ID: 1121025434

View in Genome Browser
Species Human (GRCh38)
Location 14:90612592-90612614
Sequence TGGTGCTGTCACTAATGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121025430_1121025434 -3 Left 1121025430 14:90612572-90612594 CCTCTCATCTCACCATGTTTTGG 0: 1
1: 0
2: 0
3: 10
4: 181
Right 1121025434 14:90612592-90612614 TGGTGCTGTCACTAATGAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 139
1121025429_1121025434 2 Left 1121025429 14:90612567-90612589 CCAGGCCTCTCATCTCACCATGT 0: 1
1: 0
2: 0
3: 24
4: 314
Right 1121025434 14:90612592-90612614 TGGTGCTGTCACTAATGAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121025434 Original CRISPR TGGTGCTGTCACTAATGAGG AGG Intronic
901396289 1:8984496-8984518 TGGTGATATCAATTATGAGGAGG + Intergenic
902182347 1:14698701-14698723 TGGTGCTGGCGCTGAGGAGGCGG - Intronic
904523818 1:31116615-31116637 TAGAGCTGTCACTAATGAGATGG - Intergenic
907405787 1:54252618-54252640 TGGTGTGGTTACTAATGAGAAGG + Intronic
907653503 1:56319259-56319281 TGGTGCAGGCACTGAAGAGGTGG - Intergenic
907928235 1:58974754-58974776 TGGTTCTGCCACTTATCAGGGGG - Intergenic
908666541 1:66497609-66497631 TGTTGCTGCAAGTAATGAGGAGG - Intergenic
908670548 1:66542843-66542865 TGGTTCTGCCACTAGTAAGGAGG - Intronic
910491895 1:87781858-87781880 TGCTGCCCTCACTAATGTGGAGG + Intergenic
913356543 1:117929181-117929203 TGGTGCTGTAGCCAAGGAGGCGG - Intronic
913551118 1:119917718-119917740 AGCTGCTGTCAATAATGTGGAGG - Exonic
915093253 1:153441284-153441306 TGGGGCTGGCACTAATAATGTGG + Intergenic
917299298 1:173556228-173556250 TAGTGCTGTCACAAATGACAAGG + Intronic
921704469 1:218306109-218306131 TGGTCCTGTCACTACTGTGAAGG + Intronic
923606703 1:235450499-235450521 TGGTGCTTTCCCAAATCAGGAGG - Intronic
1064639826 10:17404369-17404391 TGGTGCTGTGGACAATGAGGTGG - Intronic
1068306626 10:55218761-55218783 TGGAGCTATCTCAAATGAGGGGG + Intronic
1068610864 10:59058452-59058474 TGGTGCACTGACTAATGATGAGG - Intergenic
1069374580 10:67781060-67781082 TGGTGCTGGGAGTAAGGAGGGGG + Intergenic
1072101259 10:92231580-92231602 TGGCTCTGTCACTAGTGATGAGG - Intronic
1075715538 10:124553147-124553169 TGGTGCTGCCACTCATCAGCTGG - Intronic
1075910818 10:126124239-126124261 TGGTGCTGTCAATCATGTGGTGG + Intronic
1076270339 10:129147138-129147160 TCGTCCTGTCACTTTTGAGGGGG - Intergenic
1076651827 10:131995072-131995094 TGTTGCTCTTACAAATGAGGTGG - Intergenic
1076828061 10:132980343-132980365 GAGTTCTGTCTCTAATGAGGAGG + Intergenic
1078176399 11:8974666-8974688 TGGAGCTGACCATAATGAGGAGG - Intergenic
1078445139 11:11398514-11398536 TGGTTCTGCCACTTATGAGCTGG - Intronic
1082122868 11:48398221-48398243 TGGAGCTCTCACTAATAAGATGG - Intergenic
1082267531 11:50135579-50135601 TGGTGTTATCACTATAGAGGGGG - Intergenic
1082716891 11:56625084-56625106 TGGATCTGTAACTAATGAGAGGG - Intergenic
