26967555-26967577 ATAGGGGGAAGGAGGAGGGGAGG + Intergenic
1106353345 13:28956055-28956077 TTGGGGGAAAGGATGGGGGGGGG - Intronic
1106357135 13:28994043-28994065 GTGGGTGGCAGGAGGGGGGAGGG - Intronic
1106473964 13:30081525-30081547 TTGGGGGGAAGGTGGGGGCAGGG - Intergenic
1106931302 13:34668622-34668644 GTGGGGGTCAGGAGGAGGGGTGG - Intergenic
1107418584 13:40223953-40223975 GTGGTGGTATGGAGTGGGGAGGG - Intergenic
1107442510 13:40440715-40440737 ATGGGGGCAAAGAGGGGAAATGG - Intergenic
1107482329 13:40795121-40795143 ATGGGGGAGGGGAGGGGGAAAGG - Intronic
1107591602 13:41913281-41913303 CTGGGGGTAAGGAGTGGCCATGG + Intronic
1107943232 13:45393126-45393148 AGGGGGGTTGGGGGGGGGGAGGG + Intergenic
1107992613 13:45831690-45831712 AATGGGGTAAAGAGGAGGGAGGG + Intronic
1107999997 13:45897198-45897220 AGGGAGGGAAGGAGGAGGGAGGG - Intergenic
1108250308 13:48560307-48560329 CAGGGGTTAAGGATGGGGGAGGG + Intergenic
1108282836 13:48876461-48876483 GTGAGGGTAGGGAGGGGGTAGGG - Intergenic
1108457206 13:50628520-50628542 ATGGGGTGGGGGAGGGGGGAGGG - Intronic
1108545811 13:51492222-51492244 TTGGGGGTGGGGTGGGGGGAGGG - Intergenic
1108563856 13:51674731-51674753 ATGTGGGTGGGGAGGGTGGAGGG + Intronic
1108618974 13:52162423-52162445 GTGAGGGTAGGGAGAGGGGATGG + Intergenic
1108687718 13:52835271-52835293 ATGGGGAGGGGGAGGGGGGAAGG + Intergenic
1108794799 13:54017893-54017915 ATGGAGGGAGGGAGGGAGGAAGG + Intergenic
1108837035 13:54563377-54563399 AAGGGGGTAAGCAGGAGGGGTGG + Intergenic
1108854647 13:54777289-54777311 AGGGAGGGAGGGAGGGGGGAGGG + Intergenic
1109281086 13:60356440-60356462 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1109659668 13:65441364-65441386 ATGGGGTTAGGGATAGGGGAGGG + Intergenic
1109867497 13:68284407-68284429 CTTGGGGTGGGGAGGGGGGAGGG + Intergenic
1110763014 13:79251453-79251475 ATGGGGGATTGGCGGGGGGATGG + Intergenic
1111295224 13:86268923-86268945 AGGGAGGGAGGGAGGGGGGATGG - Intergenic
1111296797 13:86289993-86290015 GTGGGGGGAAGGGGGAGGGATGG - Intergenic
1111541917 13:89679691-89679713 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1111580803 13:90220658-90220680 GTGGGGGTGGGGAGGGGGGAGGG + Intergenic
1111844129 13:93488110-93488132 TGGGGTGAAAGGAGGGGGGAGGG - Intronic
1112565139 13:100545961-100545983 ATGGAGGAAAAGAGGGGGAAAGG - Intronic
1112833117 13:103478084-103478106 ATGGGAGGAAGGAGAGAGGAAGG + Intergenic
1113420761 13:110170034-110170056 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1113425744 13:110207098-110207120 CTGGGGGGCAGGAGGGGGGCAGG - Intronic
1113530464 13:111020724-111020746 CTGGGGGACAGGAGGAGGGAGGG - Intergenic
1113674064 13:112196148-112196170 ATGGAGGGAGGGAGGGAGGAAGG - Intergenic
1113680661 13:112242106-112242128 AGGGAGGAAAGGAGGGAGGAAGG + Intergenic
1113954369 13:114089298-114089320 GAGGGGGGGAGGAGGGGGGAGGG + Intronic
1114299723 14:21364358-21364380 GTGGGGGAAGGGAAGGGGGATGG + Intronic
1114318198 14:21525840-21525862 AGGGGGGTGGGGAGGGAGGAGGG + Intronic
1114339148 14:21724660-21724682 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1114363785 14:22005142-22005164 GTGGGTGGGAGGAGGGGGGAGGG - Intergenic
1114424940 14:22613625-22613647 ATGGGGGTCAGGGTGGGGTAGGG + Intergenic
1114479426 14:23023158-23023180 ATGTGGGGGAGGAGGGAGGAAGG - Intronic
1114492273 14:23110661-23110683 ATGGGGATAAGGAGAGAGGATGG + Intergenic
1114533920 14:23411521-23411543 AAGGGGGTAGGGAGGGGACAAGG - Intergenic
1114560887 14:23589638-23589660 AATGGGCTAAGGAGGGAGGAGGG - Intergenic
1114608220 14:24015633-24015655 ATGGGTGTCAGGCTGGGGGACGG + Intergenic
1114616729 14:24072396-24072418 ATGGGGGTAGGGAGTGGATAGGG + Intronic
1114617438 14:24075792-24075814 AGAGGGGTAAGGCGAGGGGATGG - Intronic
1115084279 14:29494522-29494544 ATGGAGGGAGGGAGGGAGGAAGG + Intergenic
1115667165 14:35563450-35563472 ATGAGGGTAAAGATGGGGGATGG + Intronic
1115889290 14:38009295-38009317 ATGGGGTGAAGGAGGGGTCAAGG + Intronic
1116491216 14:45505801-45505823 AGGGGTGGGAGGAGGGGGGAGGG - Intergenic
1116628457 14:47297522-47297544 AGGGAGGTTAGGAGGGGGGCAGG + Intronic
1116787388 14:49302554-49302576 TTGGGGGTAAGGAGGTGAGTTGG + Intergenic
1117317363 14:54585589-54585611 CTCGGGGGAAGGAGTGGGGATGG - Intronic
1117810936 14:59546318-59546340 ATGGAGGGAAGAAGTGGGGAAGG + Intronic
1118022675 14:61734761-61734783 ATGAGATTAGGGAGGGGGGAGGG + Intronic
1118096759 14:62546153-62546175 GTGGGGGTGGGGAGGGGGGAGGG - Intergenic
1118098014 14:62561158-62561180 TTGGGTGGAGGGAGGGGGGAGGG + Intergenic
1118366448 14:65101703-65101725 GTGGGGGCAAGGGGTGGGGAGGG - Intronic
1118638308 14:67768190-67768212 CTAGGGGTAAGGAGGGAGCATGG + Intronic
1118916798 14:70114587-70114609 ATGGGGGCAGGGAGGAGAGATGG - Intronic
1118939867 14:70323802-70323824 ATGGGGGTGAGGAGAGGTGGAGG - Intergenic
1119154994 14:72402004-72402026 ATGGGAGTAATCTGGGGGGAAGG + Intronic
1119168507 14:72515230-72515252 AGGGAGGGAAGGAGGGGGAAAGG - Intronic
1119219001 14:72891971-72891993 GTGGGGTTAAGGGTGGGGGAAGG - Intronic
1119235411 14:73015331-73015353 AAGGGGGGAAGGAAAGGGGAAGG + Intronic
1119377463 14:74206376-74206398 AGGGAGGCAGGGAGGGGGGAGGG - Intergenic
1119431207 14:74569149-74569171 ATGGAGGGAAGGAGGGAAGAAGG + Intronic
1119551342 14:75516165-75516187 AGGAGGGGAAGGAGGGAGGAAGG - Intergenic
1119635008 14:76266801-76266823 AGGGAGGAAAGGAGAGGGGAGGG + Intergenic
1120128189 14:80772418-80772440 ATGGGGAGCTGGAGGGGGGATGG - Intronic
1120251541 14:82065542-82065564 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1120489950 14:85164804-85164826 TTGGGGGGAAGGATGGGAGAGGG + Intergenic
1120575516 14:86175748-86175770 AGGGAGGGAGGGAGGGGGGAGGG + Intergenic
1120909734 14:89655386-89655408 AGGGAGGAAAGGAGGGAGGAAGG - Intergenic
1120995111 14:90411633-90411655 ATGGGGGGAAGGAGGCAGAAAGG - Intergenic
1121016198 14:90550814-90550836 ATGGAGGGATGGAGGAGGGATGG + Intronic
1121023634 14:90598460-90598482 ATGGGGGTAAGGAGGGGGGAAGG + Intronic
1121092800 14:91194498-91194520 CTGAGGTTAGGGAGGGGGGATGG + Intronic
1121502691 14:94450875-94450897 ATGGGTGTAGGGTCGGGGGATGG - Intronic
1121593358 14:95137476-95137498 ATGGGGATAGGGAAGGGGAAGGG + Intronic
1121614273 14:95302348-95302370 AAGGAGGGAAGGAGGGAGGAAGG + Intronic
1122081978 14:99273012-99273034 ATCGGGGTAAGGTGAGGGGAGGG - Intergenic
1122099249 14:99394252-99394274 TTGAGGGTAAGGAGGGAGGCAGG - Intergenic
1122497185 14:102166108-102166130 CTGGGGGTGAGAAGGGGGGTGGG - Intronic
1122507479 14:102240870-102240892 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1122530922 14:102426430-102426452 CTGGGGGTGAGGAGTCGGGAGGG - Intronic
1122958524 14:105083822-105083844 ATGGGTGGATGGAGGGTGGAGGG - Intergenic
1202925288 14_KI270724v1_random:18447-18469 ATGGGTGTCAGGCTGGGGGATGG - Intergenic
1123539159 15:21270548-21270570 ATTGGATTAAGGATGGGGGAAGG - Intergenic
1123541126 15:21292741-21292763 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1124841651 15:33247633-33247655 GTGAGGGTAAGCAGGGGGGCGGG + Intergenic
1124857635 15:33406123-33406145 ATGGCAGTAGGGAGGTGGGAGGG + Intronic
1124957753 15:34370852-34370874 GAGGGGGAAAGGAGGAGGGAGGG - Intergenic
1125221155 15:37336648-37336670 ATGGGGGTAGGGGGGAGGGATGG + Intergenic
1126151315 15:45526116-45526138 GAAGGGGAAAGGAGGGGGGAAGG - Intergenic
1126151329 15:45526148-45526170 GAAGGGGAAAGGAGGGGGGAAGG - Intergenic
1126151343 15:45526180-45526202 GAAGGGGAAAGGAGGGGGGAAGG - Intergenic
1126167604 15:45666929-45666951 ATGGGAGAAAGGAGAGGAGAGGG - Intronic
1126725207 15:51624277-51624299 AAGGGAGGAAGGGGGGGGGAGGG - Intergenic
1126837340 15:52679796-52679818 AGGGGGGGAAGGAGGGGGAGGGG - Intronic
1126897507 15:53274948-53274970 AGGGTGGGAAGGAGGGAGGAAGG - Intergenic
1127117028 15:55738897-55738919 AAGGGGGAAGGGAAGGGGGAGGG + Intronic
1127353032 15:58171491-58171513 ACAGGGGTTAGGAGGGAGGAGGG - Intronic
1127469821 15:59280974-59280996 TTGGAGGTGAGGATGGGGGAGGG - Intronic
1127995984 15:64153334-64153356 CTGGGGGTAAGGGGGGCCGATGG + Exonic
1128217413 15:65944142-65944164 CTGGGGGTTAGGAGGTGGCAGGG + Intronic
1128227057 15:66009336-66009358 ATGGGGGTGGGGAGGGTGCAGGG + Intronic
1128258414 15:66214877-66214899 ATGGGGGTAAGAGGAGAGGAGGG + Intronic
1128365004 15:66993321-66993343 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1128556936 15:68638182-68638204 CTGAGGGTCAGGAGGAGGGAGGG - Intronic
1128810244 15:70566185-70566207 AAGGGAGGAAGGACGGGGGAGGG - Intergenic
1128981859 15:72194021-72194043 ATGTGGGAAAGGAAGGAGGAGGG - Intronic
1129013380 15:72443220-72443242 ATGGGGTGGGGGAGGGGGGAGGG + Intergenic
1129624559 15:77183016-77183038 AAGGGGGGAAGAAGGGGGAAAGG + Intronic
1129746950 15:78028845-78028867 ATGTGGCAAAGGAGGGGGAAGGG + Intronic
1129748327 15:78040692-78040714 AGGGGGGGAGGGAGGGAGGAAGG + Intronic
1129891994 15:79077741-79077763 ATGGCAGTGAGGATGGGGGAAGG - Intronic
1129917790 15:79289654-79289676 AAGGTGGGAAGGAGGGTGGATGG - Intergenic
1130098950 15:80877434-80877456 TTGGGGGTGAGGAGGTGGGAAGG - Intronic
1130138528 15:81202467-81202489 GTGGGTGTAGGGAGGGGGGAGGG - Intronic
1130736938 15:86560281-86560303 GCGGGGGTGGGGAGGGGGGAGGG - Intronic
1130739502 15:86583332-86583354 AGAGGGGTAGGGAGGGGGCAAGG - Intronic
1130796424 15:87214533-87214555 AGGGAGGGAGGGAGGGGGGAAGG + Intergenic
1130951727 15:88596213-88596235 AGGAGGGGAGGGAGGGGGGAGGG - Intergenic
1130981062 15:88812071-88812093 AGGAGGGTTAGGAGTGGGGATGG + Intronic
1131078038 15:89510685-89510707 TTGGGGGTGAGGAAGGGAGAGGG + Intergenic
1131285516 15:91053781-91053803 CTGGGGTTAGGGAGGGGTGAAGG - Intergenic
1131447586 15:92512766-92512788 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1131588565 15:93722507-93722529 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1131634251 15:94213174-94213196 GGGGGAGTAGGGAGGGGGGAGGG + Intergenic
1131791467 15:95970228-95970250 AGGGAGGGAAGGAAGGGGGAAGG + Intergenic
1132262864 15:100441534-100441556 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1132279694 15:100602441-100602463 CCGGGGGTAAGGAGGAGAGAAGG + Intronic
1132435451 15:101797656-101797678 TTGGGGGAAAGGATGGGAGAGGG + Intergenic
1202949439 15_KI270727v1_random:19882-19904 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1132517491 16:372594-372616 ATGTGGGTAAGGAGCCGGGCTGG - Exonic
1132677432 16:1126574-1126596 GTGGGGGGAGGGCGGGGGGAGGG - Intergenic
1132854609 16:2039183-2039205 ATGGGGGTCAGCGGGGGAGATGG - Intergenic
1132989803 16:2786871-2786893 GAGGGGGTGAGGATGGGGGAGGG - Intronic
1132989824 16:2786925-2786947 AGGGGGGTGAGGATGGAGGAGGG - Intronic
1133038165 16:3046213-3046235 CTGGGGGGAAGGAGAGGGGCGGG + Intergenic
1133170382 16:3979287-3979309 ATGGGGGTTAGCAGGAGCGACGG + Intronic
1133177310 16:4025064-4025086 AAAGGGGTAGGGAGGGGGGCTGG + Intronic
1133256316 16:4518545-4518567 ATGTGGATATGGAGGGGTGAGGG - Intronic
1133376785 16:5293745-5293767 CTGGGGGAAAGGGGAGGGGATGG + Intergenic
1134263289 16:12671381-12671403 ATGGTGGTAAAGAGGGGTAAGGG + Intronic
1134291740 16:12907146-12907168 ATGGAGGGAAGGAGGGAGGGAGG - Intronic
1134311172 16:13076471-13076493 GTGGGGGAAAGGAGGGAGCAGGG - Intronic
1134316282 16:13121707-13121729 ATGGGGGCAGGGAAGGGGAATGG + Intronic
1134523236 16:14927891-14927913 AAGGGGGAGAGGAGAGGGGAGGG - Intronic
1134523247 16:14927919-14927941 AAGGGGGAGAGGAGAGGGGAGGG - Intronic
1134523268 16:14927976-14927998 AAGGGGGAGAGGAGAGGGGAGGG - Intronic
1134592199 16:15463715-15463737 ATGGGGGTCAGGATTGGGGAGGG - Intronic
1134770616 16:16806075-16806097 AAGGGGGAGAGGAAGGGGGAAGG - Intergenic
1134774113 16:16837085-16837107 CTGGGGGAAAGGAGAGGGGAGGG + Intergenic
1134851325 16:17481334-17481356 ATTGGGGTAAGGAAGGGGAGAGG - Intergenic
1134908144 16:17999720-17999742 TGGGGGTTAAGGTGGGGGGAGGG + Intergenic
1134948690 16:18342078-18342100 AAGGGGGAGAGGAGAGGGGAGGG + Intergenic
1134993654 16:18722497-18722519 ATGGGGAGGGGGAGGGGGGAGGG + Intergenic
1135025560 16:18996634-18996656 AAGGGGGAATGGAGGGCGGAAGG + Intronic
1135123526 16:19786819-19786841 AGGGAGGGAGGGAGGGGGGATGG + Intronic
1135167568 16:20153912-20153934 ATGGGGGTTACCAGGGGGGTAGG - Intergenic
1135227476 16:20674443-20674465 TTGGGGGTGGAGAGGGGGGAGGG - Intronic
1135317749 16:21465000-21465022 ATGGGCTTAAGATGGGGGGAGGG + Intergenic
1135370644 16:21896799-21896821 ATGGGCTTAAGATGGGGGGAGGG + Intergenic
1135441142 16:22473920-22473942 ATGGGCTTAAGATGGGGGGAGGG - Intergenic
1135543241 16:23348454-23348476 AGGGAGGGAGGGAGGGGGGAGGG + Intronic
1135562678 16:23488509-23488531 ATCGGAGTATGGAGGGGGGCAGG - Intronic
1135591858 16:23710874-23710896 ATGGGCCCAAGGAGGGAGGAGGG + Intronic
1135640238 16:24113517-24113539 AAGGGGGGAGGGAGGGAGGAAGG - Intronic
1135681790 16:24463476-24463498 TGGGGGGAAAGGAGGGGAGATGG + Intergenic
1135927684 16:26709825-26709847 AGGGAGGGAGGGAGGGGGGAGGG + Intergenic
1135982028 16:27155223-27155245 ATGGGTGGAGGGAGGGGGAAGGG - Intergenic
1135985762 16:27182825-27182847 ATGGGGGTAGGGAGGGAGAAAGG + Intergenic
1136043785 16:27600195-27600217 AGTGGGGTGAGGAGGGAGGAGGG + Intronic
1136238073 16:28926671-28926693 GTGGGTGTTGGGAGGGGGGAGGG + Intronic
1136240037 16:28937966-28937988 ATGGGGCTCAGGATGGGGGATGG - Intronic
1136240045 16:28937985-28938007 TTGGGGGTCAGGATGGGGGATGG - Intronic
1136333476 16:29596351-29596373 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1136619223 16:31416991-31417013 GAGGGGGGAGGGAGGGGGGAAGG - Intronic
