ID: 1121027080

View in Genome Browser
Species Human (GRCh38)
Location 14:90624479-90624501
Sequence GAGGTGCATGTCCAGTGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121027080_1121027086 12 Left 1121027080 14:90624479-90624501 CCCAACCACTGGACATGCACCTC 0: 1
1: 0
2: 2
3: 20
4: 149
Right 1121027086 14:90624514-90624536 CCCTAGTTTAGTTTTAGCCTTGG 0: 1
1: 0
2: 1
3: 4
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121027080 Original CRISPR GAGGTGCATGTCCAGTGGTT GGG (reversed) Intronic
900905210 1:5552354-5552376 GAGGTGCCTGGCAAGTGGCTGGG - Intergenic
902173960 1:14635456-14635478 GAGGTCCCTGTCCAGTGCCTGGG + Intronic
903931349 1:26864152-26864174 TGGGGGCATGACCAGTGGTTAGG - Exonic
904535733 1:31198403-31198425 CTGGTCCATGTCCAGTGTTTTGG + Intronic
907494974 1:54837619-54837641 CAGGTGCCTGCCCACTGGTTGGG + Intronic
909605952 1:77508499-77508521 GAGGTGGATGTGTACTGGTTTGG - