ID: 1121024625

View in Genome Browser
Species Human (GRCh38)
Location 14:90606263-90606285
Sequence GGCCTATGGTTGGGGTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121024616_1121024625 15 Left 1121024616 14:90606225-90606247 CCAGCATTATGACAAGGGGGTGC 0: 1
1: 0
2: 0
3: 5
4: 44
Right 1121024625 14:90606263-90606285 GGCCTATGGTTGGGGTGTGCTGG 0: 1
1: 0
2: 0
3: 9
4: 169
1121024615_1121024625 16 Left 1121024615 14:90606224-90606246 CCCAGCATTATGACAAGGGGGTG 0: 1
1: 0
2: 0
3: 9
4: 65
Right 1121024625 14:90606263-90606285 GGCCTATGGTTGGGGTGTGCTGG 0: 1
1: 0
2: 0
3: 9
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121024625 Original CRISPR GGCCTATGGTTGGGGTGTGC TGG Intronic
900002936 1:24932-24954 GCCCTGTGGTGGGGGCGTGCCGG - Intergenic
900022657 1:195457-195479 GCCCTGTGGTGGGGGCGTGCCGG - Intergenic
900310003 1:2029051-2029073 GTCCCATGGTTGGGCTGGGCTGG + Intronic
901379460 1:8863306-8863328 GGCCAATGGTTGGGGCGTCATGG - Exonic
902527699 1:17070058-17070080 GGGCGAGGGTTGGGGTCTGCAGG + Intronic
903325221 1:22565389-22565411 GGTCTGGGGTTGGGGGGTGCTGG + Intronic
903856029 1:26337960-26337982 GGCCTTTGGTGGCGGGGTGCAGG - Intronic
904147327 1:28403744-28403766 GGCCTATGTTGGGGGTGGGTGGG - Intronic
904434397 1:30484900-30484922 GGCCTATGGTCTGGGTCTCCAGG + Intergenic
905457880 1:38100830-38100852 GCCCTATGCTTGGGCTGTGGGGG + Intergenic
905779193 1:40692427-40692449 GGCCCAAGATTGGGGTGTGCAGG + Intronic
905871970 1:41409644-41409666 GGCCTCTGGTGGGAGTGTGTGGG + Intergenic
906091990 1:43187666-43187688 GGCCTAGGGCTGGGGTGGGGAGG - Intronic
907506543 1:54923175-54923197 GGGCAATGGTTGGGGTGGGGAGG - Intergenic
912604223 1:110971920-110971942 GGCCTATTGTAGGGTTGTGGGGG + Intergenic
915056304 1:153134135-153134157 TGCCTGTAGTTGGTGTGTGCAGG - Intergenic
915121761 1:153633863-153633885 GTCCTGTTGTTGGGGCGTGCCGG - Intronic
919728593 1:200899216-200899238 GACCTATGGTGGGGGAGTGCAGG - Intronic
920113059 1:203600666-203600688 GGCCTCTGGTGGGGGTGAGGTGG - Intergenic
920647972 1:207817110-207817132 GGACTAAGGGTGGGGTGTGTGGG + Intergenic
920648015 1:207817479-207817501 GGCCCCTGGTTGGGATCTGCTGG - Intergenic
922674883 1:227543936-227543958 GGCAGCTGGTTGGGGTGTGGAGG + Intergenic
923723143 1:236484247-236484269 GGCCAATGGTTGGTGTGTCATGG + Intronic
1062820571 10:531630-531652 GCCCTATGGTGTGGGTTTGCCGG - Intronic
1062997219 10:1878046-1878068 GGGCCAGGGTTGGGGTTTGCAGG - Intergenic
1067438842 10:46296910-46296932 GGCCTGTGGTTGTGGAGTCCTGG + Intronic
1069725548 10:70575571-70575593 AGCCTGTGGGTGGAGTGTGCTGG - Intergenic
1069916772 10:71791354-71791376 GGCCCCTGGTTGTGGGGTGCTGG - Intronic
1073390859 10:103175538-103175560 TGCCTATGATGGGGGTCTGCTGG - Intronic
1076756076 10:132572433-132572455 GGCCTTTCGTAGGGCTGTGCTGG + Intronic
1079387427 11:19993062-19993084 GGCCTATGCTTTGGGTGACCAGG - Intronic
1080368621 11:31608634-31608656 GGACTCTGGTTGCGGTGGGCAGG + Intronic
1083865151 11:65449627-65449649 GGCTTGTGGTTGGGGGGTGTTGG - Intergenic
1083968761 11:66059438-66059460 GGCTTAAGGTTGGGGTGGGTTGG + Intronic
1085399297 11:76225994-76226016 GGCCTTTGGGCTGGGTGTGCAGG - Intergenic
1088192926 11:107245659-107245681 GGACTAGGGTTGGGGTCTTCTGG - Intergenic
1089123343 11:116158215-116158237 GGACTAGGGGTGGGGGGTGCAGG + Intergenic
1089631691 11:119788227-119788249 GGCCTCTGCTTGGGGTGAGATGG + Intergenic
1090182628 11:124714112-124714134 GGCCTTTGGTTGAGGGATGCAGG - Intergenic
1091376355 12:26995-27017 GCCCTGTGGTGGGGGCGTGCCGG - Intergenic
1094153198 12:27309560-27309582 GGCCTTTCCTTGGTGTGTGCGGG + Intronic
1095778348 12:46033350-46033372 GGGCTATGGAGGGGGTGTGGAGG - Intergenic
1099587977 12:84545943-84545965 GGCCCATGGTTGGCATGTGCAGG + Intergenic
1100162322 12:91874785-91874807 GGCCTATGGAGGGGCTGTGTGGG + Intergenic
1101377608 12:104184389-104184411 GGCATATGATGGGGGTGTGGGGG + Intergenic
1102969895 12:117158027-117158049 GGTCTAGGGTTTGGATGTGCTGG + Exonic
1103408877 12:120696439-120696461 GGCATAGGGGTTGGGTGTGCGGG - Exonic
1104896678 12:132168254-132168276 GGCCTTTGGTTGGGCTGGACTGG + Intergenic
1105831807 13:24169226-24169248 GGCCTGTGGTTGGAATGTGATGG + Intronic
1106007832 13:25787748-25787770 GTCCCATGGTTGGGGAGTCCTGG + Intronic
1106047486 13:26157031-26157053 TGCCTAGGGTTGGGGTGTTGAGG + Intronic
1113092546 13:106630562-106630584 GGCCTTTCCTTGGGGTCTGCAGG + Intergenic
1119428175 14:74549552-74549574 GGCATCTGGGAGGGGTGTGCAGG + Intronic
1119703897 14:76772427-76772449 GGCCTGTGGCTGCTGTGTGCTGG + Intronic
1120759360 14:88272033-88272055 GACCTATGGTAGGGGTAAGCTGG - Intronic
1121024625 14:90606263-90606285 GGCCTATGGTTGGGGTGTGCTGG + Intronic
1121045008 14:90781510-90781532 GGCCTGTGGCTGGGCTGGGCCGG + Intronic
1122824375 14:104362488-104362510 GGCCTGTGGAGGGGGTGTGGGGG + Intergenic
1124125199 15:26932937-26932959 GGCCTGTGGTGGGGTAGTGCGGG + Intronic
1125688111 15:41575602-41575624 GGCCCCTGCTGGGGGTGTGCTGG + Intronic
1128986176 15:72223202-72223224 GGACTGTTGTTGGGTTGTGCTGG + Intronic
1132552196 16:558141-558163 GCCCTGTGGTTGCGGGGTGCTGG + Intergenic
1133232396 16:4372811-4372833 GGCCCAGGGGTGGAGTGTGCAGG + Intronic
1137472863 16:48777198-48777220 GGCTTAGTGTTGGGGTGTGTGGG + Intergenic
1138346299 16:56322379-56322401 GGCCTATGGGTTGTGTGTGGTGG - Intronic
1141464214 16:84195842-84195864 GGCGCATGGGTGGGCTGTGCGGG - Exonic
1142029670 16:87832264-87832286 GCCCCAGGGTTGGGGGGTGCCGG - Exonic
1142504534 17:354465-354487 GGCCTGGGGCTGTGGTGTGCGGG - Intronic
1143527015 17:7478990-7479012 GCCCCAGAGTTGGGGTGTGCGGG - Intronic
1144512102 17:15886284-15886306 AGCCTGAGGTTGGGGTGTACGGG - Intergenic
1148019748 17:44545735-44545757 GGCCTATCATTGGTGTGTGTAGG - Intergenic
1149114265 17:53073039-53073061 GGCCTATCATTCTGGTGTGCAGG + Intergenic
1149943686 17:60898875-60898897 GGCCTGTGGTTGGAGCTTGCAGG + Intronic
1150266134 17:63833533-63833555 GGCCCAGGATTGGGGTGGGCTGG - Intronic
1150300431 17:64043242-64043264 GGCCTTTGGTGGGTGTGTCCCGG - Exonic
1151542656 17:74772621-74772643 GTCCCATAGTTGGGGTGGGCTGG - Intronic
1151765599 17:76131881-76131903 GGCAGCTGGTAGGGGTGTGCGGG + Intergenic
1152240522 17:79158545-79158567 GGGCTCTGGTTGGGGTGTTTAGG - Intronic
1152486342 17:80596478-80596500 GGGCATAGGTTGGGGTGTGCAGG + Intronic
1154330036 18:13421857-13421879 GGCCTGGGGCTGGGGTGGGCAGG + Intronic
1155506131 18:26535097-26535119 GGCCTGGGGTTGGGGGGTGGGGG + Intronic
1158017147 18:52797665-52797687 GGCCTCTGGATGGTGTGTGCAGG + Intronic
1160634687 19:66540-66562 GCCCTGTGGTGGGGGCGTGCCGG - Intergenic
1161236510 19:3201058-3201080 GGCATGTGGTCGGGCTGTGCAGG + Intronic
1161349249 19:3783293-3783315 GGCCTCTGGGTGGGGTGGGTGGG + Intronic
1161723760 19:5917152-5917174 GGCCTATAGTTGGGGAGCCCTGG + Exonic
1162019041 19:7860428-7860450 GGCCCAGGCTTGGGGTGTCCTGG - Intronic
1162050315 19:8028791-8028813 GGCCTGGGGTTGGGGGGTGTGGG + Intronic
1162829509 19:13275740-13275762 GGTCTAGGGATGGGGTGTGTGGG - Intronic
1163084749 19:14971393-14971415 GGGCTATGGTATGGATGTGCAGG - Intronic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1163746987 19:19054538-19054560 AGCATAGGGTTGGGGTGTGTCGG + Intronic
1165073765 19:33269701-33269723 GGCCTTGGGATGGGGTGTGGGGG + Intergenic
1165150217 19:33755900-33755922 GGCCTTTGGTGGAGATGTGCAGG + Intronic
1166121100 19:40687194-40687216 GGCATATGTTGGGGATGTGCTGG + Intronic
1166193013 19:41188220-41188242 GGCGTATGGGTGGGGTGGGGTGG + Intergenic
1168089327 19:54071745-54071767 GGCCTGGGGTTGGGGGGTGGAGG + Intronic
925348624 2:3187017-3187039 GGCCCAGGGTTGGGGTGGGGTGG - Intergenic
925348690 2:3187406-3187428 GGCCTTGGGGAGGGGTGTGCTGG - Intergenic
926383411 2:12313539-12313561 GGCCTTGGGTTGGGGTTTACTGG - Intergenic
928272030 2:29865093-29865115 AGCTTATGGTTGGGGTGTTCTGG + Intronic
929983230 2:46699597-46699619 GGCCTCTGGCTGGGATGGGCTGG + Intronic
932417506 2:71582497-71582519 GGATAATGGTTGGGTTGTGCAGG + Intronic
933895531 2:86807510-86807532 GGCGTATGGGTGGGGTTTGCAGG + Exonic
936239650 2:110776600-110776622 GGCCTAAGGTGGGAGTGTCCTGG + Intronic
936566790 2:113588487-113588509 GCCCTGTGGTGGGGGCGTGCCGG + Intergenic
937137509 2:119566727-119566749 TGCCTCTGAGTGGGGTGTGCGGG - Intronic
938239771 2:129734464-129734486 AGCCTCTGGCTGGGGTGGGCTGG + Intergenic
938928398 2:136064985-136065007 CGCCCATGGTGGGGGTGTTCAGG + Intergenic
941439349 2:165514231-165514253 GCCCTATGGTTGGGCTTAGCAGG - Intronic
943004084 2:182368331-182368353 GGCCTTTGGGTGGGGGGGGCTGG - Intronic
943480004 2:188405404-188405426 GGCCTAGAGCTTGGGTGTGCTGG - Intronic
946049176 2:216847506-216847528 GGGCTATGTCTGGGGTGTCCAGG - Intergenic
946351935 2:219160859-219160881 GGCCTATGCCTGGCGTGGGCGGG + Intronic
1175110832 20:56646786-56646808 GCCCTGAGGTGGGGGTGTGCTGG + Intergenic
1175156154 20:56973026-56973048 AGCCTATGGGTGGGGGGTCCTGG - Intergenic
1175902729 20:62366522-62366544 GGCCTCTGGATGGGGTGGGAGGG - Intronic
1181107225 22:20582527-20582549 GGCCTATGCGTGCGGTGGGCAGG + Intronic
1181115815 22:20632056-20632078 GTCCTATGGTTGGGGTGGTGGGG + Intergenic
1182379951 22:29879933-29879955 GGCCTATGGGTGGGCTGTCCTGG + Intergenic
1183519839 22:38290522-38290544 GGGCTGTGGTTGGGATGTCCGGG - Intergenic
950473353 3:13199853-13199875 GGCATATGTGTGTGGTGTGCTGG - Intergenic
951805139 3:26635507-26635529 GGCCTTTCCTTGGTGTGTGCAGG - Intronic
954684434 3:52362691-52362713 TGCCTATGGATGTGGTGTGGAGG + Intronic
954696199 3:52428328-52428350 GGCCTGTGGGTGGGATGTCCTGG - Intergenic
955525312 3:59813840-59813862 GGCCTATGGTTAGGCTATGAAGG + Intronic
957507165 3:81136826-81136848 GGCCTGTGGTGGGGGTGAGGGGG - Intergenic
961715726 3:128856172-128856194 GACCTATGGTTGGGGGTGGCTGG + Intergenic
967094220 3:186163410-186163432 GGCCTCTGGTCTGGGTGAGCAGG + Intronic
972260741 4:37406264-37406286 GGCCAATGCTTGGGATGTGTCGG - Intronic
984932191 4:184857848-184857870 GGCCTAGGAATGGGGGGTGCAGG + Intergenic
985769421 5:1799617-1799639 GGGCCAGGGTTGGGGGGTGCGGG - Intronic
986006405 5:3672411-3672433 GGGCCATGGCTGGAGTGTGCAGG + Intergenic
986069306 5:4266413-4266435 GGCCTGTTGTTGGGGTGAGAAGG - Intergenic
988499668 5:31774104-31774126 GGCTTAGGGCTGGGGTGAGCTGG - Intronic
990526929 5:56637327-56637349 GGCTTGAGGTTGGGGTGGGCAGG - Intergenic
994727523 5:103453986-103454008 GGGCTAAGGTTGGGGTGGGATGG + Intergenic
997527889 5:134565181-134565203 GGTCTATAGTTTGGGAGTGCAGG + Intronic
998147529 5:139738790-139738812 GGCCCAGGGTGGGGGTGTGTCGG - Intergenic
999681997 5:154069281-154069303 GGCTGATGGCTGGGCTGTGCAGG + Intronic
1002402504 5:178999002-178999024 GGCCTTTTCTTGGTGTGTGCAGG + Intergenic
1003818474 6:9867956-9867978 GGCCTATGTGTGGGGGGTGTGGG - Intronic
1006268942 6:32949325-32949347 GGCCTTTGGCCTGGGTGTGCTGG - Exonic
1006505493 6:34486204-34486226 GGCCTAGGGGTGGGGTGAGGTGG + Intronic
1008910854 6:56731081-56731103 GGCCCAGGGCTGGGGTGTGCAGG + Intronic
1011545013 6:88473610-88473632 GGCCTTTTGTGGGGGTGGGCAGG - Intergenic
1014214943 6:118744547-118744569 AGCATATGGTTGGGGTGGGGTGG - Intergenic
1015568363 6:134596686-134596708 GGCCTGGGGTGGGGGGGTGCAGG - Intergenic
1017973985 6:159338236-159338258 GGCCTCTTGATGGTGTGTGCAGG - Intergenic
1022498284 7:30866714-30866736 GGCCACTGGTGGGGGTTTGCAGG + Intronic
1024248006 7:47485032-47485054 GGCTTCTGGTTGGCGTCTGCAGG - Intronic
1024529136 7:50376289-50376311 GGCCTATGGATGGAGAGGGCTGG + Intronic
1025131283 7:56375377-56375399 GGCCGATGGTGGGCCTGTGCAGG + Intergenic
1028374005 7:90126043-90126065 GGCCTATTGGTGGGGGGTGGGGG + Intergenic
1030972926 7:116083682-116083704 GGAATATGGTTGGTGTGGGCAGG - Intronic
1031985721 7:128163571-128163593 GGCCTCTGGTTGGGGACTGGGGG + Intergenic
1037892434 8:22630369-22630391 GGCCTCTGGGTGGACTGTGCGGG - Intronic
1039990223 8:42481480-42481502 GGCCTAAGCTGGGGGTGGGCAGG + Intronic
1040292389 8:46132156-46132178 GGCCTCAGGGTGGGGTGGGCGGG - Intergenic
1040292586 8:46133022-46133044 GGCCTCTGGGTGGTGTGGGCGGG - Intergenic
1040307060 8:46217557-46217579 GGCCTCAGGTTGGCGTGGGCGGG + Intergenic
1042560870 8:70071363-70071385 GGCCAATGGCTGCGGTGGGCGGG - Intronic
1043523352 8:81070551-81070573 GGTCTGTGTTTGAGGTGTGCAGG - Intronic
1044345319 8:91097928-91097950 GGCCTAGGGTTGGGGTGGATGGG + Intergenic
1044954131 8:97462215-97462237 GGCTGAGGGTTGGGGTGTGGTGG - Intergenic
1044990554 8:97791659-97791681 GGCCTGTGAATGGGGTGTGGTGG + Intronic
1053030917 9:34777312-34777334 GGGCCCTGGTTGGTGTGTGCTGG + Intergenic
1053225252 9:36349658-36349680 TGCCTATGCTTGTGGTGTGATGG + Intronic
1053477843 9:38394969-38394991 GACCTGTGGTTGGGGGATGCTGG + Intronic
1056756863 9:89387128-89387150 GGCCTGTGGCTGGGCTGGGCTGG - Intronic
1058383978 9:104410924-104410946 GGCCTAGGGTTTTTGTGTGCTGG - Intergenic
1058595967 9:106615971-106615993 GGCCTATGGTTGTGGCGTATTGG + Intergenic
1058756162 9:108084800-108084822 GGCCCATGGTTGGGATTTGGTGG + Intergenic
1060402105 9:123355223-123355245 GGCCTCTTGTTGGGGTGGACAGG - Intergenic
1062465148 9:136677620-136677642 GGCCTGGGGGTGGGGTGTGGAGG + Intronic
1062526774 9:136981104-136981126 GGCTCATGGTTGGGGGGTGCAGG + Intronic
1062591216 9:137275650-137275672 GGCCTACGGGTGGGGAGTGAAGG + Intergenic
1191842769 X:65524870-65524892 GGCCCTGGGTTGGGGTGTGAAGG - Intronic
1199342335 X:146695618-146695640 GGCCTATGCTTATTGTGTGCAGG + Intergenic