1136619229 16:31417002-31417024 AGGGAGGGAGGGAGGGGGGAGGG - Intronic
1136626437 16:31464901-31464923 ATGGGGGCAAGGAGACGGGTGGG - Intronic
1137012225 16:35333282-35333304 ATGGGGCTAAGGTGGGAGGATGG + Intergenic
1137016583 16:35382067-35382089 ATGGGGCTAAGGTGGGAGGATGG + Intergenic
1137018958 16:35403720-35403742 ATGGGGCTAAGGTGGGAGGATGG + Intergenic
1137524481 16:49222733-49222755 AGGGGGGGAGGGAGGGAGGAAGG - Intergenic
1137688482 16:50403164-50403186 ATGGTGAGAAGGAGGGAGGAAGG + Intergenic
1137887903 16:52126375-52126397 ATGGGGTAAATGAGGGGGGATGG + Intergenic
1137977309 16:53042498-53042520 AGGAGGGAGAGGAGGGGGGAAGG - Intergenic
1138081480 16:54094997-54095019 AAGGGGGCAAAGAGAGGGGATGG - Intronic
1138143562 16:54588689-54588711 AAGAGGGAAAGGAGGAGGGAGGG - Intergenic
1138183960 16:54962439-54962461 AGGGAGGGAGGGAGGGGGGAAGG - Intergenic
1138215861 16:55204839-55204861 ATTGGGGTAAGGAAGAGAGAGGG + Intergenic
1138232478 16:55348868-55348890 GTGGGGGTAGGGTGGGGGGTGGG + Intergenic
1138422597 16:56909411-56909433 ATGGTGGTAGGGATGGGGGGTGG - Intronic
1138528365 16:57621495-57621517 ATGGGTGTAGGGAGTGGGGGTGG + Intronic
1138933804 16:61694605-61694627 ATGGGGGTAAGATAGGGTGATGG + Intronic
1138972057 16:62157309-62157331 AAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1139337858 16:66245660-66245682 GTGGGGGTGAGGAGGGAGCAAGG - Intergenic
1139537401 16:67585967-67585989 ATGGGGGTAGGGTGGAGGGCAGG - Intronic
1139701551 16:68710959-68710981 GGGAGGGGAAGGAGGGGGGAGGG + Intronic
1139711550 16:68780150-68780172 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
1139933785 16:70552109-70552131 ATGGGGCAAAGAAGGGAGGAGGG - Intronic
1140194958 16:72848144-72848166 ATGGGGGTGCTGAGGGGGAATGG + Intronic
1140205267 16:72928099-72928121 ATGGGGGGAGGGGAGGGGGAGGG + Intronic
1140338095 16:74130676-74130698 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1140344562 16:74200291-74200313 CTTGGGGTCAGGAAGGGGGAAGG + Intergenic
1140669567 16:77263925-77263947 GTGGGGGTGGGGAGGAGGGAGGG - Intronic
1140733321 16:77875831-77875853 AGGGAGGTTAGGAGGGAGGAAGG + Intronic
1140814095 16:78604835-78604857 AAGGAGGGAGGGAGGGGGGAAGG - Intronic
1140927821 16:79600109-79600131 ATTGGCGTGAGCAGGGGGGAGGG - Exonic
1141427096 16:83951757-83951779 AGGGAGGGAAGGAGGGTGGAAGG - Intronic
1141427161 16:83951947-83951969 AGGGGGGGAAGGAGGGAGGAAGG - Intronic
1141427202 16:83952055-83952077 AGGGGGGGAAGGAGGGAGGAAGG - Intronic
1141430860 16:83969566-83969588 AGGGGAGTTAGGAGGGGTGAGGG - Intronic
1141565195 16:84896947-84896969 ACGGGATTAAGGAGGGTGGACGG - Intronic
1141585945 16:85033665-85033687 GTGGGGGCAGGGATGGGGGAGGG + Intronic
1141665211 16:85462348-85462370 CTGAGGGTAGGGAGGGTGGAGGG - Intergenic
1141891739 16:86930788-86930810 ATGGAGGAAAGGAGGGGTGCAGG - Intergenic
1141895612 16:86956983-86957005 ATGGGAGGAAGGTGGGGGGAGGG + Intergenic
1141954121 16:87358807-87358829 CTGGGGCTCAGGAGGTGGGAGGG + Intronic
1142021112 16:87783293-87783315 ATGGGGGTAAAGGGAGGGGAAGG - Intergenic
1142327897 16:89429021-89429043 ATGGGGGTTGGGGGGAGGGAAGG + Intronic
1142340447 16:89518765-89518787 TAGGGGTTAAGGATGGGGGAAGG + Intronic
1142748738 17:1974712-1974734 GTGGGGGTGGGGAGGGGGGAGGG + Intronic
1142765217 17:2060633-2060655 AGGCGGGCAAGGAGGGGTGAAGG + Exonic
1143021235 17:3918081-3918103 AAGGGAGGAAGGAGGGAGGAAGG + Intergenic
1143055455 17:4158771-4158793 AGGCGGGTTAGGAGGAGGGAAGG - Intronic
1143478737 17:7217228-7217250 AGTGGGGTGCGGAGGGGGGAGGG - Intronic
1143513485 17:7408126-7408148 CGGGGGGAAAGGAGGGAGGAGGG - Intronic
1143616726 17:8055971-8055993 ATGGGGGTGCGGTGAGGGGAAGG - Intergenic
1143670652 17:8393530-8393552 GTGGGAGTTAGGACGGGGGAGGG - Intronic
1144032663 17:11336333-11336355 ATGGGGTAAAGGAGGGGTGCTGG + Intronic
1144346778 17:14356545-14356567 TAGGGGGTAAGGAGGCAGGAAGG + Intergenic
1144404479 17:14939517-14939539 ACGGAGGGAAGGAGGGAGGAAGG + Intergenic
1145193736 17:20868964-20868986 ATGGGGGAAAAGGGGGGGGAAGG + Intronic
1145279743 17:21458424-21458446 AGGGAGGTGAGGAGAGGGGAAGG + Intergenic
1145742274 17:27285325-27285347 TTGGGGGTAAGGAGAGGAGAGGG + Intergenic
1145958790 17:28873350-28873372 GTGGGGGTAGGGAGTGAGGAGGG - Intergenic
1146020716 17:29276346-29276368 ATGGGGGCAAGGTGAGGGAAGGG - Intronic
1146196007 17:30813748-30813770 CTGGGTGTGGGGAGGGGGGAGGG - Intronic
1146256457 17:31393708-31393730 ATGGGAGTATGGAGCTGGGAAGG - Intronic
1146263908 17:31438566-31438588 ATGGGGGTGTGGAGAGAGGAAGG - Intronic
1146299418 17:31676608-31676630 ATGGGAGGAAGGAGGGAGGAGGG + Intergenic
1146393336 17:32442906-32442928 ACGGATGTGAGGAGGGGGGATGG - Intergenic
1146422210 17:32698277-32698299 AGGGGGGAAGGGAGGGAGGAAGG - Intronic
1146429049 17:32773515-32773537 GTGGGGGTAGGGAGTGGGGTGGG - Intronic
1146624539 17:34425261-34425283 TTGGGGGTACGGTGGGGTGAGGG + Intergenic
1146641789 17:34547384-34547406 ATGTGGGTAAGGAGAAGGGCGGG - Intergenic
1146688392 17:34856815-34856837 ATGGGGGTGCGGAGGATGGAGGG + Intergenic
1146688406 17:34856856-34856878 ATGGGGGTGGGGAGGATGGAGGG + Intergenic
1146829688 17:36057837-36057859 ATGGGTGTAAGGAGGTGGATTGG - Intergenic
1146963088 17:37001390-37001412 ATGGGAGGAGGGAGGGAGGAAGG + Intronic
1147142611 17:38467873-38467895 ATGGAGGGATGGAGGGTGGATGG - Intronic
1147241592 17:39094250-39094272 CTGGGAGTAATGAGTGGGGATGG - Intronic
1147334768 17:39720574-39720596 AAGGGGGTATGGAGAGGAGAGGG + Intronic
1147417941 17:40307220-40307242 GTGGGGGTAGGGAGGCGGAAAGG + Intergenic
1147428513 17:40357441-40357463 TGCGGGGTAAGGAGGGGGCACGG - Intronic
1147438057 17:40430092-40430114 ATGCAGGGAAGGATGGGGGAGGG + Intergenic
1147617408 17:41837699-41837721 GGGGTGGTAAGGAGGGGAGAAGG + Intronic
1147704224 17:42414923-42414945 GTGGGGGAAAGGAGGGGTGTTGG - Intronic
1147721045 17:42539549-42539571 ATGGGGGCAAAGAGGCGGGCAGG - Intronic
1147969551 17:44212176-44212198 ATGGGGGTGGGGGGTGGGGAAGG + Intronic
1148018650 17:44539632-44539654 AAGTGGGAAAGGAGGAGGGAAGG + Intergenic
1148105244 17:45115293-45115315 AGGGGGGGAAGGTGGGAGGACGG - Intronic
1148252326 17:46094471-46094493 ATGGGGGTTACGAGGTGGGAGGG + Intronic
1148324170 17:46773637-46773659 TTGGGGCTGAGGGGGGGGGAGGG - Intronic
1148450895 17:47777310-47777332 ATGGGAGTGAGGTGGGGAGATGG + Intergenic
1148749975 17:49940087-49940109 CTGGGAGTAGGGAGGGGGCAGGG + Intergenic
1148853445 17:50565826-50565848 AGGGAGGAAAGGAGGAGGGATGG + Intronic
1148861742 17:50608138-50608160 AAGGAGGTGAGGAGGGGGGTGGG - Intronic
1148985009 17:51613447-51613469 AGGGGGCAAGGGAGGGGGGAGGG - Intergenic
1148985028 17:51613484-51613506 AGGGGGGTGAGGGAGGGGGAGGG - Intergenic
1149109865 17:53015574-53015596 AAGGGGGTGGGGTGGGGGGAAGG + Intergenic
1149192752 17:54083829-54083851 AGGGGGGTTAGGGGAGGGGAGGG - Intergenic
1149217399 17:54373608-54373630 ATGGGGCTGAGGAGGGAGGATGG + Intergenic
1149553279 17:57555589-57555611 AGGGGGTTCAGGAGGGAGGAAGG - Intronic
1149655455 17:58307538-58307560 GTGGAGGAAAGGAGGGAGGAGGG + Intronic
1149717288 17:58804505-58804527 ATGGAGATAGGGAAGGGGGATGG + Intronic
1149785793 17:59433885-59433907 AGAGGGGAAAGGAGGAGGGAGGG - Intergenic
1150229243 17:63541005-63541027 ATGGGGCCATGGAGGAGGGAGGG - Intronic
1150285998 17:63954489-63954511 ATGGGGGAAGGGAGGAGGGGAGG + Intronic
1150486014 17:65544286-65544308 ATGGGGGTAGGGATGGGGAGGGG + Intronic
1150640082 17:66943722-66943744 ATGGTGGCAAGGAGGGGAGGAGG - Intergenic
1150655795 17:67038597-67038619 AGTGGGGTAAGGACGGAGGAAGG - Intergenic
1150790138 17:68196542-68196564 GTGGGGGTAGGGGGTGGGGAAGG + Intergenic
1150864404 17:68834597-68834619 ATGGAGGGAGGGAGGGAGGAAGG - Intergenic
1150883654 17:69059706-69059728 ATGGGGGCAGGGTTGGGGGAAGG + Intronic
1151475369 17:74342022-74342044 GTGGGGCTAAGGGTGGGGGAGGG - Intronic
1152007560 17:77691988-77692010 ACGGGGGTAGGGACGGGGGTAGG - Intergenic
1152063690 17:78098099-78098121 ATGGGGGAAAGGAAGAGAGAAGG - Intronic
1152155927 17:78632762-78632784 ATGGGGGCAGGGGTGGGGGATGG - Intergenic
1152238395 17:79149989-79150011 ATGGGGGTGGGGGTGGGGGATGG + Intronic
1152314561 17:79572556-79572578 GTGGGGGGAGGGAGGGGGAAGGG + Intergenic
1152352656 17:79792005-79792027 ATGGGGGCGAGGATGGGGGCGGG + Intergenic
1152401477 17:80069071-80069093 ATGGGTGTCAGGAGGGAGGAGGG - Intronic
1152423260 17:80205263-80205285 AGGGGAGGAAGGAGGGAGGAAGG - Intronic
1152577989 17:81151315-81151337 ATGTGGGGGAGGAGGGGTGAGGG - Intronic
1152701032 17:81819894-81819916 ATTGGGGTGAGGAGGGGGAGGGG - Intergenic
1152701043 17:81819917-81819939 ATTGGGGTGAGGAGGGGGAGGGG - Intergenic
1152760145 17:82103462-82103484 GTGGGGGGAGGGAGTGGGGATGG - Intronic
1152777842 17:82213382-82213404 ACTGGGGGAAGGAGGGGGGTCGG + Intergenic
1152793275 17:82293343-82293365 AGGGCGGGAAGGAGAGGGGACGG + Intergenic
1152928521 17:83098825-83098847 GTGGGGACAAGGAGGGGGGCTGG - Intergenic
1153299807 18:3582840-3582862 AGGGAGGGAGGGAGGGGGGAGGG - Intronic
1153556691 18:6322420-6322442 ATGGAGGCAGGGAGGGAGGAAGG + Intronic
1153769080 18:8401033-8401055 CTGGGGGTGGGGAGAGGGGATGG - Intronic
1153869413 18:9303509-9303531 ATGGGGGGAAGGATGGGAGGGGG - Intergenic
1153870623 18:9316163-9316185 AGGGAGGGAGGGAGGGGGGAAGG + Intergenic
1154031275 18:10756196-10756218 AAGGGGATAAGGAGGAGGGATGG + Intronic
1154031392 18:10756815-10756837 ATGGGGATAAGGATGAGGAATGG + Intronic
1154031412 18:10756906-10756928 ATGGGGATACGGATGAGGGATGG + Intronic
1154031452 18:10757110-10757132 ATGGGGATAAGGATGAGGGTTGG + Intronic
1154236246 18:12608967-12608989 ATGGGGGTGGGGTGTGGGGATGG + Intronic
1154282462 18:13016786-13016808 AAGGGAGGAAGGAGGGAGGAGGG - Intronic
1154475731 18:14755540-14755562 GTGAGGGGAAGGAAGGGGGAGGG - Intronic
1154954452 18:21241633-21241655 AAGGGGGTAGGGTGGGGGCAGGG - Intergenic
1155028041 18:21960189-21960211 AAGGGGGAAAGGGGTGGGGAAGG - Intergenic
1155243949 18:23889652-23889674 AAGGGAGGAGGGAGGGGGGAGGG + Intronic
1155531364 18:26770328-26770350 CAGGGGCTAAGGTGGGGGGAGGG - Intergenic
1155625155 18:27826024-27826046 AAGGGTCTGAGGAGGGGGGAGGG + Intergenic
1155650427 18:28134350-28134372 GTGGGGGAAAGGCTGGGGGAAGG - Intronic
1155710735 18:28875519-28875541 GTGTGGGTCAGGAAGGGGGAAGG - Intergenic
1155730965 18:29157506-29157528 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1155813783 18:30276329-30276351 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1156146469 18:34187188-34187210 ATGGGGTTAAGGAGGAGGGAGGG - Intronic
1156753119 18:40485322-40485344 ATGGGGGTAGGGATGGAGGTGGG - Intergenic
1157115504 18:44859072-44859094 ATTGGGGGAAGGAGGGGGAAGGG + Intronic
1157367708 18:47081071-47081093 ATGGAGGGAAGGAGGGAAGAAGG - Intronic
1157522011 18:48351982-48352004 ATGGAGGTGAGGAAGGGGGCTGG - Intronic
1157627188 18:49060668-49060690 AGAGGGGAAGGGAGGGGGGAGGG + Intronic
1157649862 18:49317600-49317622 AGGGAGGGAGGGAGGGGGGAGGG - Intronic
1157786858 18:50491435-50491457 ATGAGGGTTAGGAGGGTGGTTGG + Intergenic
1157919185 18:51698086-51698108 AGGGGTGTAAGGTGGCGGGATGG - Intergenic
1157949958 18:52025013-52025035 ATGGGGCTAAGGTGGGAGGAAGG + Intergenic
1158103773 18:53861353-53861375 AGGGAGGAAAGGAGGAGGGAGGG + Intergenic
1158103842 18:53861531-53861553 AGGGAGGGAAGGAGGGAGGAGGG + Intergenic
1158528177 18:58234263-58234285 AGGGGGGAAGGGAGGGAGGAAGG - Intronic
1159046917 18:63377593-63377615 AAGGGGGGAAGGAGGAAGGAAGG - Intergenic
1159242944 18:65766696-65766718 ATGGGGAGAAGGAAGGGGGGAGG + Intronic
1160335233 18:78032850-78032872 AAGGGGGTAGGGGGAGGGGAGGG - Intergenic
1160387539 18:78505619-78505641 TTGGGGGCCAGGAGGGAGGAAGG - Intergenic
1160461642 18:79043411-79043433 GTGGGGGTTGGGATGGGGGATGG - Intergenic
1160479593 18:79226632-79226654 ATGGGGCAAAGGAAGGGGGAAGG - Intronic
1160659550 19:291619-291641 AGGGGAGGAGGGAGGGGGGACGG + Intergenic
1160698743 19:496612-496634 AGGGGGCTCAGGAGAGGGGAGGG + Intronic
1160698880 19:496997-497019 AGGGGGCTCAGGAGAGGGGAGGG + Intronic
1160958282 19:1705441-1705463 ATGGAGGGAGGGAGGGAGGAAGG + Intergenic
1160965666 19:1746014-1746036 GGAGGGGGAAGGAGGGGGGAAGG + Intergenic
1160983254 19:1826376-1826398 CTGGGAGTAGGGAGGAGGGAGGG + Intronic
1161139612 19:2639749-2639771 GGGGGAGGAAGGAGGGGGGAAGG + Intronic
1161139685 19:2639958-2639980 AGGGAAGGAAGGAGGGGGGAGGG + Intronic
1161329229 19:3678466-3678488 ATGGAGGGATGGAGGAGGGATGG + Intronic
1161329234 19:3678485-3678507 ATGGAGGCAAGGAGGATGGAAGG + Intronic
1161415654 19:4145215-4145237 AAGGGAGGAGGGAGGGGGGAAGG + Intergenic
1161494502 19:4580167-4580189 TTGGGTTTAAGGAGGGAGGAGGG - Intergenic
1161594465 19:5144160-5144182 CTGGGGGCAAGGAGGCGGGCAGG - Intronic
1161608456 19:5227991-5228013 AAGGGGATAAGGAGGGGTGACGG + Intronic
1161711828 19:5853036-5853058 AAGGGGGAATGGAGGGCGGAAGG - Intergenic
1161754149 19:6119378-6119400 ATGGAGGGAAGGAGGGAGGGAGG - Intronic
1161777372 19:6270937-6270959 GTGGGAGTACGGAGGGGAGAAGG - Intronic
1161790587 19:6357440-6357462 AGGGGGGTCAGCAGGGGGGACGG + Intergenic
1161803520 19:6429421-6429443 AAGGGAGAAAGGAGGAGGGAAGG + Intronic
1161812516 19:6478905-6478927 ATGGGGGTTGGAGGGGGGGATGG - Intronic
1161978659 19:7619551-7619573 GAGGGGGTGGGGAGGGGGGATGG + Exonic
1162062844 19:8107267-8107289 ATGGACAGAAGGAGGGGGGATGG + Intronic
1162145810 19:8611426-8611448 AGGGGGGTAAGGAATGGGGCTGG + Intergenic
1162237741 19:9321795-9321817 GTGGGGGTGGGGAGGGGGGTGGG - Intergenic
1162278569 19:9677345-9677367 ATGGGTGTCAGGCTGGGGGACGG + Intergenic
1162338983 19:10080052-10080074 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1162861663 19:13510048-13510070 AGGGAGGGAGGGAGGGGGGAGGG + Intronic
1162872749 19:13598656-13598678 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1162879677 19:13648880-13648902 AGGGAGGGAGGGAGGGGGGAGGG + Intergenic
1162904555 19:13816033-13816055 ATGGGGGGAGAGAGAGGGGAAGG + Intronic
1163004545 19:14389229-14389251 AAGGGGGAAAGGGAGGGGGATGG + Intronic
1163004762 19:14390136-14390158 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1163010620 19:14423312-14423334 ATGGACGTAAGGAGGGTGGATGG + Intergenic
1163093821 19:15041287-15041309 GAGGGGGGAGGGAGGGGGGAGGG - Intergenic
1163132518 19:15284260-15284282 ATGGGGATCAGGAGGAGGAACGG + Intronic
1163270783 19:16252302-16252324 ATGAGGGTCAGGAGTGGGGCTGG - Intergenic
1163315660 19:16538921-16538943 ATGGGGGGCAGGTGGGGTGAAGG - Intronic
1163378527 19:16949051-16949073 AGGGGGGGAGGGAGGGAGGAAGG + Intronic
1163383657 19:16985742-16985764 ATGGGTGGAGGGAGGGAGGAAGG + Intronic
1163448816 19:17363540-17363562 AGGGTGGAAGGGAGGGGGGAAGG - Intronic
1163521492 19:17794725-17794747 ATGGCGATAAGGAGGGAGGGAGG - Intergenic
1163919700 19:20276982-20277004 ATGGGGGTCAGGCTGGGGGATGG - Intergenic
1163986889 19:20961955-20961977 ATGGGTGTCAGGCTGGGGGATGG - Intergenic
1164025353 19:21346646-21346668 AAGGGGGTAGGGAGGGAGGGAGG + Intergenic
1164202644 19:23031268-23031290 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1164258613 19:23550495-23550517 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1164522251 19:28988465-28988487 AAGGAGGGAAGGAGGGAGGAAGG + Intergenic
1164581272 19:29436769-29436791 AGGGGGTGGAGGAGGGGGGATGG + Intergenic
1164582673 19:29444350-29444372 AGGGAGGGAGGGAGGGGGGAGGG - Intergenic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1164757390 19:30700339-30700361 AAGGAAGGAAGGAGGGGGGAGGG - Intronic
1164999702 19:32751098-32751120 CGGGGGGTGGGGAGGGGGGAGGG - Intronic
1165148815 19:33749388-33749410 ATAGGAGGATGGAGGGGGGATGG - Intronic
1165149863 19:33753976-33753998 GTGGGGGGATGGAGGGGGGATGG - Intronic
1165149881 19:33754016-33754038 GTGGGGGGATGGAGGGGGGATGG - Intronic
1165186911 19:34030626-34030648 ATGGGGGTGGGGAGTGGAGAGGG + Intergenic
1165203922 19:34167851-34167873 ATGGGGGTGAGGAGTAGGAATGG - Intergenic
1165255688 19:34576290-34576312 ATGGGATTGAGGAGGGGGCATGG + Intergenic
1165327194 19:35121045-35121067 AAGAGGGGAAGGAGGGGAGATGG - Intronic
1165407805 19:35641780-35641802 ATGGGGGGAGTGAGGGGAGAGGG - Exonic
1165574157 19:36799951-36799973 ATGGGTGTCAGGCTGGGGGATGG - Intergenic
1165980056 19:39714087-39714109 ATGGGTGTGGGGAGGGGAGAGGG - Intergenic
1166062417 19:40334951-40334973 AGGGGGGTAGGGAGGGAGGGAGG + Intronic
1166126956 19:40720699-40720721 GAGGGGGTCAGGAGGAGGGAAGG - Intronic
1166230368 19:41422931-41422953 GTGGGGGTCAGGAGGGAGGATGG - Intronic
1166503797 19:43359261-43359283 ACGGGTGTAAGTAGGGGAGATGG + Intronic
1166506657 19:43375497-43375519 ACGGGTGTAAGTAGGGGAGATGG - Intergenic
1166565947 19:43765631-43765653 AGGGGGCAAAGGAGGGGGGCTGG - Intergenic
1166707250 19:44914812-44914834 AGGGAGGTAGGGAGGGAGGAGGG + Intronic
1166747777 19:45149899-45149921 ATGGGGGAAGGGAGTGGAGAAGG + Exonic
1166794582 19:45418930-45418952 ATGTTGGCAAGGAGAGGGGAGGG - Intronic
1166835617 19:45666017-45666039 AGGGAGGAAGGGAGGGGGGAGGG + Intergenic
1166948086 19:46409251-46409273 AGGGAGGGAAGGAGGGAGGAGGG + Intergenic
1167195197 19:48023465-48023487 ATGGAGGAAGGGAGGAGGGAAGG + Intronic
1167393615 19:49212640-49212662 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1167548512 19:50143711-50143733 ATGGGGGTGAGGATCAGGGATGG - Intergenic
1167569253 19:50276729-50276751 TTGGGGGAAAGGAGAGAGGATGG - Intronic
1167601125 19:50455462-50455484 ATGGGGGGAATGAGGGGTCAGGG - Intronic
1167607017 19:50486881-50486903 CTGGGTGGAAGGAGGGGAGAGGG - Exonic
1167824296 19:51958181-51958203 ATGGGTGTCAGGCTGGGGGATGG - Intergenic
1167939318 19:52933506-52933528 ATGGGTGTCAGGCTGGGGGATGG + Intronic
1168296637 19:55380291-55380313 AGGGGGGAGGGGAGGGGGGAAGG - Intronic
1168299102 19:55393246-55393268 ATGGGGGTCGGGGGGGGGGGGGG - Intronic
1168322536 19:55518588-55518610 GTGGGGGAAAGGAGGGGGTCAGG - Exonic
1168328780 19:55553910-55553932 AAGGAGGGAAGGAGGAGGGAGGG - Intergenic
1168489088 19:56792657-56792679 AAGGGGGTAATGAGGAAGGAGGG + Intronic
1168602043 19:57726130-57726152 ACGGGGGTGGGGAGGTGGGAGGG - Intronic
1168615688 19:57835159-57835181 ATGGGGTTAAGGGAGGAGGAAGG + Intronic
1168621095 19:57880289-57880311 ATGGGGTTAAGGGAGGAGGAAGG - Intronic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
925171000 2:1750541-1750563 AGGGGGGGAGGGAGGGGGGGAGG - Intergenic
925171021 2:1750576-1750598 AGGGAGGGAGGGAGGGGGGAGGG - Intergenic
925171036 2:1750603-1750625 AGGGAGGGAGGGAGGGGGGAGGG - Intergenic
925171053 2:1750634-1750656 AGGGAGGGAGGGAGGGGGGAGGG - Intergenic
925234539 2:2266485-2266507 ATGGGGGTGGGGTGGGGTGAGGG + Intronic
925348848 2:3187799-3187821 AGGTGGGTGAGGAGTGGGGAGGG - Intergenic
925348883 2:3187887-3187909 AGGTGGGTGAGGAGTGGGGAGGG - Intergenic
925418401 2:3690314-3690336 AGGGGGGAGGGGAGGGGGGAGGG - Intronic
925418409 2:3690326-3690348 AGGGGGGAGGGGAGGGGGGAGGG - Intronic
925684094 2:6453317-6453339 AGGGAGGGAGGGAGGGGGGAAGG + Intergenic
925927599 2:8681696-8681718 ATGGGGGAGGGGAAGGGGGAGGG - Intronic
926104380 2:10141324-10141346 ATGGGGGTGGGGGGAGGGGATGG - Intergenic
926240480 2:11081160-11081182 AGGGAGGCATGGAGGGGGGAGGG - Intergenic
926240505 2:11081218-11081240 ATGGGGGGAGGGAGGGGGGAAGG - Intergenic
926269441 2:11354261-11354283 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
926339697 2:11894846-11894868 CTGAGGGTAAGGAGGTGGGAAGG + Intergenic
926911687 2:17857586-17857608 AGGGAGGGAGGGAGGGGGGAGGG - Intergenic
927131432 2:20063702-20063724 CTGGGGGTAAGAACTGGGGAGGG + Intergenic
927217481 2:20676165-20676187 ATGGTGGTGAGGAGGGGGTGAGG - Intergenic
927240111 2:20913854-20913876 ATGGGGTTCAGGTTGGGGGAAGG - Intergenic
927431713 2:23031826-23031848 ATGGATGGAAGGAGGGAGGAAGG - Intergenic
927612671 2:24557540-24557562 AAGGGGGAAGGGAGGGGAGAAGG - Intronic
927823017 2:26285677-26285699 CTGGGGGTGGGGAGTGGGGAGGG + Intronic
927877882 2:26670826-26670848 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
927926832 2:27019364-27019386 GTGGGGGTATGGCAGGGGGATGG + Intronic
928022537 2:27715825-27715847 AGGGGTGTGGGGAGGGGGGAGGG - Intergenic
928172903 2:29014761-29014783 ATGGGGGTCAGAAGCGGGGTGGG + Intronic
928341168 2:30444157-30444179 ATGGGGGTGGGGAACGGGGAAGG + Intergenic
928598495 2:32880293-32880315 ATGGGGTGGGGGAGGGGGGAGGG + Intergenic
928602409 2:32916150-32916172 AGGGAGGTAAGGGGGAGGGAGGG - Intergenic
928715073 2:34050887-34050909 TTGGGGGGGAGGTGGGGGGACGG + Intergenic
929137531 2:38638848-38638870 ATGGGGGTACAAAGGAGGGAGGG + Intergenic
929444475 2:41991890-41991912 AAGGGGGAAAGGAGGGAGAAGGG + Intergenic
929713858 2:44291636-44291658 CTGGGGGTAAGGTGGGGAGGAGG - Intronic
929945292 2:46366808-46366830 CTGGGGGAAATGAGCGGGGAAGG + Intronic
929949111 2:46392923-46392945 CTGGAGGTGAGGAGGGGTGAAGG + Intergenic
930081674 2:47454828-47454850 AGGGGTGGAGGGAGGGGGGAGGG - Intronic
930084025 2:47480134-47480156 ATGGGGGATGGGAAGGGGGAGGG - Intronic
930424963 2:51201626-51201648 AAGGAGGGAAGGAGGGAGGAAGG - Intergenic
930568204 2:53049660-53049682 TGGGGTGTAGGGAGGGGGGAAGG + Intergenic
930654188 2:53992034-53992056 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
930771918 2:55137861-55137883 AGGGGGGTCAGTAGGGGGAATGG - Intergenic
930842651 2:55864662-55864684 ATGAGGGTGGGGAGGGGTGAGGG + Intergenic
931348886 2:61470954-61470976 AGGGGGGGAAGGACGGGGGGAGG + Intergenic
931552523 2:63462349-63462371 ATGGGGTCGAGGAGAGGGGAGGG + Intronic
931566650 2:63622018-63622040 AGGGGAGTGGGGAGGGGGGAGGG - Intronic
931625341 2:64252039-64252061 ATGGGGGTGTGGGTGGGGGAGGG + Intergenic
931784530 2:65607498-65607520 AAGGGGATGAGGAGGGTGGAGGG + Intergenic
931857056 2:66313933-66313955 AAGGGGGTGAGGTGGGGGGAGGG - Intergenic
932071612 2:68626361-68626383 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
932411342 2:71549696-71549718 ATGGGGGTCTGGAGTGGGGCAGG + Intronic
932413568 2:71560853-71560875 AAGGGGGTGAGGTGGGGGCAGGG + Intronic
932688426 2:73892854-73892876 TTGGGGGTAGGGAAGGGGGGTGG - Intronic
932736214 2:74256469-74256491 CTGGGGGTAATGTGGGGGCATGG - Intronic
933102237 2:78274903-78274925 GTGGGGGGAGGGAGGAGGGATGG + Intergenic
933109467 2:78379157-78379179 AGGGGGGAAAGGAGGGAGGGAGG + Intergenic
933109484 2:78379188-78379210 AGGGAGGGAGGGAGGGGGGAGGG + Intergenic
933118165 2:78500125-78500147 ATGGGTGGAGGGAGCGGGGAGGG - Intergenic
933264370 2:80166502-80166524 ATGGGAGTTAGGAGGTGGCATGG - Intronic
933580454 2:84120214-84120236 ATGGGGGTGAGGAGAGGAAAGGG + Intergenic
933792077 2:85890799-85890821 ATGGGTGTAAGGTGGGGGTGAGG + Intergenic
934708981 2:96503093-96503115 CTGGGGGCAAGGAGGGGTGGAGG + Intronic
934712967 2:96527656-96527678 CTGGGGGTGGGGAGGGGGGAGGG - Intergenic
934766257 2:96881734-96881756 CAGGGGGCAGGGAGGGGGGAGGG + Intronic
935326914 2:101945920-101945942 ATGGGGGTAGGGTGGGGAGCTGG - Intergenic
935517597 2:104061497-104061519 ATGGGTGGGGGGAGGGGGGAGGG - Intergenic
935684981 2:105675160-105675182 ATGGGCGCAGGGAGGGTGGATGG - Intergenic
936014852 2:108950235-108950257 ATGGAGGGAGGGAGGGAGGAGGG - Intronic
936020739 2:108993131-108993153 GTGGGGGTAAGGGGGTGTGAGGG + Intergenic
937046602 2:118855140-118855162 CTGGGGGTAGGGATGGGGTAGGG + Intergenic
937435733 2:121879644-121879666 GTGGTGGTAAGGAGTGGGGAAGG + Intergenic
937457580 2:122055775-122055797 GTGGGGGAAAGGAGGGGGCAGGG - Intergenic
937509926 2:122583654-122583676 ATGGAGGGAGGGAGGGAGGAAGG + Intergenic
937900680 2:127016717-127016739 ATGGGGCTGCGGAGGGGAGAAGG - Intergenic
938031416 2:127997624-127997646 AGGGAGGTAAGCAGTGGGGATGG + Intronic
938093477 2:128447764-128447786 ATGGGGGCAGGAAGGGGGGCGGG + Intergenic
938218194 2:129541051-129541073 GTGGGGGGGAGGAGGGGGGAGGG + Intergenic
938539263 2:132273127-132273149 AAGGGGGTGAGGGGTGGGGACGG - Intergenic
938739844 2:134220701-134220723 AGGAGGGTGAGGAGGGGAGAAGG - Intronic
939023868 2:136989023-136989045 ATTGGGGTAAGGATGGTTGATGG + Intronic
939172213 2:138709439-138709461 CTGTGGGTAGGGAGGGGGGCAGG - Intronic
939570279 2:143832483-143832505 CTGGGGTGAAGGAGGAGGGAAGG + Intergenic
940003264 2:148987950-148987972 ATGGGGGTAGGGAGGTGGAGAGG + Intronic
940259520 2:151765735-151765757 GTTGGGGTGAGGAGGAGGGAAGG - Intergenic
940333710 2:152502873-152502895 AAGGGGGTAAGGAGAGGGTATGG + Intronic
940372909 2:152922623-152922645 ATGGAGGGAAGGAGGAAGGAAGG - Intergenic
940651324 2:156443804-156443826 AGGTGGGTAAGTAGGGGGAAGGG - Intronic
941003232 2:160222524-160222546 ATGTGGGTGAGGAAGGGGGATGG - Intronic
941038188 2:160590504-160590526 AAGGGGGAGGGGAGGGGGGAGGG - Intergenic
941100737 2:161292154-161292176 GTGGGGTGAGGGAGGGGGGAGGG + Intergenic
941339305 2:164286966-164286988 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
941475160 2:165942525-165942547 ATGGGGGTGAGGAGGAGTGGTGG - Intronic
941629249 2:167865968-167865990 ATGGGGAGGAGGATGGGGGAGGG - Intergenic
941773989 2:169371932-169371954 GTGGGGGGCAGGAGGAGGGAGGG + Intergenic
941802595 2:169676902-169676924 ATGGAGGAAAGTAGGGTGGAGGG + Intronic
941870952 2:170385112-170385134 ATGGGGGGAGGAAGGGGGCATGG + Intronic
942043864 2:172087832-172087854 ATGGGGGAAGGGAGGAAGGAGGG + Intronic
942059592 2:172215783-172215805 TTGGGGGAAAGGAGGGGCCAGGG + Intergenic
942833780 2:180267674-180267696 ATGGAGGGAAGCTGGGGGGAGGG - Intergenic
943189970 2:184663438-184663460 AGGGTGGTAGGGATGGGGGAGGG + Intronic
944026941 2:195181880-195181902 GTGGGGGTGGGGTGGGGGGAGGG - Intergenic
944131574 2:196353097-196353119 AAGGGGGTAAGGAGCGAGGCGGG - Intronic
944329592 2:198449950-198449972 ATGGGGTGGGGGAGGGGGGAGGG - Intronic
944634797 2:201665021-201665043 ATGGGGGTGATGAAGGGGGAAGG + Intronic
944866783 2:203870432-203870454 CTGGGGGTGTGGAGAGGGGAAGG + Intronic
944905320 2:204256388-204256410 ATGGAGGGAAGGAGGTAGGAGGG + Intergenic
945007477 2:205423934-205423956 ATGGAGGATAGGAGGAGGGAGGG + Intronic
945185661 2:207137078-207137100 ATGCAGGTGAGGAGAGGGGAGGG - Intronic
945225785 2:207530174-207530196 CCGGGGGGACGGAGGGGGGACGG + Intronic
945311818 2:208322837-208322859 ATGGGGTGGGGGAGGGGGGAGGG - Intronic
945564175 2:211375990-211376012 ATGAGGGAAAGGAAGGAGGATGG + Exonic
945678964 2:212889904-212889926 GTGGGGGTAGGGAGTTGGGAGGG - Intergenic
946153012 2:217788985-217789007 ATGGGGGTTTTGAGAGGGGAAGG + Intergenic
946216139 2:218185243-218185265 AGAGGGGTAATGAGGTGGGATGG - Intergenic
946246964 2:218393309-218393331 CTGGGGGGTGGGAGGGGGGAAGG - Intronic
946441535 2:219701129-219701151 AAAGGGGTAGGGAGGGAGGAAGG - Intergenic
946524646 2:220505246-220505268 AGGAGTGTAAGGAGGGAGGAAGG + Intergenic
946565841 2:220964711-220964733 ATGGAGGAAAGGAGGAGAGACGG - Intergenic
946686968 2:222280298-222280320 AGGGAGGGAAGGAGGGAGGAGGG + Intronic
946713142 2:222526442-222526464 ATGGAGGGAAGGAGGGGAGGAGG + Intronic
946785051 2:223234944-223234966 AGGGGGGAAAGGTGGGGAGAAGG - Intergenic
946853195 2:223927925-223927947 AAGGGGGAAAGGAGGGAGGCAGG + Intronic
946912833 2:224484064-224484086 ATGAGGCTAAGGTGGGAGGATGG + Intronic
947085141 2:226442758-226442780 ATGGAGGGAAGGTTGGGGGAGGG + Intergenic
947136490 2:226981216-226981238 ATGGGGTGAGGGATGGGGGAGGG + Intronic
947179431 2:227399033-227399055 AAGGAGGCAGGGAGGGGGGAGGG + Intergenic
947215914 2:227749872-227749894 AAGGAGGGAGGGAGGGGGGAGGG - Intergenic
947590228 2:231381167-231381189 ATGGGGTTCAGGATGGAGGATGG - Intergenic
947689714 2:232123497-232123519 ATGGGGGTAAGAATAGGGGAGGG - Intronic
947796437 2:232896674-232896696 GTGGGGGTAGGGATGGGGGTGGG + Intronic
948388979 2:237598574-237598596 ATGAGGGTAGGGAAGGGGGCGGG - Intronic
948806934 2:240457028-240457050 CTGGAGGTAAGGAGGGGCGGGGG + Intronic
949081528 2:242104476-242104498 ACTGGGGCGAGGAGGGGGGATGG - Intergenic
1168744113 20:221470-221492 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1168771809 20:420688-420710 ATGGGGGTGGGGCTGGGGGATGG - Intronic
1168894444 20:1313566-1313588 GTGGGGGTAGGGATGGGGAAAGG + Intronic
1168900313 20:1358307-1358329 ATGGGAAGAAGGAGGAGGGAGGG + Intronic
1168974365 20:1953096-1953118 ATGGAGGGAGGGAGGGAGGAAGG + Intergenic
1169137102 20:3203949-3203971 ATGGGGGGAAAGAGGGAGGATGG + Intronic
1169206826 20:3745322-3745344 GTGGGGCTAAGGAGAGGGGTCGG + Intronic
1169417033 20:5426000-5426022 ATGGGGGCAGGGATGGGGGTAGG + Intergenic
1169505724 20:6209214-6209236 AAGAGGGAAAGGAGGGAGGAAGG - Intergenic
1169928924 20:10811250-10811272 TTGGGGGAGAGGTGGGGGGAAGG - Intergenic
1170162237 20:13325159-13325181 AATGGGGTGAGGTGGGGGGATGG + Intergenic
1170631749 20:18072333-18072355 AGGGAGGGAAGGAGGGAGGAGGG - Intergenic
1170645238 20:18191740-18191762 CTGGGGGTGAGGTGGGGAGAGGG + Intergenic
1170690103 20:18606777-18606799 GTGGGGGGGGGGAGGGGGGAGGG + Intronic
1170705648 20:18742629-18742651 ATGGGGGACAGAAGAGGGGATGG - Intronic
1170726395 20:18931284-18931306 TTGGGGGAAAGGATGGGGGGTGG - Intergenic
1170848683 20:19984020-19984042 TTGGGTGGGAGGAGGGGGGAGGG - Intronic
1171156449 20:22878910-22878932 ATGGGGATAATGAGGGATGAAGG - Intergenic
1171208959 20:23302437-23302459 ATGGTGGTAGGGAGTGGGGGCGG - Intergenic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1171302268 20:24073747-24073769 ACGGGGGAAGGGAGGGGGGAGGG + Intergenic
1171358722 20:24571108-24571130 AAGGGGTTAAGGATGGGGAAAGG + Intronic
1171358939 20:24573009-24573031 ATGTGGGTCAGGACGGGGGCTGG - Intronic
1172022091 20:31921823-31921845 TGGGGTGGAAGGAGGGGGGAGGG + Intronic
1172090754 20:32430544-32430566 ATGGGGGTGGGGTGGGGTGAGGG - Intronic
1172407355 20:34699675-34699697 AAGGGGGCACGGAGGGGGGCAGG + Intronic
1173155281 20:40603252-40603274 ATGAGGGAAGGGAGGGAGGAGGG + Intergenic
1173180777 20:40804813-40804835 ATGGGAGTGAGGAGGGGCTAGGG - Intergenic
1173370054 20:42427163-42427185 ATGGGGGAGAAGAGGAGGGATGG - Intronic
1173374456 20:42470913-42470935 ATGGGGGTATGGAGGTGGGGTGG + Intronic
1173427901 20:42958444-42958466 GAGGAGGAAAGGAGGGGGGAGGG + Intronic
1173438833 20:43057276-43057298 AGGGGGGGAAGGGGAGGGGAGGG + Intronic
1173586654 20:44187517-44187539 ATCGGGGAAGGGAGGGGAGAGGG + Exonic
1173663286 20:44748854-44748876 ATGGGGGTGAGGAGTGGGGATGG - Intronic
1173663858 20:44751946-44751968 ATGAGGGAAAGGTGGGTGGATGG + Exonic
1173780015 20:45748030-45748052 GTGGAGGAAAGAAGGGGGGAAGG + Intronic
1173837658 20:46136345-46136367 TTGGGGGTCAGGAGGAGGAAGGG + Intergenic
1173852649 20:46228557-46228579 GTGGGGGTAAGGGTGGGGGAGGG + Intronic
1173879476 20:46400992-46401014 ATAGGGGGAAGGAGGGGAGCTGG - Intronic
1173911776 20:46675871-46675893 AGGGTGGTCAGGAGGGGGAACGG + Intronic
1173912611 20:46681440-46681462 AAGAGGGGAAGGAGGGAGGAGGG + Intronic
1174264701 20:49322977-49322999 ATGGGGGAAAGGAGGCTGGGAGG + Intergenic
1174267321 20:49341154-49341176 AGGGAGGGAGGGAGGGGGGAGGG - Intergenic
1174404581 20:50294965-50294987 ATGGGGGGCAGGAGGGCGGAGGG + Intergenic
1174513742 20:51075460-51075482 ATGGGGGAAATGGGGTGGGAGGG - Intergenic
1174582906 20:51585286-51585308 TTGGGGGTTGGGAGTGGGGAGGG - Intergenic
1174692038 20:52515967-52515989 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1174797399 20:53533737-53533759 AAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1174924510 20:54742779-54742801 GTGGGGGTAGGGGGTGGGGAGGG + Intergenic
1174960520 20:55151765-55151787 AGGAGGGGAGGGAGGGGGGAGGG - Intergenic
1175062294 20:56254637-56254659 ATGAGGGGAAGGAGAGGAGAAGG + Intergenic
1175139817 20:56852622-56852644 GTGGGGGTAAGGTGGAGGTAGGG + Intergenic
1175259912 20:57667801-57667823 GTGGGGGTAGGTAGGGGAGAGGG - Intronic
1175388509 20:58612146-58612168 AAGGGGGGAAGGAGGGAGGGAGG - Intergenic
1175392456 20:58635933-58635955 AGGGAGGGAGGGAGGGGGGAAGG + Intergenic
1175499862 20:59442102-59442124 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1175651169 20:60724523-60724545 ATGGAGGGAAGGAAGGGGGAAGG + Intergenic
1175676410 20:60949895-60949917 ATGGAGGTAGGGAGGGAGGGAGG + Intergenic
1175692572 20:61076164-61076186 ATGGGGCTAGGCAGGGGGGCTGG - Intergenic
1175984040 20:62755375-62755397 ATGGAGGGAGGGAGGGTGGATGG - Intronic
1175984203 20:62755849-62755871 ATGGGTGGAGGGAGGGAGGATGG - Intronic
1177084210 21:16681828-16681850 AAGGGGCTAAGGATGGGGAAAGG - Intergenic
1177175030 21:17693923-17693945 ATGTGGGGAAGGATGGGAGAAGG + Intergenic
1178123980 21:29497941-29497963 GCTGGGGTAAGGAGTGGGGATGG - Intronic
1178220493 21:30652200-30652222 GTGGGGGGAGGGAGGAGGGATGG + Intergenic
1178532947 21:33390256-33390278 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1178737492 21:35166288-35166310 AGGGAGGGAAGGAAGGGGGAAGG + Intronic
1179116703 21:38499832-38499854 ATGGGAGGAAGGAGGGAGGAAGG + Intronic
1179232299 21:39515776-39515798 ATGATGGTAAGGAGGGATGATGG + Intergenic
1179352136 21:40621901-40621923 AGGGAGGGAGGGAGGGGGGAGGG + Intronic
1179486820 21:41715855-41715877 CTGGGGGTAGGGAGTGGGGCAGG + Intergenic
1179495579 21:41769415-41769437 ATGGGGGGTGGGAGGTGGGAAGG + Intergenic
1179795343 21:43779288-43779310 AGGGAGGGAGGGAGGGGGGAGGG - Intergenic
1179832439 21:44005832-44005854 TGTGGGGTAAGGAGGGAGGAGGG - Intergenic
1179879165 21:44286323-44286345 TTGGGGGTGAGGTGTGGGGACGG - Intronic
1179987589 21:44930192-44930214 ACAGGGGGAGGGAGGGGGGAGGG - Intronic
1180049400 21:45324434-45324456 GAGGGGGTAAGGTGGGGTGAAGG + Intergenic
1180513619 22:16118586-16118608 ATGGGTGTTAGGCTGGGGGATGG - Intergenic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180794198 22:18593999-18594021 AGGAGGGGAACGAGGGGGGATGG - Intergenic
1180796079 22:18606414-18606436 ATGGTGGTGAGGAGGGGTGCTGG + Exonic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181006298 22:20015270-20015292 ATGGGGGTAGGGTGGGGACAGGG + Intronic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181225643 22:21388857-21388879 ATGGTGGTGAGGAGGGGTGCTGG - Exonic
1181252991 22:21545956-21545978 ATGGTGGTGAGGAGGGGTGCTGG + Exonic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181444985 22:22963436-22963458 ATGGGGGTGGGAAGGGGAGAGGG - Intergenic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181969477 22:26679478-26679500 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1182050694 22:27310582-27310604 AGGGAGGGAAGGAGGGGGGAGGG + Intergenic
1182050704 22:27310601-27310623 AGGGAGGGAAGGAGGGGGGAGGG + Intergenic
1182050714 22:27310620-27310642 AGGGAGGGAAGGAGGGGGGAGGG + Intergenic
1182076946 22:27501387-27501409 TTGGGGGTAGGGAGGTGGGTGGG - Intergenic
1182300913 22:29336426-29336448 ATGCTGGAAAGGAGAGGGGAGGG - Intronic
1182424957 22:30266919-30266941 GTGGGGATGGGGAGGGGGGAGGG + Intergenic
1182485205 22:30635198-30635220 CTGGGGCTACGGAGGGGCGATGG + Intergenic
1182513678 22:30838977-30838999 AGGGGGGAAGGGTGGGGGGAGGG - Intronic
1182709184 22:32310047-32310069 AGCGGGGTGGGGAGGGGGGAGGG + Intergenic
1182741645 22:32572266-32572288 AGGGAGGGAGGGAGGGGGGAAGG - Intronic
1182865465 22:33600580-33600602 ATGGGGGAAAGGAAGGAGGTTGG + Intronic
1182927055 22:34134798-34134820 ATTGGGGTCAGCAGTGGGGATGG + Intergenic
1182931455 22:34178252-34178274 AGGGGGATAAGGAGGAGGAAGGG - Intergenic
1183042623 22:35193614-35193636 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1183085827 22:35486405-35486427 GTGGAGGTAAGGAGGGGAGAGGG - Intergenic
1183093335 22:35538444-35538466 AAGTGGGTGGGGAGGGGGGAAGG + Intergenic
1183291084 22:37002388-37002410 ATGGGGGTGAGGAGGGGAAACGG + Intronic
1183339362 22:37271072-37271094 ATGGGGGTGAGGAGGGTAGAGGG + Intergenic
1183361327 22:37384733-37384755 ATTGGGGTCAGGTGGGGAGAGGG - Intronic
1183371008 22:37432405-37432427 GTGGGGGGAAGGAGGTGGTAGGG - Intergenic
1183381247 22:37491592-37491614 AGGGGGAGAAGGAGGGGGGAGGG + Intronic
1183481718 22:38068959-38068981 ATGGAGGTAAGGCTGGGGGCAGG + Intronic
1183590349 22:38776197-38776219 ATGGGGGTGGGGAGAGAGGACGG - Intronic
1183698795 22:39438154-39438176 ATGGAGGGAAGGAGGAAGGAAGG - Intergenic
1183720673 22:39559839-39559861 ATGGGGGCAAGGGGAGGGGAGGG - Intergenic
1184084949 22:42255749-42255771 GTGGTGGGAAGGAGAGGGGAGGG - Intronic
1184116341 22:42424857-42424879 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
1184210862 22:43034906-43034928 AGGGGGGAGGGGAGGGGGGAGGG + Intergenic
1184533432 22:45071079-45071101 ATGGGGCCCAGGAGGTGGGAAGG - Intergenic
1184642427 22:45879582-45879604 AGGGAGGGAGGGAGGGGGGAAGG - Intergenic
1184657715 22:45950187-45950209 TTGGGGGTGAGGAGGGGCGCTGG - Intronic
1184852342 22:47128055-47128077 ATGGGTGAGGGGAGGGGGGATGG - Intronic
1184873734 22:47258933-47258955 ATGGGGGTGAGCAGGGAGGCAGG + Intergenic
1184889227 22:47369282-47369304 ATGGGGGACAGGAGGGTTGACGG + Intergenic
1184942261 22:47777629-47777651 ATGGGGGTGAGGAGAGGGGTTGG + Intergenic
1185037008 22:48484693-48484715 AAGGAGGGAGGGAGGGGGGAGGG - Intergenic
1185079812 22:48703494-48703516 GTGGGGCTGAGGATGGGGGAGGG - Intronic
1185149048 22:49153921-49153943 GTGTGGGTAAGGTGGGAGGAGGG + Intergenic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
949514921 3:4798920-4798942 CTGGGGGTAGGGATGGGGCAAGG + Intronic
949903745 3:8840973-8840995 GTGGGAGTAAGCAGGGGGCAAGG + Intronic
950149623 3:10676495-10676517 ATGGGGATGGGGAGGGAGGAGGG + Intronic
950214911 3:11152627-11152649 AGGGGGGGATGGAGGTGGGAGGG - Intronic
950263401 3:11558451-11558473 ATGGGGGTGGGGTGGGGGGAAGG - Intronic
950308311 3:11934057-11934079 AGGGGGCTAAGGCGGGAGGATGG - Intergenic
950358667 3:12434420-12434442 ATGGAGGGAGGGAGGGGAGAAGG - Intergenic
950472618 3:13195838-13195860 ATGTGGATAAGATGGGGGGATGG + Intergenic
950598709 3:14011292-14011314 TTGGGGGAAAAGAGGGGGAAAGG - Intronic
950726904 3:14922580-14922602 ATGGGGGTGGGGTGGGGGAAGGG + Intronic
950826661 3:15830570-15830592 ATGGGGGTGCGGTGGGGGGTGGG - Intronic
950882766 3:16336366-16336388 ATGGAGGTGAGGTGGAGGGAGGG + Intronic
951026620 3:17837873-17837895 ATGTGGGTAAAGAGGGCTGAAGG + Intronic
951279685 3:20732408-20732430 CTGGGGGGATGGAGGAGGGATGG + Intergenic
951368858 3:21818180-21818202 ATGGGGGTGGGGATGGGGGAGGG + Intronic
951578215 3:24134847-24134869 ATGGGGGTAGGAAAGGGGGATGG + Intronic
951728999 3:25790168-25790190 AAGGAGGAAAGGAGGGGCGAAGG - Intronic
952469051 3:33625191-33625213 ATGGGGTGGGGGAGGGGGGAGGG + Intronic
952603226 3:35109772-35109794 GTGGGGAAGAGGAGGGGGGAGGG + Intergenic
952767560 3:36968150-36968172 ATGGGGTAGGGGAGGGGGGAGGG - Intergenic
952925137 3:38314943-38314965 ATGGGAGTAAGGCCGGGGCAGGG + Intronic
953098850 3:39806648-39806670 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
953347840 3:42190792-42190814 ATGGAGGGAGGGAGGGAGGAAGG - Intronic
953357423 3:42266629-42266651 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
953357457 3:42266739-42266761 ACGGAGGGAGGGAGGGGGGAAGG - Intergenic
953550158 3:43895848-43895870 ATGGAGGTGAGGAAGGGGGCTGG - Intergenic
953550621 3:43899618-43899640 AAGGGGGAGAGGAGAGGGGATGG - Intergenic
953904375 3:46861148-46861170 AGGGGGGCAAGGAGGCAGGAGGG - Intronic
953974895 3:47375149-47375171 ATGGGGCTAGTGAGGAGGGAAGG - Intergenic
954228676 3:49199604-49199626 GTTGGGGAAAGGCGGGGGGAGGG + Intronic
954583270 3:51715046-51715068 AAGGGGGCTAGGATGGGGGAGGG - Exonic
954750347 3:52810056-52810078 CTGGGGGTGGGGAGGGGGTAAGG + Intergenic
954756900 3:52845570-52845592 CTTGGGGCAAGGAGGTGGGAGGG + Intronic
955188951 3:56742201-56742223 ATAGTGGTGAGGTGGGGGGAAGG + Intronic
955231890 3:57106888-57106910 TTGGGGGTAAGGTGGAGGCAGGG - Intronic
955389790 3:58513118-58513140 CTGGGGGTCAGTAGGGAGGAGGG - Intronic
955733946 3:62017019-62017041 ACGGGGGTGAGGGAGGGGGAGGG - Intronic
956373826 3:68592675-68592697 CAGGGAGTAAGGTGGGGGGAGGG - Intergenic
956508642 3:69970984-69971006 ATGGGGGTTTGGAGGTGGGCTGG + Intergenic
956812895 3:72881628-72881650 ATGGTGGTAAGGTGTCGGGAGGG + Intergenic
956916870 3:73880943-73880965 ATGGGGGCAGGGATGTGGGAGGG + Intergenic
957045960 3:75374744-75374766 ACGGGGGTCGGGTGGGGGGACGG + Intergenic
957086046 3:75678138-75678160 AGGGGGGGAAGGTGGGAGGAGGG - Intergenic
957228003 3:77473917-77473939 ATGGGGGTTTGGAGGAAGGAAGG - Intronic
957245615 3:77712263-77712285 ATGAGGGGAAAGAGGAGGGAAGG - Intergenic
957507160 3:81136818-81136840 GTGGGGGTGAGGGGGTGGGAGGG - Intergenic
957723140 3:84031064-84031086 AAGTGGGTCAGGATGGGGGAGGG + Intergenic
957979871 3:87494716-87494738 ATGGGGGAAGGGAGGGAAGAAGG + Intergenic
958991697 3:100853721-100853743 ATGGGAATAACGAGGGGAGATGG - Intronic
959105831 3:102063539-102063561 ATGGAGGCAAGGAAGAGGGAAGG - Intergenic
959428660 3:106224192-106224214 AGGGTGGTAGGGTGGGGGGATGG + Intergenic
959543854 3:107571123-107571145 AAGGGGGAATGGAGGGTGGAAGG + Intronic
959617450 3:108364130-108364152 ATGAGGGTAAAGGGGAGGGAGGG - Intronic
960075357 3:113477790-113477812 ATGGGGGGAGGGGGGAGGGATGG + Intronic
960293893 3:115919122-115919144 GTGGGGGTGAGGAGTGGGGAGGG - Intronic
960561409 3:119087617-119087639 TTGGGGGAAAGGGTGGGGGATGG + Intronic
960619012 3:119621431-119621453 ATATGGGTAGGGAGGGGGTAGGG + Intronic
960733793 3:120755749-120755771 ATGGTAGTAGGGATGGGGGATGG - Intronic
961003408 3:123389020-123389042 ATGGAAGGAAGGAGGGAGGAAGG + Intronic
961037481 3:123652709-123652731 ATTAGGGTAAGGAGCAGGGATGG + Intronic
961149819 3:124628308-124628330 AGGGAAGGAAGGAGGGGGGAGGG - Intronic
961287823 3:125820650-125820672 CTGGGGGAAAGGGGAGGGGATGG + Intergenic
961481116 3:127181505-127181527 GTAGGGGTAGGGAGGTGGGAGGG + Intergenic
961569041 3:127785185-127785207 GTGTGGGGAAGGAGGGGGGAAGG - Intronic
961603675 3:128078191-128078213 ATGGGGGTACAGAAGGGGGCTGG - Intronic
961611706 3:128144829-128144851 ATGGGGGGAAGGAGGGACCAGGG - Intronic
961636688 3:128337434-128337456 ATGGGGAGGAGGAGGGGGAAGGG + Intronic
961899247 3:130195343-130195365 CTGGGGGAAAGGGGAGGGGATGG - Intergenic
962077211 3:132095129-132095151 AAGGGGGAAAGGAGAGGTGATGG + Intronic
962573677 3:136736277-136736299 CTAGGGGCAAGGAGAGGGGAAGG + Intronic
962847825 3:139286880-139286902 ATGGGCGGAGGGAAGGGGGAAGG - Intronic
963425067 3:145114211-145114233 ATGGAGGAATGGAGGGTGGAAGG - Intergenic
963436368 3:145272659-145272681 AAGGAGGTGGGGAGGGGGGAGGG - Intergenic
963456814 3:145555622-145555644 ATGGAGGAATGGAGGGTGGAAGG + Intergenic
963599004 3:147361131-147361153 AAAGGAGGAAGGAGGGGGGAGGG - Intergenic
963851648 3:150215974-150215996 GAGGGGGAAAGGAGGGAGGATGG + Intergenic
964573991 3:158144275-158144297 AGGGGTGGGAGGAGGGGGGAGGG - Intronic
964942665 3:162178301-162178323 CTGGGGGAAAGTAGGGTGGAGGG + Intergenic
965045894 3:163576546-163576568 AGGGAGGGAGGGAGGGGGGAGGG - Intergenic
965171121 3:165265691-165265713 AGGGGTGAAGGGAGGGGGGAGGG - Intergenic
965211634 3:165797288-165797310 AGGGGGGGAGGGAGGGAGGAAGG - Intronic
965520201 3:169662946-169662968 CTGGGGGGAAGGGGAGGGGAGGG + Intronic
965692671 3:171374215-171374237 ATTGGGGTAAGGAGGATAGAGGG - Intronic
965700886 3:171458913-171458935 AAGGGGGTGAGGGGTGGGGATGG - Intronic
965925729 3:173977319-173977341 ATGGGAGTGGGGATGGGGGAAGG + Intronic
965960421 3:174422723-174422745 TTGGGGCTGAGGAGGGAGGAAGG + Intergenic
966154516 3:176901574-176901596 ATGTAGGTAAGAAGGGGAGAAGG + Intergenic
966398596 3:179525390-179525412 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
966461506 3:180181717-180181739 AGGGAGGGAAGGAGGGAGGATGG - Intergenic
966923390 3:184629159-184629181 CTGGGTGTAAGGAGGAGGGCAGG - Intronic
967217075 3:187219954-187219976 ATAGGCCGAAGGAGGGGGGATGG + Intronic
967280447 3:187817403-187817425 AGAGGGGAAAGGAGGGGGGAAGG - Intergenic
967748471 3:193086457-193086479 ATGGGGTGGGGGAGGGGGGAGGG - Intergenic
967899980 3:194440054-194440076 ATGTGGGTAGGGAGGGAGGGAGG + Intronic
968025855 3:195442406-195442428 AGGGGCGGAAGGAAGGGGGAAGG + Intronic
968088820 3:195886944-195886966 AGGTGGGTGAGGAGGTGGGAGGG - Intronic
968150570 3:196334838-196334860 GTGGGGGTTAGGAGAAGGGAGGG + Intronic
968150594 3:196334908-196334930 GTGGGGGTTAGGAGAAGGGAGGG + Intronic
968150618 3:196334978-196335000 GTGGGGGTTAGGAGAAGGGAGGG + Intronic
968150642 3:196335049-196335071 GTGGGGGTTAGGAGAAGGGAGGG + Intronic
968208822 3:196829292-196829314 AAGGGGGAAAGGAGGGAAGAAGG - Exonic
968266256 3:197365805-197365827 ATGGGGGTAGGAAGGGGAGTCGG - Intergenic
968315005 3:197716772-197716794 ATGGTCATAAGGAGGGGGGTAGG + Intronic
968373718 4:19429-19451 ATGGGTGTCAGGCTGGGGGATGG - Intergenic
968375201 4:34376-34398 ATGGGGGGAGGGTGGGAGGAGGG - Intergenic
968396272 4:241595-241617 ATGGGTGTCAGGCTGGGGGATGG - Intergenic
968479551 4:827138-827160 GTGGGGGTGGGGAGGGGGGAGGG + Intergenic
968479578 4:827250-827272 ATGGGGCTGAGGGCGGGGGAGGG - Intergenic
968650287 4:1757714-1757736 GTGGGGGTTGGGTGGGGGGATGG - Intergenic
968887234 4:3341366-3341388 ATGGGGGTACGGGGGGAGGGAGG + Intronic
968930002 4:3573693-3573715 AGGGGTGTGAGGTGGGGGGAGGG + Intergenic
969150817 4:5167180-5167202 TTGGGGGCAAGGTGGGAGGATGG - Intronic
969260458 4:6030240-6030262 ATGGGGGGAGGGAGGGAGAAGGG + Intronic
969492542 4:7508218-7508240 AAGGGGGTGAGGAGGGATGAAGG + Intronic
969495313 4:7523037-7523059 AGGGGAGGAAGGAGGGAGGAGGG - Intronic
969504291 4:7574598-7574620 AGGGAGGCAAGGAGGGAGGAAGG + Intronic
969512836 4:7629470-7629492 GTGGGAGTCAGGAGGTGGGAAGG + Intronic
969543348 4:7807868-7807890 ATGGTGGTCAGGAGGAGGGATGG - Intronic
969607837 4:8211302-8211324 AGGGGGAGAAGGAGGGAGGAGGG - Intronic
969654256 4:8487293-8487315 ATGGAGGAATGGAGGGTGGAAGG + Intronic
969823703 4:9740216-9740238 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
969847400 4:9930133-9930155 AAGGGAGGAAGGAGAGGGGAGGG - Intronic
970123806 4:12787147-12787169 CAGAGGGTAAGGAGGGAGGATGG - Intergenic
970502330 4:16690504-16690526 AGGGAGGGAGGGAGGGGGGAGGG + Intronic
970715447 4:18916720-18916742 AAGGGGGTTAGGGGTGGGGAAGG - Intergenic
970793629 4:19888601-19888623 AGGGGCGTAAGGTGGTGGGATGG - Intergenic
970906882 4:21226228-21226250 ATAGGGGGAGGGAGGGGGGGAGG + Intronic
971218087 4:24680559-24680581 AAGGAGGAAAGGAGGGAGGAGGG + Intergenic
971448561 4:26778450-26778472 AAGGGGGAAGGGAAGGGGGAAGG + Intergenic
971470312 4:27018026-27018048 TTGGGGGTAAGGTGTGAGGAGGG + Intronic
971727746 4:30335615-30335637 AGGGGGGAGTGGAGGGGGGAGGG + Intergenic
971843168 4:31881023-31881045 AGGGAGGGAAGGAGGAGGGAAGG - Intergenic
971932374 4:33101778-33101800 ATGGAGGGAGGGAGGGAGGAAGG - Intergenic
972147324 4:36043842-36043864 AGGGGGGAGGGGAGGGGGGAGGG + Intronic
972607845 4:40630354-40630376 ATGGGGGGAAGAAGGGGAGCGGG - Intronic
972987413 4:44781049-44781071 ATGGGGGAACAGAGAGGGGAAGG - Intergenic
973575960 4:52289595-52289617 ATGGGTGCAAGCAGGGTGGAAGG - Intergenic
973633449 4:52840773-52840795 ATGAAGGAAAGGAAGGGGGAAGG - Intergenic
973750975 4:54021058-54021080 AAGGGGGAATGGAGGGTGGAAGG - Intronic
974330229 4:60468268-60468290 TGGGGTGGAAGGAGGGGGGAGGG + Intergenic
974331133 4:60480688-60480710 TTGTGGGGGAGGAGGGGGGAGGG - Intergenic
974345323 4:60672924-60672946 AAGGAGGGAGGGAGGGGGGAGGG + Intergenic
974377543 4:61097730-61097752 TTGGGTGGAGGGAGGGGGGAGGG - Intergenic
974379846 4:61125123-61125145 ATGGTGGTGAGTAGTGGGGATGG + Intergenic
974631986 4:64504187-64504209 ATAGTGGTAAGGTTGGGGGAAGG - Intergenic
974715801 4:65668727-65668749 TTGGGGGTAGGGAGGGGGACTGG + Intronic
974833385 4:67216412-67216434 AGGGGGGGAAGGGAGGGGGAGGG + Intergenic
974890354 4:67874579-67874601 ATGGGAGTGAGGAGGTGAGAAGG + Intronic
974903630 4:68031862-68031884 ATGGAGGAATGGAGGGTGGAAGG - Intergenic
974958601 4:68673176-68673198 ACGGGTGTAAGGTGGCGGGATGG - Intergenic
975151923 4:71032458-71032480 AAGGGGGAATGGAGGGCGGAAGG - Intergenic
975170925 4:71231096-71231118 ATGGGAGAAGGGAGGTGGGAGGG + Intronic
975372851 4:73608037-73608059 AAGGGGGAGAGGAGAGGGGAGGG - Intronic
975442383 4:74426521-74426543 TTGGGGGCAAGGATTGGGGAAGG - Intergenic
975786966 4:77900990-77901012 TAGGGGGTAAGGGAGGGGGAAGG + Intronic
976313355 4:83634372-83634394 AATGGGGGAAGTAGGGGGGAGGG - Intergenic
976476684 4:85492083-85492105 AGGGAGGGAAGGAGGGAGGAGGG - Intronic
976652153 4:87447554-87447576 ATGGAGGTGAGGAAGGGGAAGGG + Intronic
977202809 4:94136756-94136778 AGGGGGGGAGGGAGGAGGGAGGG + Intergenic
977290563 4:95160602-95160624 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
977488230 4:97676584-97676606 AGGGAGGGAGGGAGGGGGGATGG + Intronic
977589101 4:98806897-98806919 AGGGGTGTGGGGAGGGGGGAGGG + Intergenic
977676709 4:99756362-99756384 ATGGGGGTGGTGACGGGGGAGGG - Intergenic
978072716 4:104491870-104491892 AAGGGGGAAAGGTGGGGGGGAGG + Exonic
978588705 4:110300883-110300905 ACCAGGGTAAGGAGGTGGGAGGG + Intergenic
979506456 4:121502741-121502763 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
979506466 4:121502765-121502787 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
979563317 4:122124602-122124624 AGGGAGGTATGGAGGGTGGAGGG - Intergenic
979698513 4:123640848-123640870 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
979994319 4:127412156-127412178 AAGGAGGGAAGGAGGGAGGAAGG + Intergenic
979994356 4:127412550-127412572 AGGTGGGGAAGGAGGGAGGAGGG + Intergenic
980145133 4:128973423-128973445 GTGGGGGGAGGGAGAGGGGAGGG + Intronic
980807148 4:137828332-137828354 AAGGAGGGAAGGAGGGAGGAAGG + Intergenic
980940339 4:139268120-139268142 AAGGGGGAAAGGAAGGGGGAAGG + Intronic
981044637 4:140253466-140253488 GTGGGGATAAGGAGGAAGGAGGG + Intergenic
981482867 4:145256000-145256022 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
981587705 4:146322361-146322383 ATGGGGTGGGGGAGGGGGGAGGG - Intronic
981728578 4:147873533-147873555 ATGGGGATAAGGGTGGGGGATGG + Intronic
981980017 4:150780808-150780830 AAGGGGGTGAGGGGGGGGAATGG + Intronic
982318651 4:154057511-154057533 ATGGAGGAATGGAGGGCGGAAGG - Intergenic
982558628 4:156900886-156900908 AAGGAGGGAAGGAGGGAGGAAGG + Intronic
982593620 4:157349436-157349458 AGCGGGGGAAGGAGGGAGGAAGG - Intronic
982816489 4:159891937-159891959 AAGGGGGGAAGGAGGGAGGGAGG - Intergenic
982889111 4:160824061-160824083 ATGGGGTGGGGGAGGGGGGAGGG + Intergenic
982967338 4:161929107-161929129 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
983503146 4:168523264-168523286 AAGGGAGGAAGGAGGGGGGAGGG + Intronic
983565570 4:169147471-169147493 ATGGGGGCAGGGTGGGGGAATGG + Intronic
983649050 4:170020616-170020638 ATGGGAGGAGGGAGGGGGGAGGG - Intronic
983963152 4:173778540-173778562 ATGGGGGTCAGGAGGTGCAATGG - Intergenic
984256231 4:177392984-177393006 ATGGGTGGAAGGAGGAGAGATGG - Intergenic
984368279 4:178827444-178827466 TTGGGGGTGGGGTGGGGGGAGGG - Intergenic
984461387 4:180041188-180041210 ATGGGGGTGGGGTGGGGGGTGGG + Intergenic
984784284 4:183553787-183553809 ATGAGGGTAAGCATGGGTGAGGG + Intergenic
984847640 4:184121177-184121199 ATAGGGAAAAGGAGGAGGGAAGG - Intronic
984952404 4:185017244-185017266 ATCGGGGGGAGGAGGAGGGAGGG - Intergenic
985168817 4:187126736-187126758 AGGGGGGAAAGAAGGGAGGAAGG - Intergenic
985250891 4:188023367-188023389 AGCTGGGTGAGGAGGGGGGATGG + Intergenic
985273384 4:188216117-188216139 AGGGGGGAAGGAAGGGGGGAAGG - Intergenic
985336964 4:188906145-188906167 AAGGAGGAAAGGAAGGGGGAAGG - Intergenic
985441427 4:189984615-189984637 ATGGGGGTGCGGATGGGGGTGGG - Intergenic
985459842 4:190094668-190094690 ATGGGGGGAGGGTGGGAGGAGGG + Intergenic
985461669 4:190113122-190113144 ATGGGTGTCAGGCTGGGGGATGG + Intergenic
985805371 5:2039143-2039165 CTGGGGGGATGGAGGGGGGCTGG + Intergenic
986167091 5:5283462-5283484 CTGGGGGGGAGGTGGGGGGAGGG - Intronic
986301493 5:6481673-6481695 ATGTGGGCAAGGCTGGGGGAAGG - Intronic
986420473 5:7576116-7576138 ATGGGGGCTGGGAGGAGGGAAGG - Intronic
986490746 5:8286981-8287003 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
986800626 5:11256664-11256686 ATGGGGTTAAGGAGGAGCTATGG - Intronic
986865097 5:11976837-11976859 AAGGGGGACAGGAGGAGGGAAGG - Intergenic
986867412 5:12006420-12006442 AGGGAGGGAGGGAGGGGGGAGGG - Intergenic
987047755 5:14123562-14123584 TGGGGGGAAAGGAGTGGGGAAGG + Intergenic
987067994 5:14308503-14308525 ATGGAGGTTGGGAGGGTGGATGG - Intronic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987346996 5:16987841-16987863 TTATGGCTAAGGAGGGGGGAAGG - Intergenic
987361512 5:17111533-17111555 AGGGAGGGAAGGAGGGGGGAGGG - Intronic
987606316 5:20140317-20140339 ATGGGGTTGGGGAGGGGGAAGGG + Intronic
987774145 5:22342559-22342581 ATGGAGGGAGGGAGGGAGGAAGG - Intronic
988264091 5:28927971-28927993 ATGGGTGTGAGGCGGGAGGACGG + Intergenic
988388663 5:30599051-30599073 GTGGGGGGAGGGAGGAGGGATGG - Intergenic
988434218 5:31154586-31154608 ATGGGGGCAGGAAGGGGGGGGGG - Intergenic
988507334 5:31834738-31834760 GTGGGGGGAAGGGGGAGGGATGG + Intronic
988623636 5:32848437-32848459 AAGGGGGGAAGGAGGGAGGGAGG - Intergenic
988726596 5:33932536-33932558 ATGGGGGTGAGGTGGGGGTAAGG - Intergenic
988913071 5:35865101-35865123 ATAGGTGGAAGGAGGGGGGAGGG - Intronic
988999509 5:36745496-36745518 ATGGGGGAAGGGAGAGGGGCCGG + Intergenic
989077197 5:37576121-37576143 GAGGGGGGAAGGAGGGCGGAGGG - Intronic
989077202 5:37576132-37576154 AGGGAGGGAGGGAGGGGGGAAGG - Intronic
989248654 5:39282065-39282087 AGGGGGGGAGGGAGGGAGGAAGG - Intergenic
989440036 5:41459897-41459919 ATTGGGCTAAGGAGAGGGAAAGG + Intronic
989560466 5:42844450-42844472 TTGGGTGGAGGGAGGGGGGAAGG - Intronic
989585983 5:43074204-43074226 AGGGGCGTAAGGTGGTGGGATGG + Intronic
989690354 5:44136168-44136190 GTGGGGTGGAGGAGGGGGGAGGG - Intergenic
989824069 5:45832984-45833006 GTGGGGGGGAGGATGGGGGAGGG - Intergenic
989969917 5:50511299-50511321 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
990005939 5:50944613-50944635 ATGGGGGTGGGTAGGTGGGAGGG + Intergenic
990184859 5:53201763-53201785 AGGGGTGTAAGGTGGCGGGACGG - Intergenic
990637343 5:57743648-57743670 CTGGTGGTAAGTAGGGGGTAAGG + Intergenic
990762312 5:59143157-59143179 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
990976801 5:61568006-61568028 AAGGGGGGAGGGAGGGAGGAAGG - Intergenic
991166951 5:63574720-63574742 ATGGGGGTGGGGTGGGGGGAAGG - Intergenic
991518927 5:67472496-67472518 AGGGAGGGAAGGAGGGTGGAAGG - Intergenic
992022382 5:72637197-72637219 AAGGGAGAAAGGAGAGGGGAGGG + Intergenic
992106560 5:73452934-73452956 ATTGGGGAAGTGAGGGGGGACGG + Intergenic
992465324 5:76998631-76998653 AGGGAGGGAAGGAGAGGGGAAGG + Intergenic
992489055 5:77223375-77223397 ATGGGTGGGGGGAGGGGGGAGGG - Intronic
992605100 5:78447928-78447950 AGAGGGGGAAGGAGGGAGGAAGG - Intronic
992605157 5:78448066-78448088 GAGGGGGAAAGGAGGAGGGAGGG - Intronic
992605524 5:78452325-78452347 GTGGGGGGAGGGAGGGGGGAGGG - Intronic
992756181 5:79908289-79908311 ATGGGGTGGAGGAAGGGGGAAGG + Intergenic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993204592 5:84863356-84863378 AGGGAGGGATGGAGGGGGGAGGG - Intergenic
993281252 5:85927643-85927665 ATGAAGGTAAGGAGGGAGGGAGG - Intergenic
993302918 5:86235595-86235617 ATGAGGAAAAGGATGGGGGAAGG + Intergenic
993462430 5:88200173-88200195 ATGGAGGTAAGAAATGGGGATGG + Intronic
993521234 5:88904264-88904286 TAGGGGGTCGGGAGGGGGGAGGG - Intergenic
993901057 5:93584618-93584640 CGGGGGGTGGGGAGGGGGGAAGG + Exonic
994228342 5:97281776-97281798 ATGGGGGCAGGGGGGTGGGAGGG - Intergenic
994294814 5:98078178-98078200 ATGGGGTTGAAGAGGAGGGAGGG + Intergenic
994305522 5:98199269-98199291 ATGGGGGCAGGGTGGGGGGCAGG + Intergenic
994414624 5:99454079-99454101 GTGGGGTGGAGGAGGGGGGAGGG - Intergenic
994559828 5:101353541-101353563 AAAGGGGGAAGGTGGGGGGAGGG + Intergenic
994576861 5:101589309-101589331 GTTGGGGTGGGGAGGGGGGAGGG + Intergenic
994868125 5:105305537-105305559 ATAGGGATAGGGAGGGAGGAGGG - Intergenic
994918983 5:106017693-106017715 AAGGAGGGAAGGAGGGAGGAAGG - Intergenic
995327548 5:110908086-110908108 ATGGGGTAGGGGAGGGGGGAGGG + Intergenic
995426213 5:112026489-112026511 GTGGGGTGAGGGAGGGGGGAGGG - Intergenic
995769231 5:115651758-115651780 ATGGGGGAATGGAGGGCGGAAGG - Intergenic
995991590 5:118246645-118246667 TGGGGTGGAAGGAGGGGGGAGGG - Intergenic
996032456 5:118721226-118721248 TTGGGGGGAAGGAGGGAGGGGGG + Intergenic
996069379 5:119117511-119117533 ATGGGTGTGAGGATGGGGAAAGG + Intronic
996185183 5:120465209-120465231 TTGGGGCTAAGGAGGGGGTCTGG + Intronic
996527902 5:124498288-124498310 ATGGAGGAATGGAGGGTGGAAGG - Intergenic
996547363 5:124694712-124694734 ATGGGGTGGGGGAGGGGGGAGGG - Intronic
996777328 5:127146654-127146676 ATGGGTGGGGGGAGGGGGGAGGG + Intergenic
997017045 5:129948323-129948345 ATAGGTGGAAGGAGGGGTGAGGG - Intronic
997112775 5:131093155-131093177 AGGGGTGTGGGGAGGGGGGAGGG + Intergenic
997254832 5:132420414-132420436 ATAGGGGTGAGAAGAGGGGAGGG - Intronic
997385105 5:133466130-133466152 ATATGGGAAAGGAGGGGGCAGGG + Intronic
997469333 5:134108223-134108245 GTGGGGGTTGGGAGTGGGGACGG - Intergenic
997646996 5:135488383-135488405 ATGGGGGTGAGGTGTGAGGAAGG + Intergenic
997680784 5:135749354-135749376 ATGGGGGTTTGGCTGGGGGAGGG - Intergenic
997782619 5:136675320-136675342 ATGGAGGTCAGGAGGGGGATTGG + Intergenic
997920625 5:137975918-137975940 ATGGGGGACGGGAGTGGGGAAGG + Intronic
998142064 5:139705656-139705678 CTGGGGGGAAAGAGAGGGGAGGG - Intergenic
998198832 5:140101249-140101271 GTGGGGGAAAGGAGAGGAGAAGG + Intergenic
998258161 5:140606075-140606097 AGGGGGGGAAGGGGGAGGGAGGG - Intergenic
998416185 5:141947835-141947857 TTGGGGGTAAGGAAAGAGGAGGG - Intronic
998499654 5:142621379-142621401 AAGGAGGGAAGGAGGGAGGAAGG - Intronic
998861404 5:146447536-146447558 ATGGGGTTTAAGAAGGGGGAAGG + Intronic
999015711 5:148102214-148102236 ATGGGAGTAGGGAAGGGTGAGGG + Intronic
999324956 5:150638086-150638108 ATGGGGGTAGGTAGGGGAGTGGG + Intronic
999947434 5:156612593-156612615 ATGGGGGTAAGGGTGTTGGATGG + Intronic
1000287536 5:159839602-159839624 ATGGTGGTAAGGATGGGGGTAGG - Intergenic
1000502418 5:162068147-162068169 GTGGGGGGAAGGTGTGGGGAGGG + Intronic
1000997523 5:167974101-167974123 AGGGAGGAAAGGAGGGAGGAAGG + Intronic
1000997575 5:167974255-167974277 AGGGAGGAAAGGAGGGAGGAAGG + Intronic
1000997591 5:167974308-167974330 AGGGAGGAAAGGAGGGAGGAAGG + Intronic
1001308726 5:170595184-170595206 CTGGGGGTGAGGAGTGGGGTGGG + Intronic
1001312122 5:170618529-170618551 AGGGAGGAAAGGAGGGAGGAGGG + Intronic
1001331603 5:170766464-170766486 AAGGGGGAATGGAGGGTGGAAGG + Intronic
1001332144 5:170769977-170769999 ATGGGAGTAAGGACTAGGGAAGG + Intronic
1001332669 5:170773212-170773234 ATGGGGGCACGGATGGGAGAAGG + Intronic
1001336186 5:170798937-170798959 AAGGGTGTGGGGAGGGGGGAGGG - Intronic
1001483092 5:172101952-172101974 ATGGGGGTCAGCAGGGTGGGGGG + Intronic
1001494484 5:172178357-172178379 ATGGTGATAAGGTGGAGGGAAGG - Intronic
1001774822 5:174320833-174320855 ATGGAAGGAAGGAAGGGGGAGGG - Intergenic
1001785922 5:174413013-174413035 TTGGGGGAAAGCCGGGGGGAAGG + Intergenic
1001891715 5:175344788-175344810 GTGGGGGGAAGGAGGTGGGAAGG + Intergenic
1002102353 5:176863772-176863794 AAGGGGGTAAAGAAGGAGGAGGG - Intronic
1002194670 5:177495453-177495475 CTGGGGGTCAGGAGGGGGTGGGG - Intronic
1002255425 5:177954758-177954780 AAGGGAGGGAGGAGGGGGGAGGG + Intergenic
1002539025 5:179893912-179893934 AGGGAGGCAAGGAGGGAGGAGGG + Intronic
1002886413 6:1299285-1299307 CTGGGGCTAAGGATGGGGCAGGG + Intergenic
1002917660 6:1542026-1542048 AGGGAGGGAAGGAGGGAGGAGGG + Intergenic
1002917709 6:1542170-1542192 AGGGAGGGAAGGAGGGAGGAGGG + Intergenic
1003145251 6:3504876-3504898 GTGGGGGTTGGGAGAGGGGAGGG + Intergenic
1003372184 6:5539137-5539159 ATGGGGGAAAGGAAGGCTGATGG - Intronic
1003507637 6:6752559-6752581 AGGGAGGGAGGGAGGGGGGAAGG + Intergenic
1003673473 6:8181405-8181427 AGGGAGGGAAAGAGGGGGGAGGG - Intergenic
1003812235 6:9796918-9796940 AGGGAGGGAAGGAGGGGGAAGGG + Intronic
1004139286 6:13000638-13000660 AAGGGGGGAGGGAGGGAGGAAGG + Intronic
1004589808 6:17039252-17039274 ACGGGGGTAAGGGTGAGGGAAGG - Intergenic
1005014806 6:21365943-21365965 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1005140955 6:22631056-22631078 AGGGGGGTAGGGAGGTAGGAGGG - Intergenic
1005161557 6:22870293-22870315 TTGGGTGTGGGGAGGGGGGAGGG + Intergenic
1005441892 6:25878943-25878965 AAGGAGGGAAGGAGGGAGGAAGG - Intronic
1005665107 6:28044452-28044474 AAGGGGGGAGGGAGGGAGGAAGG + Intergenic
1005952880 6:30644412-30644434 ATGGAGGAAAGGAGAGAGGAAGG - Intronic
1006271215 6:32968802-32968824 CTGGGGGAAAGGCGGGGGGTGGG + Intronic
1006308811 6:33242619-33242641 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1006623148 6:35381210-35381232 CTGGAGGTCAGGAGGAGGGAAGG - Intronic
1006848968 6:37083678-37083700 ATGGGAGGAAGGTGGGGGTAGGG - Intergenic
1007183498 6:39947937-39947959 ATGGGTGTAGGGAGGGAGGGAGG + Intergenic
1007407942 6:41645460-41645482 CTGGGGGTGAGGAGCAGGGAGGG - Intronic
1007427441 6:41756704-41756726 GTGGGGGTGAGGGGAGGGGAGGG - Intergenic
1007789177 6:44299191-44299213 ATGGGGATCAGGAGTGTGGATGG - Intronic
1007979053 6:46131296-46131318 GTGGGGGGAAGGGGGAGGGATGG - Intronic
1008071933 6:47106862-47106884 ATGGAGGTATGGGGGGGGGGCGG - Intergenic
1008219075 6:48833887-48833909 ATGGGGTGTAGGAGGGTGGAGGG + Intergenic
1008288386 6:49682534-49682556 ATGGAGGGAAGGAGGGAGGTGGG - Intergenic
1008288397 6:49682761-49682783 ATGAGGGAAGGGAGGGAGGAAGG - Intergenic
1008418612 6:51271717-51271739 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1008418661 6:51271910-51271932 AGGAGGGAAGGGAGGGGGGAAGG + Intergenic
1008418667 6:51271922-51271944 AGGGGGGAAGGGAAGGGGGAAGG + Intergenic
1008623886 6:53298888-53298910 GTGGGGGCAAGGCGGGGGGGGGG + Intronic
1008694147 6:54014426-54014448 ATGGGGCTAGGGGTGGGGGATGG + Intronic
1008892549 6:56511853-56511875 ACGGGGGGAAGGAGGGAGAAGGG + Intronic
1009457393 6:63873143-63873165 TGGGGTGTAGGGAGGGGGGAGGG - Intronic
1009593737 6:65708770-65708792 ATGGGGAAAAGGAGGAGGAAGGG - Intergenic
1009836791 6:69011483-69011505 AGGGAGGGAAGGAGAGGGGAAGG + Intronic
1010015954 6:71105105-71105127 ATGGGGGTGAGGCGGGTGGCTGG + Intergenic
1010240184 6:73608145-73608167 ATGGGGGTGGGGAGTGGGAATGG - Intronic
1010331632 6:74629963-74629985 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1010484786 6:76397100-76397122 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1010493504 6:76503387-76503409 ATGGGGGATAGGCAGGGGGAGGG - Intergenic
1010643603 6:78360201-78360223 ATGGGGTGGGGGAGGGGGGAGGG + Intergenic
1010704307 6:79089680-79089702 ATGGAGGGAAAGAGGGAGGAAGG - Intergenic
1011632362 6:89339597-89339619 GAGGGGGGAAGGAGAGGGGAGGG + Intronic
1011682021 6:89792507-89792529 TGGGGGGTAAAGAGGGAGGAGGG + Intronic
1011742441 6:90375885-90375907 GTGGGGCTGAGGTGGGGGGAAGG + Intergenic
1011833016 6:91396110-91396132 ATATGGGCAAGGAAGGGGGAAGG + Intergenic
1011953903 6:93001156-93001178 GTGGGGGGAAGGGGGAGGGATGG + Intergenic
1012033597 6:94103615-94103637 AAGGGGGTAAGGGAGGGGCATGG - Intergenic
1012042978 6:94234048-94234070 ATGGGGAGCAGGAAGGGGGATGG - Intergenic
1012085581 6:94822296-94822318 AAGGGGGGAAAGAGGGGGGAAGG - Intergenic
1012375938 6:98561559-98561581 ATGGAGGGAGGGAGGAGGGAAGG - Intergenic
1012399770 6:98834120-98834142 ATGGGGAAACGGAGGGGGTAAGG - Intergenic
1012750002 6:103147852-103147874 TTGGGGATAAGGATGGGGGTTGG + Intergenic
1012872842 6:104692139-104692161 AGGGAGGAAAGGAGGGAGGAAGG + Intergenic
1012934182 6:105348537-105348559 ATGGGGGAAAGGAGGAGAGGGGG + Intronic
1013309414 6:108879451-108879473 ATGGGTGGATGGATGGGGGATGG - Intronic
1013536908 6:111071377-111071399 AAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1013756460 6:113467539-113467561 ATGGGGACAGGGAGAGGGGAGGG - Intergenic
1013971602 6:116026513-116026535 AGGGAGGGAGGGAGGGGGGAAGG + Intronic
1014041996 6:116838750-116838772 CTGGGGTGGAGGAGGGGGGAGGG + Intergenic
1014176368 6:118335748-118335770 ATGGGAGGAAGGAGAGGGGAAGG + Intergenic
1014913291 6:127118569-127118591 GAGGGGGAGAGGAGGGGGGATGG - Intergenic
1014913307 6:127118605-127118627 AGGAGGGCAGGGAGGGGGGAGGG - Exonic
1015028536 6:128567129-128567151 AGGGGGGAAAGGAGGGAGGGAGG - Intergenic
1015085574 6:129287088-129287110 AAGGAGGGAAGGAGGGAGGAAGG + Intronic
1015403489 6:132812925-132812947 AGGGGGTTAGGGAGTGGGGATGG - Intergenic
1015562596 6:134532809-134532831 GTGGGAGAAAGGAGGGTGGAAGG + Intergenic
1015620602 6:135127858-135127880 TTGGGGGGAAGGATGGGAGAGGG + Intergenic
1015626404 6:135183359-135183381 CTGGGGGTTAGGAAGAGGGAGGG - Intronic
1015631520 6:135236533-135236555 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1015770898 6:136767354-136767376 AAGGGAGGAAGGAGGAGGGAGGG + Intronic
1015890499 6:137965354-137965376 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1015999352 6:139028026-139028048 CTGGGGGTGGGGAGGGGGTAAGG + Intergenic
1016317757 6:142808706-142808728 ATGGAGGAAAGGATGGGGGAGGG + Intronic
1016400545 6:143675533-143675555 CTGGGGGTGAGGAGGCAGGAGGG - Intronic
1016480090 6:144471213-144471235 AGGGTGGGAAGGAGGGAGGAGGG + Intronic
1016532557 6:145074975-145074997 ATTGGGGAAGGGAGGGAGGAAGG + Intergenic
1016534229 6:145092684-145092706 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1016851878 6:148628392-148628414 AGGGGGATAAGGATGGGGGAGGG - Intergenic
1017041111 6:150309213-150309235 AGGGAGGTAGGGAGGGAGGAAGG + Intergenic
1017297228 6:152812049-152812071 AAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1017334066 6:153234493-153234515 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1017637387 6:156456246-156456268 AGGGGGGGAAGGGGAGGGGAAGG - Intergenic
1017790275 6:157792087-157792109 ATGGAGGGAAGGAGGGAGGGAGG - Intronic
1017885249 6:158594038-158594060 AGGGGTGTGAGGAGGAGGGAGGG - Intronic
1017931910 6:158963402-158963424 GAAGGGGGAAGGAGGGGGGAGGG - Intergenic
1018205609 6:161434918-161434940 CTGGGAGGAAGGAGAGGGGAGGG + Intronic
1019040040 6:169096157-169096179 TGGGGGGTGAGGAGGGAGGAGGG - Intergenic
1019065112 6:169289857-169289879 CTGGGGGTAAGCAGGTGCGAAGG + Intergenic
1019334876 7:478369-478391 AAGGAGGGAAGGAGGAGGGAAGG + Intergenic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019730609 7:2627486-2627508 ATGGAGGGAAGGAAGGTGGAAGG + Intergenic
1019797302 7:3060342-3060364 CTAGGGGTAGGGAGGGGTGACGG - Intergenic
1019830296 7:3321737-3321759 GGGAGGGGAAGGAGGGGGGAGGG - Intronic
1020035047 7:4959377-4959399 GTGGGCGTAAGGAGTGGGGGCGG + Intergenic
1020070423 7:5223610-5223632 ACGGGGGTGAGGAAGGGGGTTGG - Intronic
1020080223 7:5282805-5282827 AAGAGGGTGAGGAAGGGGGAGGG + Intronic
1020201916 7:6086663-6086685 AAGGGGGAAGGGAAGGGGGAAGG - Intergenic
1020437159 7:8176734-8176756 GTGGTGGTAAGGACGAGGGATGG - Intronic
1020685234 7:11285984-11286006 AGGGGGGTGAGGGGAGGGGAGGG - Intergenic
1020722255 7:11761897-11761919 AAGGGGGGAAGGAGGGAGGCAGG - Intronic
1020760405 7:12261784-12261806 GTGGGGGGGGGGAGGGGGGAGGG + Intergenic
1021031557 7:15743422-15743444 ATGGGGGCAAGTATGGTGGAAGG + Intergenic
1021112450 7:16710656-16710678 AAGGAGGGAAGGAGGGAGGAAGG + Intergenic
1021329944 7:19324020-19324042 AGGGAGGGAAGGAGGGAGGAGGG + Intergenic
1021565091 7:22008807-22008829 AAGGGGGGAAGAAGTGGGGAGGG + Intergenic
1021656716 7:22880697-22880719 ATGGGAGGAAGGAAGAGGGAAGG - Intergenic
1021694339 7:23261635-23261657 GTAGGGGTAGGGAGGCGGGATGG + Intronic
1021995857 7:26177595-26177617 AAGGAGGGAAGGAGGGAGGAAGG + Intronic
1022003167 7:26245016-26245038 AGGGGCGTAAGGTGGCGGGATGG - Intergenic
1022092071 7:27114114-27114136 ATGGGGCTGAGGCGAGGGGAGGG + Intronic
1022188937 7:27998016-27998038 ATGGGGGGAAGAAGGAAGGAAGG + Intronic
1022393014 7:29959951-29959973 GTGGGGGGAGGGAGGGAGGAGGG + Intronic
1022447258 7:30480499-30480521 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1022541789 7:31144413-31144435 AGGGAGGTAGGGAGGGAGGAAGG - Intergenic
1022734555 7:33063389-33063411 CTGGGGGTGAGGAGGGGCGCAGG + Intergenic
1023059315 7:36313239-36313261 ATCGGGGCAGGGATGGGGGATGG + Intergenic
1023279592 7:38555965-38555987 TTGTGGGGAAGGAGGAGGGAAGG + Intronic
1023346676 7:39278106-39278128 AGGGGGGGAGGGAGGGAGGAAGG + Intronic
1023584654 7:41716621-41716643 ATGGGGGCAAGGATGGGAGTAGG - Intergenic
1023754958 7:43407790-43407812 ATGGAGGGAAGGAGGAGGGCTGG - Intronic
1023830941 7:44038786-44038808 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1023848148 7:44134821-44134843 AAGGAGGGAAGGAGGGAGGAAGG - Intergenic
1023916983 7:44597031-44597053 GGAGGGGAAAGGAGGGGGGAGGG + Intergenic
1024089184 7:45921349-45921371 GTGGGGGTTGGGAGGGGGGCGGG + Intronic
1024350734 7:48360181-48360203 ATGGGGTGGGGGAGGGGGGAGGG - Intronic
1024439775 7:49403746-49403768 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1024470473 7:49764579-49764601 GTGGTGGTAAGGTGTGGGGAGGG - Intergenic
1024616936 7:51123820-51123842 ATGTGGGTGAGGAGGTGGCATGG - Intronic
1024659761 7:51482257-51482279 ATTGGGGTAAGGTGGAGGAAAGG - Intergenic
1024725466 7:52189376-52189398 AGAGGGGAAAGGAGAGGGGAGGG + Intergenic
1024737751 7:52323553-52323575 AAGGGGGAAAGGAAGGGAGAAGG - Intergenic
1025064117 7:55838520-55838542 AGGGAGGAAGGGAGGGGGGAGGG - Intronic
1025574540 7:62619625-62619647 ATGGGTGTCAGGCTGGGGGATGG - Intergenic
1026094720 7:67335742-67335764 TAGGGGGTCGGGAGGGGGGAGGG + Intergenic
1026264319 7:68783173-68783195 GTGGGGGTGGGGTGGGGGGATGG - Intergenic
1026308739 7:69166085-69166107 GTGGGGGAGGGGAGGGGGGAGGG + Intergenic
1026308829 7:69166258-69166280 AAGGGGATGGGGAGGGGGGAAGG + Intergenic
1026361067 7:69600591-69600613 TTGGGAGAAAGGAGGGAGGAGGG + Intronic
1026557782 7:71422892-71422914 ATGGGGAGCAGGAAGGGGGATGG + Intronic
1026907137 7:74069026-74069048 CTGGGGGGAGGGAGGAGGGAAGG + Intronic
1027235787 7:76297078-76297100 ATGGGGGTGAGGTGGGTGGTAGG - Intergenic
1027336312 7:77154447-77154469 ATGGGGTGGGGGAGGGGGGAGGG - Intronic
1027354263 7:77340924-77340946 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1027362987 7:77428517-77428539 ATGGGGGAAAGTAGTGGGAAGGG + Intergenic
1027725644 7:81802185-81802207 TTAGGGGTAAGGAGGAGAGAAGG + Intergenic
1027823980 7:83087072-83087094 GTGGGGGGAAGGGGGAGGGAGGG + Intronic
1027885411 7:83898677-83898699 TGGGGGGTAGGGTGGGGGGAGGG - Intergenic
1028100588 7:86815145-86815167 AGGGGGAAAAGGAGGGGGAACGG + Intronic
1029069190 7:97881422-97881444 CTGGGGGAAAGGGGAGGGGATGG - Intergenic
1029199172 7:98827241-98827263 ATGGGGGTGGGGAGTGGGGGAGG - Intergenic
1029282031 7:99441529-99441551 ATGGGGATGAAGAGGAGGGATGG - Intronic
1029284907 7:99458657-99458679 ATGGGAGTGAGGTGGGGGTAGGG + Intronic
1029741275 7:102493095-102493117 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029759265 7:102592264-102592286 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029776634 7:102688174-102688196 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1029779476 7:102716654-102716676 ATGGGGTGGGGGAGGGGGGAGGG + Intergenic
1029803589 7:102974987-102975009 AGGGGCGTAAGGTGGTGGGATGG - Intronic
1030107630 7:106000072-106000094 ATGGGGCCAAAGAGGTGGGATGG - Intronic
1030601958 7:111602875-111602897 ATGGGGTGAAGGAGAGGGGGAGG + Intergenic
1030709761 7:112736455-112736477 TTGGGTGTGGGGAGGGGGGAAGG - Intergenic
1030760304 7:113342066-113342088 ATGGGTGTCAGGCTGGGGGACGG + Intergenic
1030923323 7:115420021-115420043 GTGGTGGTAAGGTGTGGGGAGGG + Intergenic
1031466567 7:122119547-122119569 TTGGGGGTGAGGATGGGGAATGG - Intronic
1031742217 7:125447965-125447987 ATGGGGGCAAAGATAGGGGATGG - Intergenic
1031901578 7:127417211-127417233 AAGGGGGTACGGCGGGGGGCGGG - Intronic
1032056496 7:128688784-128688806 GTGGGGAGAGGGAGGGGGGAGGG - Intergenic
1032275741 7:130453741-130453763 AAGGAGGGAAGGAGGGGGCAAGG - Intergenic
1032345235 7:131110252-131110274 AGGGGGGTAAGGTGGGGCGGCGG + Intronic
1032357758 7:131226022-131226044 AGGGAGGGAGGGAGGGGGGAAGG - Intronic
1033146697 7:138877129-138877151 ATGGAGGTGGGGAGCGGGGAGGG - Intronic
1033354918 7:140591939-140591961 AGGGGAGTAGGGAGGGGGGAGGG - Intronic
1033892018 7:146025133-146025155 AGGGAGGGAAGGAGGGTGGAAGG - Intergenic
1033955373 7:146841363-146841385 AAGGGGGTTGGGTGGGGGGAAGG + Intronic
1034252893 7:149706543-149706565 AGGGGGGGAAGGAGAGGAGAGGG - Intergenic
1034263308 7:149770337-149770359 AGGGAGGGAGGGAGGGGGGAGGG + Intronic
1034402792 7:150876953-150876975 GTGGGGGAAAGGCGGGGGGTGGG - Intergenic
1034465154 7:151223648-151223670 ATGGGGGTAGGGAAGGAGGGAGG + Intronic
1034480567 7:151317220-151317242 GTGGGGGTAAGGAGGTCGGATGG + Intergenic
1034605325 7:152307371-152307393 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1034612236 7:152381346-152381368 ACGGGGGCAGGGAGGGGGGGAGG + Intronic
1034757391 7:153635534-153635556 GAGGGGGGAGGGAGGGGGGAGGG - Intergenic
1034821227 7:154218087-154218109 ATGGGGGAAACGATGGTGGATGG - Intronic
1034905498 7:154941072-154941094 ATGGGAGTAAGGGGGTGGGATGG + Intronic
1034919510 7:155068417-155068439 AGGGGGTAAGGGAGGGGGGAAGG + Exonic
1035230651 7:157463814-157463836 ATGGGGGTGAGGATGGGGTGGGG - Intergenic
1035230663 7:157463841-157463863 ATGGGGGTGAGGATGGGGTGGGG - Intergenic
1035230693 7:157463930-157463952 ATGGGGGTGAGGATGGGGTGGGG - Intergenic
1035265827 7:157689986-157690008 GTGTGGGAAAGGAGGAGGGAAGG - Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035539441 8:421266-421288 ACTGGGGCGAGGAGGGGGGATGG - Intronic
1035776260 8:2191171-2191193 AGGGAGGAAAGGAGGAGGGAAGG - Intergenic
1036089924 8:5654426-5654448 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1036125380 8:6057422-6057444 ATGGGGGTGGTGATGGGGGATGG - Intergenic
1036251446 8:7166193-7166215 CTGGGGGAAAGGGGAGGGGATGG - Intergenic
1036366042 8:8121267-8121289 CTGGGGGAAAGGGGAGGGGATGG + Intergenic
1036472491 8:9063909-9063931 AAGGGGGAATGGAGGGTGGAAGG + Intronic
1036495763 8:9268581-9268603 AAGGGGGGAAGGAGGGGGGGAGG + Intergenic
1036663048 8:10720858-10720880 GAGGGGGGAAGGAGGGAGGAAGG - Intergenic
1036756748 8:11476290-11476312 ATGGGGGAAAGCCGGGGGGCGGG - Intergenic
1036884895 8:12544813-12544835 CTGGGGGAAAGGGGAGGGGATGG - Intergenic
1037134760 8:15446733-15446755 AGAGGGGGAGGGAGGGGGGAGGG + Intronic
1037438587 8:18890807-18890829 CTGGGGGTAAGGGTGGGGGAGGG + Intronic
1037825838 8:22160101-22160123 AAGGGGGTGAGGAGGGTGGTGGG + Intronic
1038012456 8:23486026-23486048 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1038166298 8:25088055-25088077 AGGGGGGAAAGGGGAGGGGAAGG + Intergenic
1038331150 8:26610568-26610590 ATTGAGGGAAGGAGGGTGGAGGG - Intronic
1038420484 8:27431072-27431094 AAGGGGGCCAGGAGGGGGCAGGG + Intronic
1038870076 8:31484262-31484284 ATGGGGTGGGGGAGGGGGGAGGG - Intergenic
1038900841 8:31841990-31842012 ATGGGGAGGAGGAGGAGGGAAGG - Intronic
1039013937 8:33125333-33125355 ATTGGGGTGAAGATGGGGGAGGG - Intergenic
1039090972 8:33829320-33829342 AAGGGGATAAGGTGGGAGGAGGG - Intergenic
1039352950 8:36782297-36782319 ATGAGGGAAGGGAGGGAGGAAGG - Intergenic
1039352970 8:36782361-36782383 AGGGAGGTAGGGAGGGAGGAAGG - Intergenic
1039386245 8:37138174-37138196 TTGGGGGAAAGGAGGGTGCAGGG + Intergenic
1039393313 8:37200665-37200687 ATGGAGGGAAGGAGAGTGGATGG + Intergenic
1039464066 8:37770899-37770921 ATGGGAGGAGGGAGCGGGGAAGG + Intronic
1039474834 8:37834132-37834154 ATGGGGGTCAGCAGAGGGGGTGG + Intronic
1040841173 8:51786520-51786542 GTGGGGGTGAGGATGGGGGTCGG - Intronic
1040863274 8:52022810-52022832 ATGGGGGTAGGGGAGGGGGAGGG - Intergenic
1040879380 8:52189116-52189138 TTGGGGGCAAGGAGGGGAGATGG - Intronic
1040983126 8:53266260-53266282 ATGGGTGTGGGGAGTGGGGAAGG - Intergenic
1041135892 8:54758471-54758493 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1041136640 8:54766026-54766048 AGGGGGGTAAGGACGATGGATGG + Intergenic
1041203448 8:55473874-55473896 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
1041334283 8:56762756-56762778 GTGGGAGGAAGGAAGGGGGAAGG - Intergenic
1041444184 8:57931899-57931921 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1041584937 8:59505382-59505404 AAGGGAGGAAGGAGGGGGCAAGG + Intergenic
1041643845 8:60230580-60230602 AAGGAGGGAAGGAGAGGGGAAGG - Intronic
1041769155 8:61454316-61454338 AGGGGGGAAAGGAGAGAGGAGGG - Intronic
1042230028 8:66545719-66545741 ATGGAGGGAAGGAGGGAGGGAGG + Intergenic
1042517439 8:69674299-69674321 ATGGGAGGGAGGAGGGAGGAAGG + Intronic
1042543988 8:69934533-69934555 ATGTGGGGAAGGATGGGGGCAGG - Intergenic
1043019361 8:74982286-74982308 TTGGGGGTAAGGAGGAGGGTTGG - Intergenic
1043316495 8:78928431-78928453 ATGGGGTGGGGGAGGGGGGAGGG + Intergenic
1043376387 8:79654344-79654366 TGGGGGATAGGGAGGGGGGAAGG + Intronic
1043815108 8:84792279-84792301 ATGGGGAGATGGAAGGGGGATGG + Intronic
1044180877 8:89192408-89192430 GTGGGGGTAAGGGGGTGGGGAGG + Intergenic
1044450374 8:92329335-92329357 ATGGTGGTAAGGAGGACAGATGG - Intergenic
1044684919 8:94817373-94817395 ATGGGGGGAAGGAGTGGGGGAGG - Intronic
1044851217 8:96430524-96430546 AGGGAGGGAGGGAGGGGGGAAGG - Intergenic
1044872026 8:96628873-96628895 AGGGAGGGAAGGAAGGGGGAAGG - Intergenic
1045233071 8:100324556-100324578 ATGGGGGTAAAGTGGGAGTAGGG - Intronic
1045288742 8:100813659-100813681 ATGGGGGAAGGTAGAGGGGAGGG - Intergenic
1045412029 8:101929396-101929418 ATGGAGGGAGGGAGGGAGGAAGG + Intronic
1045487120 8:102640410-102640432 AAGGAGGGAAGGAGGGAGGAAGG + Intergenic
1045508545 8:102795441-102795463 AGGGGGGTCAGGTGGAGGGAGGG + Intergenic
1045544713 8:103118223-103118245 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1045967028 8:108036679-108036701 CTGGGGGTGAGGTGGGAGGAAGG + Intronic
1046320194 8:112564338-112564360 AGGGGAGAAAGGAGGGGAGAAGG - Intronic
1046690985 8:117283964-117283986 CTGGAGGTAAGGAGGAGGAAAGG - Intergenic
1047203039 8:122782112-122782134 AGGGGGGTACGGAAGGGGGGGGG + Intronic
1047210343 8:122835404-122835426 AGGGGCGTAAGGTGGTGGGATGG + Intronic
1047293546 8:123551295-123551317 ATGGAGGTAAGGATGGGAGTGGG + Intergenic
1047594660 8:126366234-126366256 TTGTGGGGAAGAAGGGGGGAAGG + Intergenic
1048141646 8:131800882-131800904 GTGGGTGTATGGAGGTGGGACGG + Intergenic
1048541621 8:135347116-135347138 AGGGGAGGAAGGAGAGGGGAGGG + Intergenic
1048586821 8:135781872-135781894 TTGGGGATAGGGAGGGGGGAAGG - Intergenic
1048805786 8:138239998-138240020 ATGGGGTGGGGGAGGGGGGAGGG + Intronic
1048846489 8:138607533-138607555 ATGGAGGTAGGGACGGGGGTGGG - Intronic
1049169214 8:141148234-141148256 CTGGTGGAAAGGAGGGAGGAGGG + Intronic
1049359998 8:142207815-142207837 ATGGGAGGATGGATGGGGGATGG + Intergenic
1049406731 8:142454962-142454984 ATGCAGGGAAGGAGGGAGGAGGG - Intronic
1049464328 8:142744142-142744164 ATGGGTGGATGGATGGGGGATGG + Intergenic
1049464646 8:142745202-142745224 ATGGGGGCAAGATGGGTGGATGG + Intergenic
1049464934 8:142746779-142746801 ATGGGTGGATGGATGGGGGATGG + Intergenic
1049511064 8:143026877-143026899 ATGGGGGTGGGCAGGGGGGAGGG - Intergenic
1049554165 8:143274028-143274050 GTGGGGGCAGGGTGGGGGGATGG - Intronic
1049584550 8:143426825-143426847 GTGGGGGTAGGGAGCAGGGAGGG + Intronic
1049654997 8:143793405-143793427 ACGGGGGTAGAGAGGGGGGTGGG + Intronic
1049712388 8:144071220-144071242 AAGGGGGAGGGGAGGGGGGAGGG - Intergenic
1049737708 8:144218698-144218720 AGGGGGGACAGGAGGGGAGAGGG - Intronic
1049868970 8:144958745-144958767 ATGGAGGAATGGAGGGTGGAAGG + Intergenic
1049876772 8:145028404-145028426 ATGGGTGTCAGGCTGGGGGATGG + Intergenic
1050208299 9:3223064-3223086 ATTGGGGTAAGGGGGGTGGGGGG - Exonic
1050595798 9:7203580-7203602 ATGGGGTTAAGGGGGAGGGAGGG - Intergenic
1050759199 9:9045404-9045426 GTGGGGGTAAGGTGGGTGAAGGG + Intronic
1050809874 9:9731600-9731622 TGGGGTGTAGGGAGGGGGGAAGG - Intronic
1051160833 9:14205241-14205263 AAGGGAGGAAGGAAGGGGGAGGG + Intronic
1051408512 9:16764898-16764920 AAGGAGGGAAGGAGGGAGGAGGG + Intronic
1051440246 9:17075477-17075499 AGGGAGGGAAGGAGGGGGGAAGG - Intergenic
1051459350 9:17294825-17294847 AGGGCGGGGAGGAGGGGGGAGGG + Intronic
1051721156 9:20039112-20039134 AAGGGGGAAAGGAGGCGGCATGG + Intergenic
1052274392 9:26661076-26661098 ATGGAGGAAAGGAGGGAGGGAGG + Intergenic
1052297959 9:26919735-26919757 ATGGGGGTGAGGATGAAGGATGG + Intronic
1052346225 9:27412541-27412563 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
1052484836 9:29083432-29083454 GTGGGGTGAGGGAGGGGGGATGG + Intergenic
1052617270 9:30857016-30857038 TGGGGTGGAAGGAGGGGGGAGGG - Intergenic
1052748308 9:32463163-32463185 ATGGGGCCAAGAAGTGGGGAAGG - Intronic
1053060119 9:35024099-35024121 AAGGGGGAATGGAGGGCGGAAGG + Intergenic
1053133990 9:35637911-35637933 ATGGGGGAATCGAGGGTGGAAGG - Intronic
1053157759 9:35792215-35792237 ATGGGAGGAAGGCGGGGGGCGGG - Exonic
1053337306 9:37286965-37286987 AGGGAGGGAGGGAGGGGGGAGGG - Intronic
1053337319 9:37286988-37287010 AGGGAGGGAAGGAGGGGGGAGGG - Intronic
1053437303 9:38084554-38084576 ATGGGGATTAGGAAGGAGGAAGG + Intergenic
1053715533 9:40884495-40884517 ATGGGCGTGAGGTGGGAGGATGG + Intergenic
1054460198 9:65458465-65458487 AGGGGTGTGAGGTGGGGGGAGGG - Intergenic
1054790908 9:69255922-69255944 AGGGGGGGAGGGAGGGGGGAAGG - Intergenic
1054825330 9:69567564-69567586 GTGGGGTTGTGGAGGGGGGAGGG - Intronic
1055316538 9:75039807-75039829 AGGGAGGGAAGGAGAGGGGAGGG - Intergenic
1055514535 9:77022170-77022192 CTGGGGCTCAAGAGGGGGGAAGG - Intergenic
1055730307 9:79273926-79273948 AAGGAGGTAAGGAGGGAGGGAGG + Intergenic
1055819316 9:80242802-80242824 AAGGAGGTAGGGAGGGAGGAAGG - Intergenic
1056391725 9:86147034-86147056 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1056805792 9:89727616-89727638 AGGGGGGTGTGGAGGGGAGATGG + Intergenic
1057173628 9:92978411-92978433 ATGGGGGTGGGGTGGGGGGGTGG - Intronic
1057191848 9:93092773-93092795 ATGGGGACAAGGATGGGGCAGGG + Intergenic
1057247250 9:93467247-93467269 ATGGGGGAAAAGGGGGGGGGGGG - Intronic
1057458132 9:95233117-95233139 AGGCGGGAAAGGAGGGGAGATGG + Intronic
1057759368 9:97860239-97860261 TAGGGGCTAAGGAGTGGGGATGG + Intergenic
1057767427 9:97934423-97934445 ATGGGGGAGAGGAGGGGGAGGGG + Intronic
1057885112 9:98823856-98823878 ATGGAGGCAAGGAGGGTGGAGGG + Intronic
1057948747 9:99352883-99352905 AAGGGGGTGAGGTGGAGGGAGGG - Intergenic
1057981931 9:99671425-99671447 ATGGAGGAATGGAGGGTGGAAGG - Intergenic
1057987025 9:99727345-99727367 CTGGGGGTAAGGATGGGGGATGG + Intergenic
1058121509 9:101144263-101144285 TTGGGGGTGGGGAGCGGGGAGGG + Intronic
1058504051 9:105651470-105651492 AAGGGGCTAAGGATGGAGGAGGG + Intergenic
1058618839 9:106862707-106862729 CTGGGGTTCAGCAGGGGGGAGGG + Intergenic
1058656743 9:107229218-107229240 AAGGGGATACGGAGGGGGCAGGG + Intergenic
1058663637 9:107289075-107289097 AGGGAGGAAAGGAGGGAGGAAGG - Intronic
1058692511 9:107531623-107531645 ATGGGGGAAAGGATTGGGGGTGG - Intergenic
1058976074 9:110126742-110126764 GTGGGGGTCAGCAGCGGGGAGGG - Intronic
1058983234 9:110189360-110189382 ATGGGGGAAAGGAGGTGGCAGGG - Intergenic
1059051612 9:110932814-110932836 ATGGGTTGGAGGAGGGGGGATGG - Intronic
1059108410 9:111531784-111531806 ATGAGGCTGAGGAGGGAGGATGG - Intronic
1059342056 9:113602856-113602878 CTGGGGGTAAAAAGTGGGGATGG - Intergenic
1059404595 9:114092111-114092133 ATGGGGGTGGGGTGGGGGGAAGG - Intronic
1059474739 9:114536250-114536272 AAGGAGGGAAGGAGGGGGGAAGG + Intergenic
1059476094 9:114548889-114548911 AGGGAGGAAAGGAGGAGGGAAGG + Intergenic
1059701087 9:116775775-116775797 AAGGAGGGAAGGAGGAGGGAAGG + Intronic
1059714919 9:116904937-116904959 TTGGGGGTGCGGAGGGTGGAAGG - Intronic
1059762758 9:117354684-117354706 AGGGAGGGAAGGAGGAGGGATGG - Intronic
1060045805 9:120339178-120339200 AGGGAGGGAAGGAGGGAGGAAGG + Intergenic
1060069133 9:120531258-120531280 GTGGGGGTGAGGCGGGGGTAGGG - Intronic
1060190342 9:121588575-121588597 AAGGGGGAAGGGAAGGGGGAAGG + Intronic
1060351600 9:122866371-122866393 GTGGGGAGAGGGAGGGGGGAGGG - Intronic
1060418840 9:123453006-123453028 GTGGGAGGAAGGAGGAGGGAAGG + Intronic
1060550781 9:124484275-124484297 ATGGTGGCAAGGAGGGGGCCTGG + Intronic
1060551116 9:124485905-124485927 ATGGGGGTCCGGAGGGGGACAGG + Intronic
1060595749 9:124847639-124847661 ATGTGGGGAAGTAGGGGAGAGGG - Intergenic
1060735745 9:126065579-126065601 AGGGAGGGAGGGAGGGGGGAAGG - Intergenic
1060771941 9:126338182-126338204 CTGGGGGGAAGGAGGGAGAACGG + Intronic
1060815622 9:126633574-126633596 ATGGGGGCCAGGCTGGGGGATGG + Intronic
1060975363 9:127762042-127762064 ATGGGGGTGGGGTGGGAGGAGGG - Intronic
1061060255 9:128246695-128246717 AGGGAGGGAAGGAGGAGGGAAGG - Intronic
1061060270 9:128246743-128246765 AGGGAGGAAAGGAGGGAGGATGG - Intronic
1061196151 9:129108260-129108282 ATGCAGGTAGGGATGGGGGAGGG + Intronic
1061339216 9:129965783-129965805 AAGGAGGGAGGGAGGGGGGAAGG + Intronic
1061416542 9:130450364-130450386 ATGGAGGGAAGGAGGGAGGAAGG - Intronic
1061431241 9:130532725-130532747 CTGGGGGAAAAGAGGCGGGATGG + Intergenic
1061483410 9:130908489-130908511 GTGGGTGGAAGGAGGGGAGATGG - Intronic
1061562627 9:131415948-131415970 ATGGGGGTGGGGTGGGGGGAAGG - Intronic
1061942553 9:133891409-133891431 GAGGGGGGATGGAGGGGGGACGG + Intronic
1062010833 9:134265813-134265835 AGGGAGGGAAGGAGGGGGAATGG - Intergenic
1062050466 9:134444312-134444334 AAGGAGGGAGGGAGGGGGGAAGG - Intergenic
1062050504 9:134444398-134444420 AGGAGGGGAAGGAGGAGGGAGGG - Intergenic
1062074763 9:134579830-134579852 AGGGGGAGAAGGAGCGGGGAGGG + Intergenic
1062113335 9:134794746-134794768 AGGAGGGGAAGGAGGGAGGAAGG + Intronic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062328238 9:136023039-136023061 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1062437132 9:136551318-136551340 CTGGGGGTAGTGAGGGGGCATGG - Intergenic
1062449169 9:136608330-136608352 AGGGAGGGAAGGAGGGGAGAGGG + Intergenic
1062449210 9:136608452-136608474 AAGGAGGGAAGGAGGAGGGAGGG + Intergenic
1062449218 9:136608471-136608493 AGGGAGGGAAGGAGGGGAGAGGG + Intergenic
1062502793 9:136858490-136858512 CTGGGGGTAACGAGAGGGGGTGG - Exonic
1062523671 9:136969847-136969869 ATGGGGGTGGGGAAGGGGGTGGG - Intronic
1062588704 9:137263429-137263451 TTGGGGGGAAGGAGGGAGGGAGG - Intronic
1203574023 Un_KI270744v1:159774-159796 ATGGGGGGAGGGTGGGAGGAGGG + Intergenic
1185459755 X:328735-328757 AGGGGGGCGGGGAGGGGGGAGGG - Intergenic
1185459775 X:328767-328789 AGGGGGGCGGGGAGGGGGGAGGG - Intergenic
1185511502 X:667953-667975 AGGGGGTGAAGGAGAGGGGAGGG - Intergenic
1185608433 X:1380443-1380465 AGAGGGGGGAGGAGGGGGGAAGG + Intronic
1185608453 X:1380481-1380503 AGGGGGGAAAGGAGGGGGAAGGG + Intronic
1185660206 X:1721811-1721833 TGGGGTGGAAGGAGGGGGGAGGG - Intergenic
1185700511 X:2227762-2227784 AGGGAGGGAGGGAGGGGGGAAGG + Intronic
1185700518 X:2227774-2227796 AGGGGGGAAGGGAGGGGGGAAGG + Intronic
1185700656 X:2228083-2228105 AGGGAGGGAAGGAGGGAGGAAGG + Intronic
1185700689 X:2228149-2228171 AGGGAGGGAGGGAGGGGGGAAGG + Intronic
1185700700 X:2228169-2228191 AGGGAGGGAGGGAGGGGGGAAGG + Intronic
1185721944 X:2389277-2389299 ATGGGGGGAAAGAGAGGGAAAGG + Intronic
1185772200 X:2773305-2773327 AGGGAAGAAAGGAGGGGGGAAGG + Intronic
1185954602 X:4475687-4475709 AGGGAGGGAAGGACGGGGGAAGG + Intergenic
1186010449 X:5125790-5125812 AGGGAGGGAGGGAGGGGGGAGGG - Intergenic
1186148167 X:6646448-6646470 ATGGGGGTGAGGAGGGGCACAGG + Intergenic
1186240017 X:7555514-7555536 AAGGAGGGAAGGAGGGAGGATGG + Intergenic
1186490018 X:9964217-9964239 AGGGAGGGAAGGAGGGAGGAAGG - Intergenic
1186500200 X:10044872-10044894 ATGGGGGGACGGAGGGAGGGAGG - Intronic
1186533359 X:10320172-10320194 ATGGGGGTAGAGGGGAGGGATGG - Intergenic
1187051954 X:15703830-15703852 GTGGGGGGGGGGAGGGGGGAGGG + Intronic
1187252069 X:17607568-17607590 ATGGGGTTAGGCAGGGGGAAAGG - Intronic
1187323017 X:18257964-18257986 AAGGGGGAAGGGAAGGGGGAAGG + Intronic
1187323023 X:18257976-18257998 AAGGGGGAAGGGAAGGGGGAAGG + Intronic
1187323029 X:18257988-18258010 AAGGGGGAAGGGAAGGGGGAAGG + Intronic
1187346907 X:18473841-18473863 CTGGGGGTGGGGAGAGGGGATGG + Intronic
1187407460 X:19016686-19016708 ATGGGTGGGGGGAGGGGGGAGGG - Intronic
1187600602 X:20825139-20825161 CTGGGGGTAGGGAGTGGAGAAGG - Intergenic
1187635036 X:21218760-21218782 TGGGGTGTAGGGAGGGGGGAGGG - Intergenic
1187694548 X:21905424-21905446 AAGGGGTTAGGGAGGGGGGAGGG + Intergenic
1187704295 X:21993978-21994000 AAGGGGGAAAGGAGGGAGGGAGG - Intronic
1188023507 X:25184618-25184640 ATGGGGGAAAGGAGGTGGAGAGG + Intergenic
1188194026 X:27208442-27208464 GTGGGGGGGGGGAGGGGGGAGGG + Intergenic
1188229184 X:27640077-27640099 ATTGGTGGGAGGAGGGGGGAGGG - Intronic
1188246616 X:27842333-27842355 ATGGAGGTAAGTAGAGGAGATGG - Intergenic
1188430873 X:30104600-30104622 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1188448302 X:30281181-30281203 ATGAGGTTGGGGAGGGGGGAGGG - Intergenic
1188534496 X:31181530-31181552 ATGGGGGTGGGGAGTGGGGAAGG - Intronic
1188653301 X:32658728-32658750 ATGGAGGTAGGGCAGGGGGAGGG - Intronic
1188699190 X:33237180-33237202 AGGGAGGGAAGGAGGGAGGAAGG - Intronic
1189104027 X:38219165-38219187 ATGAGAGAAAGGAGAGGGGAGGG + Intronic
1189332218 X:40151281-40151303 ATTGGGGCAAGCAGGAGGGAGGG + Intronic
1189491675 X:41475192-41475214 ATGAGGGGAAGGGGAGGGGAGGG - Exonic
1189525409 X:41814591-41814613 TTGGGTGGAGGGAGGGGGGAGGG + Intronic
1189573674 X:42326719-42326741 GTGGAGGTTAGGAGGAGGGAGGG + Intergenic
1189637873 X:43031425-43031447 ATGGGGTTGGGGTGGGGGGAGGG + Intergenic
1189794885 X:44635934-44635956 ATTGGGGTGAGGGTGGGGGAAGG + Intergenic
1189802963 X:44708592-44708614 TTGGGGGTAAGGTTGGGGGTGGG + Intergenic
1190367403 X:49709342-49709364 ATGGGGGTGGGGGAGGGGGAGGG + Intergenic
1190706631 X:53034114-53034136 AGGGAGGGAGGGAGGGGGGAAGG + Intergenic
1191048760 X:56168639-56168661 ATGGGGTCGGGGAGGGGGGAGGG - Intergenic
1191228010 X:58065885-58065907 ATGGGTGTCAGGCTGGGGGAAGG + Intergenic
1191579839 X:62748200-62748222 ATGGGTGGGGGGAGGGGGGAGGG + Intergenic
1191735105 X:64380735-64380757 TAGGGTGGAAGGAGGGGGGAGGG - Intronic
1191790867 X:64970503-64970525 AGGGAGGGAGGGAGGGGGGAAGG + Intronic
1191805962 X:65134117-65134139 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1191822097 X:65321890-65321912 AGGGGTGTAGGGAGGGAGGAAGG + Intergenic
1192105821 X:68315282-68315304 AAGGAGGTAGGGAGGGAGGAAGG + Intronic
1192142390 X:68656857-68656879 GTGGGGTGGAGGAGGGGGGAGGG + Intronic
1192167028 X:68832746-68832768 ATGAGCGCAAGGTGGGGGGATGG + Intronic
1192213973 X:69145079-69145101 TGGGGGGTGAGGAGGAGGGAGGG + Intergenic
1192424040 X:71060070-71060092 ATGGGGGAAAGGAGAATGGAAGG + Exonic
1192534663 X:71917253-71917275 AGGGAGGGAGGGAGGGGGGAGGG - Intergenic
1193278535 X:79620837-79620859 CTGGGGGTGAGGGGTGGGGAGGG - Intergenic
1193369151 X:80672409-80672431 AGGGAGGGAGGGAGGGGGGAGGG + Exonic
1193448041 X:81629327-81629349 ATGGAGGGATGGAGGAGGGAAGG - Intergenic
1193454514 X:81713700-81713722 GTGGGTGGGAGGAGGGGGGAGGG + Intergenic
1193894301 X:87093206-87093228 GTGGGGGGAAGGTGGGAGGAGGG - Intergenic
1194042009 X:88952558-88952580 ATGAGGTTGGGGAGGGGGGAGGG + Intergenic
1195030458 X:100922767-100922789 AGTGGGGTCAGGAGAGGGGAGGG - Intronic
1195168625 X:102244999-102245021 ATCAGGGGAAGGAGGGGGAAAGG - Intergenic
1195190232 X:102442088-102442110 ATCAGGGGAAGGAGGGGGAAAGG + Intronic
1195357024 X:104048639-104048661 GTGGGGGCAAGGAGGTGGTATGG - Intergenic
1195490464 X:105462908-105462930 ATGGGGGTAAGGACTGCAGATGG - Intronic
1195506989 X:105669019-105669041 GTGGGGTTAAAGAGGGTGGAAGG + Intronic
1195549461 X:106150616-106150638 AAGGGGGGAGGGAGGGAGGAAGG + Intergenic
1195766601 X:108302989-108303011 TTGGGGGGGTGGAGGGGGGAGGG - Intronic
1195889133 X:109672284-109672306 ATGGGGGTGGGGAGGGGAGAGGG + Intronic
1196203648 X:112914524-112914546 ATGGGGTGGAGGAAGGGGGAGGG - Intergenic
1196603919 X:117633890-117633912 ATGGGGTGGGGGAGGGGGGAGGG + Intergenic
1196698236 X:118637218-118637240 ACAGGGGTAGGGAGGGTGGAGGG + Intronic
1196811953 X:119635953-119635975 ATGGAGTGAAGGAGGAGGGAAGG + Intronic
1196820021 X:119694215-119694237 ACGGGGATAAGGAGGGCGGGCGG - Intergenic
1196916861 X:120545868-120545890 GTGGGGGTGGGGAGGGGTGATGG + Intronic
1197357467 X:125453262-125453284 GTGGGGGTGGGGCGGGGGGAAGG + Intergenic
1197470811 X:126864352-126864374 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1197487423 X:127071085-127071107 TTGGGGGTAAGGCTGGGAGAGGG - Intergenic
1197907585 X:131442842-131442864 CTGGGGCTAAGCAGGGGAGAAGG + Intergenic
1197911838 X:131491388-131491410 CTGGGGCTAAGCAGGGGAGAAGG + Intergenic
1198234593 X:134725297-134725319 GAGGGGGTAAGGGGAGGGGACGG - Intronic
1198301363 X:135336775-135336797 CTGGGAATAAGGAGAGGGGAAGG - Intronic
1198327179 X:135585398-135585420 AGTGGGGGAAGGAGGGAGGATGG + Intergenic
1198566961 X:137914854-137914876 ATGTGGGTAGGGTGAGGGGAGGG + Intergenic
1198638688 X:138730185-138730207 GTGGGGTGGAGGAGGGGGGAAGG + Intronic
1198683190 X:139203525-139203547 TGGTGGGAAAGGAGGGGGGAGGG + Intronic
1199248357 X:145631955-145631977 AAAGGGTTAAGGAGGGGGGCGGG + Intergenic
1199303547 X:146240744-146240766 AAGGGGATAGGGAGGGAGGAGGG - Intergenic
1199474485 X:148230913-148230935 AGGGGGATGGGGAGGGGGGAGGG - Intergenic
1199710451 X:150465606-150465628 TTGGTGGTGAGGAAGGGGGAGGG - Intronic
1199795924 X:151196761-151196783 GTGGGGGTCAGGTGGGGGGATGG - Intergenic
1199874632 X:151920582-151920604 ATGGGGGTACAGATGGGGTAGGG - Intronic
1199895097 X:152119869-152119891 ATGAGGGTGGGGATGGGGGAGGG + Intergenic
1199944171 X:152652462-152652484 CTGGGGGGAGGGAGGAGGGAAGG - Intronic
1200087238 X:153613208-153613230 CAGGGGGTGAGGAGGGGGGGGGG + Intergenic
1200267248 X:154653084-154653106 ATGGGGGTAAGGCGCCGGGTGGG - Intronic
1200817464 Y:7548377-7548399 AGGGAGGGAAGGAGGGAGGAGGG + Intergenic
1200969450 Y:9135179-9135201 ATGGGGGGAGGGGGGAGGGATGG + Intergenic
1200974738 Y:9196617-9196639 ATGGGGGGAGGGGGGAGGGATGG + Intergenic
1201238829 Y:11938186-11938208 AGGGGTGGAGGGAGGGGGGAGGG + Intergenic
1201515205 Y:14812962-14812984 AAGGAGGGAAGGAGGGAGGAAGG - Intronic
1201650534 Y:16279996-16280018 ATGGAGGGAAGGAGGAGGGGAGG - Intergenic
1201691760 Y:16774963-16774985 ATGGGTGTAGGGAGGGAGGGAGG - Intergenic
1201698522 Y:16854232-16854254 AAGGAAGGAAGGAGGGGGGAGGG - Intergenic
1201904476 Y:19076022-19076044 GTGGGGGTTATTAGGGGGGAGGG - Intergenic
1202057386 Y:20849192-20849214 AGGGGTGGAGGGAGGGGGGAGGG - Intergenic