ID: 1121025535

View in Genome Browser
Species Human (GRCh38)
Location 14:90613517-90613539
Sequence CTCCTAGAATACAGGACAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121025531_1121025535 -2 Left 1121025531 14:90613496-90613518 CCAATCAAGATTTACATTTGACT 0: 1
1: 0
2: 0
3: 22
4: 367
Right 1121025535 14:90613517-90613539 CTCCTAGAATACAGGACAAGGGG 0: 1
1: 0
2: 4
3: 14
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121025535 Original CRISPR CTCCTAGAATACAGGACAAG GGG Intronic
905178908 1:36155133-36155155 CTTCTAGAAGTCAGGACAAAGGG + Intronic
905837284 1:41136898-41136920 CTCCTAAAAGCCAGGACAACAGG + Intronic
906015441 1:42574147-42574169 CTTCTAGAAGACAGAAAAAGAGG - Intronic
909967610 1:81935088-81935110 ATCCTAAAATTCAAGACAAGAGG - Intronic
910482112 1:87670077-87670099 CTCTTTGAATACAGAACATGTGG - Intergenic
910604210 1:89066062-89066084 CTTCTAGCATACAGAATAAGTGG + Intergenic
911239027 1:95444882-95444904 CTTCTAGAATAAAGCACAAGAGG - Intergenic
915841451 1:159216512-159216534 CCCCCAGACAACAGGACAAGTGG + Intergenic
919045317 1:192443725-192443747 CTTCCAGAATAGAGGACAAATGG - Intergenic
920395325 1:205641254-205641276 CTCCTAGAATACAGAAGAGATGG - Intergenic
922058663 1:222066333-222066355 CTCTTAGAAAACATGAAAAGAGG - Intergenic
924653959 1:245955957-245955979 CTCCTAGAAGACACATCAAGAGG - Intronic
1064136190 10:12752895-12752917 TTCCTTGAGTACATGACAAGTGG - Intronic
1065271020 10:24034214-24034236 CTCCTGGATTACATAACAAGTGG + Intronic
1065495077 10:26319300-26319322 CTCCTAGAACACTGGACCCGTGG - Intergenic
1070182875 10:74031366-74031388 CTGATAGGCTACAGGACAAGAGG - Intronic
1071562190 10:86653052-86653074 CTCCTCTAAGACAGGGCAAGGGG + Intergenic
1071690090 10:87808923-87808945 CTTCTAGAATATAGGAAACGAGG - Intronic
1072638136 10:97190462-97190484 CTCCTAGACTAAAGGTCAAGTGG + Intronic
1073883790 10:108014231-108014253 CTCTTAGAACACAGGAAGAGTGG - Intergenic
1074679161 10:115886131-115886153 CTCATAGTATGCAGGACAAATGG + Intronic
1077664059 11:4092637-4092659 CTCCTAGGGCTCAGGACAAGTGG + Exonic
1083768776 11:64854901-64854923 CTCCCAGACTCCAGGCCAAGTGG + Intronic
1088454753 11:110021881-110021903 TTCCTACAAGACAGGTCAAGGGG + Intergenic
1088802769 11:113321276-113321298 CTCCTACAAAAGAGTACAAGAGG - Intronic
1092091014 12:5803692-5803714 TTCCTAGAAGCCAGGACAACCGG - Intronic
1092283105 12:7112247-7112269 CTGCTGGTATAGAGGACAAGGGG + Intergenic
1092335249 12:7627381-7627403 CTCCCAAAATACAGTAAAAGGGG - Intergenic
1093936288 12:25004308-25004330 CTCCTAGTATACAGATGAAGTGG - Intergenic
1099825130 12:87766397-87766419 CTCTTTGCTTACAGGACAAGAGG - Intergenic
1101395129 12:104340545-104340567 CTACTAGAAGACAGAAGAAGAGG - Intronic
1103277296 12:119723138-119723160 CCCCTAAAATACAGGAAAAAAGG + Intronic
1107636536 13:42397867-42397889 CTCAAAGAATAAAGGACAAGCGG - Intergenic
1109000258 13:56792534-56792556 CTCCTAGAAGAAAGCATAAGAGG - Intergenic
1109078497 13:57867617-57867639 CTCTTATAATACAGGTCTAGTGG - Intergenic
1111595143 13:90401787-90401809 GTCCTAGAAAACTGGAGAAGCGG + Intergenic
1121025535 14:90613517-90613539 CTCCTAGAATACAGGACAAGGGG + Intronic
1125740302 15:41958221-41958243 CTCCGAGAACACAGGAAAGGGGG - Intronic
1133636549 16:7671748-7671770 CTCCTAGAATAGAGGTGAGGTGG + Intronic
1134362173 16:13541827-13541849 CTCACAGAATAAAGGACAAGAGG + Intergenic
1138506009 16:57478621-57478643 CCCCTAGAAGACAGGAGCAGAGG - Intronic
1139729983 16:68935198-68935220 ATCCTGTACTACAGGACAAGTGG - Intronic
1140412785 16:74751436-74751458 GTCCTAGAATTCATGACAACTGG + Intronic
1142310390 16:89309034-89309056 CTTCTAGAAGACAGCACAGGAGG + Intronic
1142892351 17:2952299-2952321 CTCATACAATAAACGACAAGAGG - Intronic
1143613179 17:8032287-8032309 CTACTAGAAAACAGAACAAAAGG + Intergenic
1147013080 17:37467486-37467508 CTCCAAGAATACAGGACAGCAGG + Exonic
1148046684 17:44749024-44749046 CTCCTGGGATACAGGGCCAGTGG - Intronic
1149028967 17:52062719-52062741 CTCCTAGAATGCAAGAGCAGTGG + Intronic
1150478174 17:65489461-65489483 CCCCTAGAACACAGAACAAGTGG - Intergenic
1152635099 17:81427615-81427637 CTCCTAGGCTGCAGGGCAAGGGG - Intronic
1152706012 17:81844090-81844112 ATCCTGGGATACAGGAAAAGGGG + Exonic
1153569837 18:6458612-6458634 CTTCCAGAATATAGAACAAGAGG - Intergenic
1154012488 18:10587740-10587762 CTCCCAGAATCCTGAACAAGAGG + Intergenic
1154136704 18:11786062-11786084 CTCCCAGAAATCAGGAGAAGGGG + Intronic
1157661078 18:49445502-49445524 CTCCCATAATAAAGAACAAGAGG + Intronic
1158280658 18:55822047-55822069 CTCCAAGAAGACAGAAAAAGTGG - Intergenic
1162574891 19:11493549-11493571 CCTGCAGAATACAGGACAAGGGG - Intronic
1164752270 19:30665758-30665780 CTCCTAGAAAACAGGTTAAGGGG + Intronic
1167456506 19:49599121-49599143 CTCCTAGAATCTAAGACAAGGGG + Intronic
925475784 2:4212719-4212741 CTCCTAGAAGAAAACACAAGGGG - Intergenic
931132583 2:59353786-59353808 CTACTAGAATAAAGGCCATGGGG - Intergenic
931690472 2:64831221-64831243 TTCCTGGAAAACAGCACAAGGGG - Intergenic
932139896 2:69266236-69266258 CTAATAGAAGACAGGAAAAGAGG + Intergenic
934905880 2:98202719-98202741 CTTCTAGAAAAAAGGACACGGGG - Intronic
935287726 2:101580098-101580120 ATCCTAGAGTCCAGGAGAAGAGG + Intergenic
937407757 2:121646406-121646428 TTCCTAGAAAACAAGAGAAGAGG - Intronic
941332808 2:164200213-164200235 CTCCTAGAAGAAAAGACAGGGGG + Intergenic
943157354 2:184199589-184199611 CTCCTCTAATCCAGCACAAGAGG - Intergenic
943293914 2:186113308-186113330 CTCCTATAAGACAGGCCTAGTGG + Intergenic
1168872573 20:1143523-1143545 CTCCTAGAAGAAAACACAAGAGG + Intronic
1169981234 20:11386697-11386719 CTCTCAGAATACAGAAAAAGAGG - Intergenic
1172723713 20:37019355-37019377 AACCTATAATACAGTACAAGGGG - Intronic
1177676356 21:24305956-24305978 CTCATATAATACAGGACTTGAGG + Intergenic
1178380151 21:32100818-32100840 CTACTGGAATACAGGCCAATAGG - Intergenic
1178715122 21:34957481-34957503 CTCCTGGAATTCTGGGCAAGGGG + Intronic
950701896 3:14756670-14756692 CTCCAAGACTAAAGGACAAGTGG + Intronic
953398921 3:42595396-42595418 CTACTAGTTTACAGGAAAAGTGG - Intronic
953566818 3:44039142-44039164 CTGCTAGAATAAAGGATATGGGG + Intergenic
954304880 3:49720350-49720372 TTACTAGAATACAGGACTTGGGG + Exonic
957243279 3:77686254-77686276 TCCTTAGAATACAGGACAATTGG + Intergenic
960234493 3:115266047-115266069 CTCCTAGAAAACAAAACAAAAGG + Intergenic
960581138 3:119279806-119279828 CTCCAAAGATACAGCACAAGAGG + Intergenic
965832238 3:172805383-172805405 CTCCTAGAATTCAGGAGAAGAGG - Intronic
966542569 3:181108159-181108181 CTCCCAGAATACTAGAAAAGTGG + Intergenic
967356858 3:188581554-188581576 CTCATTGACCACAGGACAAGTGG + Intronic
968032661 3:195514341-195514363 CTCCTGGTATCCAGGGCAAGTGG + Intergenic
970452835 4:16189135-16189157 CTCCTTGAATACAGTATAACAGG + Intronic
970691130 4:18621875-18621897 TTCCAAGGATACAGGATAAGAGG - Intergenic
972378119 4:38492400-38492422 CAACTAGAATACAGGAGAGGAGG + Intergenic
974982755 4:68980484-68980506 CTCTTACAATACAGAACATGAGG + Intergenic
975008466 4:69320409-69320431 CCTCTGGAATACAGGAAAAGTGG + Intronic
975017794 4:69445527-69445549 CTCTTACAATACAGAACATGAGG - Intergenic
977595863 4:98879178-98879200 TTTCTAGAATACTGAACAAGAGG + Intronic
978655847 4:111064612-111064634 CTCCCAGAATACAGGGGGAGGGG - Intergenic
979799845 4:124894896-124894918 CTCCAAGGACACTGGACAAGTGG - Intergenic
980663008 4:135891245-135891267 GTGCTAGAATACAGAACAACTGG - Intergenic
981797670 4:148615583-148615605 CTCCTAGAAAACAGTACTAAGGG + Intergenic
982609440 4:157554929-157554951 CAACTAGAAGACAGAACAAGGGG + Intergenic
983307497 4:166010743-166010765 CTTCTAGAATAAAACACAAGGGG - Intronic
986371822 5:7087842-7087864 CTTCTTGGATACTGGACAAGAGG + Intergenic
987370702 5:17190117-17190139 CTCCCTGACTACAGGTCAAGTGG - Intronic
988371416 5:30373084-30373106 CTTCTAGGAAACAGGACAAAAGG + Intergenic
990968535 5:61477222-61477244 AACCTAGAATAGAGGAAAAGAGG + Intronic
991254753 5:64601673-64601695 GTCCTAGAATGTAGGACAGGAGG - Intronic
991263874 5:64693960-64693982 CTCCTGAAATCAAGGACAAGTGG + Intronic
993748181 5:91628696-91628718 GTCCTAGGATTCAGGAAAAGAGG + Intergenic
995084528 5:108092171-108092193 CTCCTAGTATGCTGGACCAGTGG + Intronic
999766978 5:154748580-154748602 CAAGTAGAATTCAGGACAAGTGG + Intronic
1000500461 5:162042376-162042398 CTCTTAAAAAACAGGTCAAGAGG - Intergenic
1001656654 5:173355879-173355901 CTCCCAGAAAACAGGTCAAATGG - Intergenic
1003142514 6:3483162-3483184 GTCCTAGAAAAGAGGCCAAGAGG - Intergenic
1003300358 6:4875160-4875182 CTGCTAGGATGCAGGACAACAGG - Intronic
1003511697 6:6786610-6786632 CTCCCAGAAAACAGAACCAGAGG + Intergenic
1005822795 6:29611593-29611615 CTCTTTGTATCCAGGACAAGAGG - Intronic
1009473701 6:64061186-64061208 CACCTAGAATAAAGGACACAGGG + Intronic
1013923173 6:115434937-115434959 CTGCTAGAATAAAGGGTAAGTGG - Intergenic
1015245583 6:131070770-131070792 CACCTAGAAAACAGGAAAAGAGG + Intergenic
1015486586 6:133777471-133777493 CCCCTAGAAAACAGGAAGAGAGG + Intergenic
1019999472 7:4747134-4747156 CTCCGAGATTACAGGAAACGCGG - Intronic
1022181253 7:27922884-27922906 CGCCTAGAAGCCAGGATAAGTGG + Intronic
1029989965 7:104954219-104954241 CACCTAGAATACAGGGTCAGAGG - Intergenic
1031093835 7:117394730-117394752 CTCCAAGAATACAACACAAAGGG - Intronic
1031739208 7:125407649-125407671 ATGCTAGATTACAGGACAATGGG + Intergenic
1032015734 7:128379334-128379356 GTCCTAGAATACAGGGCAGGAGG - Intergenic
1032707796 7:134436681-134436703 CTCCCAGAAAACAGGAAAAGAGG - Intergenic
1032808377 7:135381975-135381997 CTCTTAGAATAAAGGTAAAGTGG + Intronic
1034966320 7:155393432-155393454 ATCATCAAATACAGGACAAGAGG + Intronic
1039461251 8:37747153-37747175 CTCCTAGAAAGCAGGTCAAATGG + Intronic
1043284795 8:78515720-78515742 CTCCTAAAAGACTGGAGAAGTGG - Intergenic
1044089392 8:87980307-87980329 CTCCAAGAAAACAGAACCAGGGG - Intergenic
1044574138 8:93750184-93750206 TTCCTAGAATACATTACTAGTGG - Intergenic
1045101221 8:98846522-98846544 CTCCCAGAAAACAGGACCAAGGG - Intronic
1052393315 9:27907118-27907140 CTCCCAGAATAAAGGAAATGAGG + Intergenic
1053037372 9:34836638-34836660 CTCCTTGAATACAGAACTAAAGG + Intergenic
1053102157 9:35380223-35380245 GTCCTAGAACAAAGGGCAAGGGG - Intronic
1054742791 9:68825669-68825691 CTCCTAGCATAAAGGACCAGGGG - Intronic
1056280864 9:85040191-85040213 CTCCTAGAACGCAGGAGATGTGG + Intergenic
1060198580 9:121638890-121638912 CTCCTAGGATACAGGACATGGGG - Intronic
1186808159 X:13160857-13160879 CTCCAAGATCACTGGACAAGGGG - Intergenic
1190463681 X:50704723-50704745 CTCCTAGTAAGCTGGACAAGTGG - Intronic
1190812570 X:53898639-53898661 TATCTAGAATACAGCACAAGGGG + Intergenic
1190914985 X:54804786-54804808 CTCCCAGAATAAAGGCCATGAGG - Intergenic
1191750948 X:64542132-64542154 CTTCTAGAATACAGGAAAAGAGG + Intergenic
1191807995 X:65155884-65155906 CTTCTAGAATACAGGAAAAGTGG - Intergenic
1191849467 X:65575325-65575347 CTCCCAGAAAACAGAAAAAGAGG + Intergenic
1195402378 X:104475110-104475132 TTCCTACAATGCAGGACAATGGG - Intergenic
1199108179 X:143897093-143897115 CTCCGAGAATACAGCACACGTGG - Intergenic