ID: 1121026139

View in Genome Browser
Species Human (GRCh38)
Location 14:90617670-90617692
Sequence CATTGTGAACTGAGTCCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121026139 Original CRISPR CATTGTGAACTGAGTCCAGT GGG Intronic
902340007 1:15776933-15776955 AATTGAGAACTGTGTTCAGTGGG - Intronic
904815063 1:33189898-33189920 CATTTTACAGTGAGTCCAGTGGG - Intergenic
914435867 1:147658815-147658837 CAGTGTGTACCTAGTCCAGTGGG - Intronic
921071745 1:211665205-211665227 CATTCTGAACTCAGGACAGTTGG - Intronic
922241762 1:223760027-223760049 CATTGTGAATTGAGGCCACCTGG - Intronic
1064254245 10:13730573-13730595 CATTGTCTCCTGAGCCCAGTAGG + Intronic
1065849039 10:29771617-29771639 CATTGTCAATAGAGTCCATTAGG + Intergenic
1067016560 10:42760222-42760244 CTTTGTGACCAGAGCCCAGTTGG - Intergenic
1071425247 10:85542979-85543001 CATTGTGAGCAGAGCCCAGGAGG + Intergenic
1075469595 10:122678156-122678178 CCTTGTGAACTGAGACCTGCTGG + Intergenic
1075796782 10:125126130-125126152 CATTGCGAAGTGTGTCCAGCGGG - Intronic
1083884177 11:65563353-65563375 CCAGGTGACCTGAGTCCAGTTGG - Intergenic
1084412189 11:69011480-69011502 CATTGTGATGTGTGTGCAGTGGG + Intronic
1087175733 11:95093151-95093173 CAGTGTGAACTTTGTCCTGTAGG - Intronic
1101917201 12:108904752-108904774 CACTGTGTACTGAGTCCTATAGG - Intergenic
1103262121 12:119596451-119596473 CATAGTAAACTGTCTCCAGTGGG - Intronic
1108758168 13:53529535-53529557 CATTGTGAATTGAGTACATGGGG + Intergenic
1108766342 13:53634780-53634802 CATTGTGAACATAGTGCATTGGG + Intergenic
1108825047 13:54403285-54403307 TATTGTGAATTGAGTCTAATTGG - Intergenic
1108932204 13:55839329-55839351 GATTGTGATCTTAGTCCATTTGG + Intergenic
1110879038 13:80547525-80547547 CATTCTGAACTTGTTCCAGTTGG + Intergenic
1114230067 14:20773314-20773336 CTTAATGAATTGAGTCCAGTAGG - Intergenic
1117454910 14:55887102-55887124 CACTGTTAATTGACTCCAGTAGG + Intergenic
1118945436 14:70381916-70381938 TATTGTGAAATCAATCCAGTGGG + Intronic
1120176708 14:81302019-81302041 CACTGTGCACTGAGGGCAGTTGG + Intronic
1121022625 14:90590423-90590445 TCTGGTGAACTGAGTACAGTGGG - Intronic
1121026139 14:90617670-90617692 CATTGTGAACTGAGTCCAGTGGG + Intronic
1129039455 15:72673470-72673492 CATTGTCAACTGAGTTCAAATGG + Intergenic
1131189636 15:90303602-90303624 CATTGTCAACTGAGTCAAAATGG + Intronic
1136651520 16:31677294-31677316 CATTCTGAAATGGGGCCAGTTGG - Intergenic
1138258075 16:55587123-55587145 TATTGAGAGCTGAATCCAGTTGG - Intergenic
1139253566 16:65519724-65519746 AATGGTGAACTGAGTCAGGTGGG + Intergenic
1148129163 17:45252738-45252760 CATTGTGAACTGTGGCCTTTTGG + Intergenic
1153745575 18:8175721-8175743 CTTAGTGTGCTGAGTCCAGTAGG + Intronic
1153789539 18:8565138-8565160 CATGGTGCCATGAGTCCAGTAGG - Intergenic
1158195558 18:54881464-54881486 CATTCTGTACAGATTCCAGTCGG + Intronic
1158999193 18:62955665-62955687 AATTATGAAATGAGTTCAGTAGG - Intronic
1159235065 18:65660646-65660668 AATTGAGCACTGAGTCCATTGGG + Intergenic
1160889968 19:1372351-1372373 CATTTTTAACAGAGTCCATTCGG - Intronic
1161581798 19:5085193-5085215 CTTTCTGAACTGAGTCCTGGGGG - Intronic
1163093964 19:15042100-15042122 CAGTGAGAGGTGAGTCCAGTTGG - Intergenic
1164417219 19:28057353-28057375 CATTATGCACTGAGGCCTGTGGG + Intergenic
1164959135 19:32412259-32412281 GATTGTGAAATTAGTGCAGTAGG + Intronic
1165590970 19:36969512-36969534 AAGTGTGAAATGAGTCCTGTGGG + Intronic
925752779 2:7104756-7104778 CAGTGTGGACTGAGGCCAGAAGG + Intergenic
929438034 2:41943454-41943476 CATTGGGAAATGTGGCCAGTGGG - Intronic
931908462 2:66868659-66868681 CTTTTTTAACTCAGTCCAGTAGG - Intergenic
932180440 2:69642252-69642274 TATTTTGAACTCAGTCTAGTAGG - Intronic
935058393 2:99587577-99587599 CAGTGGGAACTCAGACCAGTTGG - Intronic
942693391 2:178611545-178611567 CATGTTGAAATGTGTCCAGTAGG - Exonic
943066187 2:183089234-183089256 CACTGTGAAATGAGCCCAGCAGG - Intronic
944507163 2:200424718-200424740 CAATGGGAATTGTGTCCAGTGGG - Intronic
948310314 2:236980775-236980797 CATTCAGAACTGAGTTCAGTGGG + Intergenic
1172121542 20:32601857-32601879 CAGTATGAGCTGAGGCCAGTGGG + Intronic
1175268126 20:57714842-57714864 CAGTGCCAACCGAGTCCAGTGGG - Intergenic
1175973409 20:62698593-62698615 CAGGGGAAACTGAGTCCAGTGGG - Intergenic
1180982976 22:19887960-19887982 AATTCTGAACCAAGTCCAGTGGG - Intronic
1184014549 22:41776119-41776141 CCTTGTGAGCTGTGTCCACTGGG - Exonic
1184606614 22:45578064-45578086 CATTGTGAACTGGGAGGAGTGGG + Intronic
1185036760 22:48482608-48482630 CAGTGTGTACTGAGTACTGTAGG - Intergenic
950661754 3:14471195-14471217 AATTGTTAACTGAGACCTGTGGG - Intronic
954295221 3:49670744-49670766 CACTGTGAAGTGAGTGCACTGGG - Exonic
954806820 3:53225379-53225401 CATTGTGACCTCAGTCCACCTGG - Intronic
958500921 3:94907582-94907604 CTGAGTGAACTGAGTTCAGTAGG - Intergenic
960304787 3:116047698-116047720 AAATGTGAACAGGGTCCAGTTGG - Intronic
960665646 3:120106273-120106295 CTTTGTTAACAGATTCCAGTAGG + Intergenic
961572519 3:127810111-127810133 CTTTGTGCACTCAGTTCAGTTGG - Intronic
963564081 3:146905830-146905852 CATTCTGTACTGAATCCATTGGG + Intergenic
964739977 3:159954947-159954969 CTTTGTGAGCTGATTCCAGCTGG - Intergenic
966908078 3:184542179-184542201 CATTGTGAGCTGGGTCTCGTCGG - Intronic
970040360 4:11790450-11790472 CATAGTGAAATGAGTCTAGGTGG + Intergenic
971045301 4:22799275-22799297 AATTGTGGACTGAGTCTAGCAGG + Intergenic
977390839 4:96408315-96408337 CATTTTGAGCTGACCCCAGTTGG - Intergenic
978119695 4:105063654-105063676 TATTGTGAAATGATTCCATTTGG + Intergenic
981559926 4:146036519-146036541 CATTGTCAACTGAGTCTAAATGG - Intergenic
982066207 4:151656954-151656976 ATCTGTGAACTGAGGCCAGTAGG - Intronic
983843322 4:172483346-172483368 CATTGTGAAGGGAGTGCAGAGGG + Intronic
984490122 4:180423821-180423843 CATTGTCAATAGAGTCAAGTGGG - Intergenic
989239021 5:39182230-39182252 CAGTGTGAACAGAGTGCAGGTGG + Intronic
990241646 5:53822127-53822149 AAGTGAGACCTGAGTCCAGTTGG - Intergenic
995485509 5:112636344-112636366 CATGGTGAGCTGAGACCTGTAGG - Intergenic
996246309 5:121267763-121267785 CAGTGTGAACCTTGTCCAGTAGG - Intergenic
997581980 5:135023902-135023924 CATGGTGAACTGAGTCAAACAGG - Intergenic
999030216 5:148282124-148282146 CATTGTAATCAGGGTCCAGTGGG - Exonic
1000035289 5:157443136-157443158 CATTCTGGGCTGAGTCCGGTGGG + Intronic
1004191033 6:13463589-13463611 CATGGTGAAATCAGTTCAGTGGG + Intronic
1005033062 6:21529607-21529629 CTTTGTGGACTGAGTCCTCTGGG - Intergenic
1006604407 6:35245757-35245779 AATTGTGGAATGAGCCCAGTGGG + Intronic
1007734261 6:43970850-43970872 CTTTGTGACCTGAGTCCACTGGG + Intergenic
1011293682 6:85804940-85804962 CACTGTGAACTGAGAGAAGTAGG - Intergenic
1014708641 6:124779850-124779872 CATTTTGAATTGAGTTCAGCTGG - Intronic
1015474606 6:133646518-133646540 CATTTTCTACTGAGTCCACTCGG - Intergenic
1016479516 6:144467122-144467144 CACTGTGAGCTGAGTCAGGTGGG + Intronic
1017236325 6:152120592-152120614 GCTTGTGAGCTGAGTCCTGTGGG + Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1018445609 6:163855490-163855512 CATAGTGAATTGAGGCCAGGTGG + Intergenic
1020711077 7:11605897-11605919 GATTCTGAACTGAGGTCAGTAGG - Intronic
1020948039 7:14640125-14640147 CATCATGATTTGAGTCCAGTAGG - Intronic
1021584537 7:22193725-22193747 CACTGGGAACTGAGTCCATCTGG + Intronic
1022526145 7:31038559-31038581 CATGCTGGTCTGAGTCCAGTGGG + Intergenic
1024255168 7:47535466-47535488 TATTGTGAAATGAGACCAGACGG + Intronic
1031115114 7:117658945-117658967 CAGTGTGGACTTAGTCCAGAAGG - Intronic
1032937951 7:136755668-136755690 CAGTCTGAATTGAGTTCAGTCGG + Intergenic
1035371620 7:158382666-158382688 CATTGTGAACTGCGCACAGGAGG + Intronic
1038078251 8:24102264-24102286 CATTTAGAACTGAGTGAAGTAGG + Intergenic
1038305155 8:26393744-26393766 GATAGTAAACTGAGGCCAGTAGG + Intronic
1038415028 8:27388923-27388945 CATTGGGAAATGAGACCAGAAGG - Intronic
1044462083 8:92457451-92457473 CATTCTGAACTGACTGAAGTGGG + Intergenic
1046739868 8:117816529-117816551 CCTTGGGCACTGAATCCAGTGGG - Intronic
1047885657 8:129247425-129247447 CATTCTGAATTTAGTCAAGTGGG + Intergenic
1050849471 9:10265043-10265065 CATGGGGAACTGAGTCCATGAGG + Intronic
1051899988 9:22026836-22026858 CCTTGTGAACTCACTCCATTAGG - Intronic
1192222059 X:69203975-69203997 CATTTTGAACACAGTCCAGTTGG - Intergenic
1197526188 X:127566466-127566488 CATTGTGAGCTGATTCCTCTAGG - Intergenic
1198127649 X:133662112-133662134 TATTGTGCTCTCAGTCCAGTGGG + Intronic