1082940556 11:58700954-58700976 TGGAGCTGTCACTTGTGATGTGG + Intronic
1085937567 11:81168103-81168125 TTGTGCTGTCACTGATGATTTGG + Intergenic
1090794864 11:130126083-130126105 TGGTTCTGTCACTGATGGTGGGG + Intronic
1092765790 12:11851477-11851499 TGGTGATGTCTCTGATGAGGCGG - Intronic
1093097135 12:14984422-14984444 TGATGCTGTAAGTAATCAGGAGG + Intergenic
1093284382 12:17240303-17240325 TGGTGCTATCATTGATGAGCAGG - Intergenic
1096205098 12:49714854-49714876 AAGTGCTGTCAGTAAGGAGGGGG - Intronic
1096496078 12:52040202-52040224 TTGTGATGTGACTATTGAGGGGG + Intronic
1099151187 12:79116035-79116057 TGGTTCTGTCACTAACTAGCTGG + Intronic
1101889014 12:108695161-108695183 TGGTGCTGGCAGTCATCAGGAGG + Intronic
1104484100 12:129134723-129134745 TGGTGCTGTCACTTGTTAGAGGG + Intronic
1106921980 13:34573933-34573955 TGTTGCTGTCATTGTTGAGGAGG + Intergenic
1109327804 13:60890471-60890493 TAGTGCTGCCACTGAGGAGGTGG + Intergenic
1110826913 13:79981600-79981622 TGGTGATGTCAATAGTGGGGAGG - Intergenic
1113272194 13:108685871-108685893 TGGTGCCCTCACAAATAAGGAGG - Intronic
1121025434 14:90612592-90612614 TGGTGCTGTCACTAATGAGGAGG + Intronic
1122648805 14:103213660-103213682 GGGGGCTGTCAATAATCAGGTGG - Intergenic
1124859664 15:33426669-33426691 TGGTTCTGCCACTAATCAGCTGG - Intronic
1128353666 15:66909163-66909185 TGTTGTTGTCACTAAGGATGTGG + Intergenic
1129657195 15:77532074-77532096 TGGTGCTGTCACTATGGCTGGGG + Intergenic
1129904664 15:79178022-79178044 TGCTGCTGTCACTGATGCTGTGG + Intergenic
1131923555 15:97356827-97356849 TGGTGCAGTCAAAAAGGAGGAGG - Intergenic
1133094144 16:3429527-3429549 TGGTGCTGTCACTTACTAGTAGG - Intronic
1133875284 16:9728122-9728144 TGGTGCTGTCACACATGAGCTGG + Intergenic
1137718459 16:50613114-50613136 TGGCGGTGTCACTTCTGAGGTGG + Intronic
1137922940 16:52509998-52510020 TGCTGCTGGTAATAATGAGGAGG + Intronic
1141366071 16:83444520-83444542 TGGTTCTGCCACTCATCAGGTGG - Intronic
1141589413 16:85057918-85057940 TGTTGGGGTCACCAATGAGGAGG - Intronic
1141699219 16:85634847-85634869 TGCTGCTGGCACAAATGGGGAGG + Intronic
1149617680 17:58015151-58015173 TGGTGCTGACACTAATATGAGGG - Intergenic
1151655307 17:75493077-75493099 TGGTGGTGTCTTTAATGAAGAGG - Exonic
1154094689 18:11401696-11401718 TTGTGATGTCACTAATGCAGCGG - Intergenic
1155297052 18:24394944-24394966 TGGTACTGTCAGTATTAAGGGGG - Intronic
1157819322 18:50753878-50753900 TTGTGCTAACACTCATGAGGTGG - Intergenic
1160377181 18:78421855-78421877 TGGGGCTGTCACTACTGGAGCGG + Intergenic
927409646 2:22809484-22809506 TGTTGCAGACACTAATGACGGGG + Intergenic
927897579 2:26794282-26794304 TGATGCTGCCACTAATGGTGAGG - Exonic
929258391 2:39838783-39838805 AGGTGCTGTCTGTGATGAGGAGG + Intergenic
930625613 2:53694275-53694297 TGGTGCTGTCACCCATGAGAAGG - Intronic
931928047 2:67096618-67096640 TGGTGCTGTCATTGAGAAGGAGG + Intergenic
933294493 2:80473596-80473618 TGGAGCTTTCACTGGTGAGGTGG - Intronic
949070176 2:242019645-242019667 TGGTGCTGGCATTTAAGAGGGGG + Intergenic
1168771049 20:417204-417226 TGGTGGTTTCACTAAGGAGCAGG + Intronic
1172838396 20:37887458-37887480 TGCTGGTGTCACTAATGGGTGGG + Intergenic
1173132506 20:40408058-40408080 TTGTGCTGTCACTGATGGGTGGG + Intergenic
1173599621 20:44284223-44284245 TCATGCTGTAACTAATGAGCAGG - Intergenic
1177716876 21:24850116-24850138 TGGAGCTATCACTAAAGAGGTGG - Intergenic
1183313505 22:37124551-37124573 TTCAGCTGTCAGTAATGAGGAGG + Intergenic
1184243526 22:43223815-43223837 CGAGGCTGTCACTCATGAGGTGG - Intronic
1185361100 22:50407440-50407462 TTGTGCTGTCACTGACCAGGTGG + Intronic
953136693 3:40188035-40188057 TGGGGCTTTCACTGACGAGGAGG - Intronic
953200623 3:40775443-40775465 TGGTGCTGTCTCTTATGTGCAGG + Intergenic
955777753 3:62451566-62451588 TCGGGCAGTCACTAATGCGGTGG - Intronic
956086396 3:65615562-65615584 TGCTGCTGGCATTTATGAGGAGG + Intronic
956909262 3:73800412-73800434 TGGTGGTCTCACTATGGAGGGGG - Intergenic
958844303 3:99247077-99247099 TGCTACTGTCATTAATGAAGTGG - Intergenic
958844306 3:99247117-99247139 TGCTACTGTCATTAATGAAGTGG - Intergenic
961606171 3:128097094-128097116 CTGTCCTGTCACTCATGAGGAGG - Intronic
962118994 3:132542116-132542138 TGGAGCTGTCACCAATAAGTGGG + Intergenic
962249120 3:133824192-133824214 TGGTGCAGTCATAAATGGGGGGG - Intronic
963259398 3:143177555-143177577 TGGGGATGTCACTGAAGAGGGGG - Intergenic
964743663 3:159991601-159991623 TGCTGCTGTCACAAATGTAGTGG + Intronic
966947925 3:184790446-184790468 TGGTTCTGTCACTTATGAGCTGG - Intergenic
969643530 4:8413073-8413095 TGGGGCTGTCAGTGCTGAGGAGG - Intronic
970474870 4:16412083-16412105 TGGTGCTCTCAGTAAAGAAGGGG + Intergenic
972644981 4:40959007-40959029 TATTGCTGTCACTCATTAGGTGG - Intronic
972771146 4:42198152-42198174 TAGTGCTGGCATTAATGAGATGG + Intergenic
975383693 4:73730987-73731009 TGGTGGTGGAAATAATGAGGAGG - Intergenic
975741564 4:77434325-77434347 TCGTGCAGTCACTAAAGATGTGG + Intergenic
975834905 4:78412326-78412348 TGGTCCAGTAACTGATGAGGAGG + Intronic
983368253 4:166824038-166824060 TGGTGATGTCACTCAGGAGCAGG - Intronic
985151889 4:186955604-186955626 TGGGGTTGTCACAACTGAGGAGG + Intergenic
986043851 5:4019001-4019023 TGGTGTTGTCACCACTGAGAGGG - Intergenic
986070764 5:4280258-4280280 TTCTGCTTTCACAAATGAGGTGG + Intergenic
986256134 5:6102245-6102267 TGGTGGCCTCACTAATGAGTTGG + Intergenic
986301007 5:6478390-6478412 TGGTGCTTTCACTGCTGAGGTGG - Intronic
989570679 5:42943525-42943547 TGGGGATGTTACTAAGGAGGAGG - Intergenic
992365693 5:76086874-76086896 TACTGCTGTCCCTAATTAGGAGG - Intronic
995052154 5:107719265-107719287 TGGTGGTGTGGCTCATGAGGGGG - Intergenic
995916711 5:117255480-117255502 AGCTGCTGTCACTACTAAGGAGG + Intergenic
998477254 5:142432418-142432440 TGATGATGTCACTGATGAAGGGG - Intergenic
999371092 5:151055817-151055839 TGGCTCTGTCACTAAGGTGGCGG + Intronic
1000130381 5:158291445-158291467 TCTTGCTGTCACAAATGGGGAGG - Intergenic
1000879223 5:166677963-166677985 TGGTGCTGCCACTTCAGAGGAGG + Intergenic
1001699694 5:173697897-173697919 TGTTACTGTCATTAATGAGCTGG - Intergenic
1002181659 5:177433957-177433979 TGGTGCTGACACTGATGAACGGG + Exonic
1005394274 6:25365221-25365243 TGATGCTGCCACAAATGATGAGG + Intronic
1006186875 6:32186424-32186446 TGGGGATGTCACTGAAGAGGGGG + Exonic
1006235642 6:32629214-32629236 TTTTGTTGTCACTAATGGGGAGG + Intronic
1006272394 6:32974360-32974382 AGGTGCTGGCCCTAGTGAGGTGG - Intronic
1012235649 6:96811316-96811338 TTCTGCTGTCAGTAATGAGTTGG - Intronic
1012745940 6:103088767-103088789 TCTTTTTGTCACTAATGAGGAGG + Intergenic
1015040833 6:128716794-128716816 TTGTGCTGCCACTTACGAGGTGG + Intergenic
1018455633 6:163949526-163949548 TGGTGCTTTCATTAAAGAGAAGG - Intergenic
1024148876 7:46547060-46547082 GGGTGCTGACAATAATGTGGAGG + Intergenic
1024293028 7:47819580-47819602 TGCTGGTTTCACAAATGAGGAGG + Exonic
1024632891 7:51263665-51263687 TGGTGCTGACACCAGTGAGCTGG - Intronic
1026121643 7:67542855-67542877 TCCTGCTGCCACTGATGAGGTGG - Intergenic
1026261068 7:68755838-68755860 AGGTGCTGCCACTAAGGAGATGG + Intergenic
1026448709 7:70508255-70508277 TAGTGCTGTCAAAAAGGAGGGGG + Intronic
1029371823 7:100155251-100155273 TGGTTCTGTACCTCATGAGGTGG + Exonic
1039743986 8:40407256-40407278 TGGTGTTGTCTCTACTGAGAAGG - Intergenic
1043678092 8:82986728-82986750 TGGTGCCGTCAATAATGAAATGG - Intergenic
1047279967 8:123436903-123436925 TCGTGCTGTCACCATTGAGAGGG + Intronic
1048964821 8:139607929-139607951 TGGTCCTATTACAAATGAGGAGG + Intronic
1050136429 9:2470344-2470366 TGGTGCTTTCAGTAATGAGCAGG + Intergenic
1052036865 9:23692718-23692740 TGGAGCTGTCACCAATGTGAAGG - Exonic
1056690975 9:88808476-88808498 TGGTCCTGTTACCAATTAGGAGG - Intergenic
1059385925 9:113964193-113964215 AGGTGCTGCCACAAATGTGGGGG - Intronic
1060702305 9:125767051-125767073 TGTTGCTGTCGCTCATCAGGTGG + Intronic
1060750611 9:126166014-126166036 GGCTGCTGTCACTGATGTGGTGG + Intergenic
1060813352 9:126622412-126622434 TGGGGCTGGCAGGAATGAGGAGG + Intronic
1060899713 9:127246434-127246456 TGGTGTTGTCATTAATAAGAGGG + Intronic
1186857014 X:13636379-13636401 TGGTGCAGTGACTGAGGAGGAGG - Intergenic
1187531678 X:20102806-20102828 TGGTGATCCCACTAATGAGAAGG + Intronic
1190257309 X:48773312-48773334 TTGTGATGTCCCTATTGAGGAGG + Exonic
1194331603 X:92590462-92590484 TGGTGCTGTCTCTGCTGATGAGG + Intronic
1200640309 Y:5709518-5709540 TGGTGCTGTCTCTGCTGATGAGG + Intronic
1201325638 Y:12754701-12754723 TGGTTTTGTCACTGAAGAGGTGG + Intronic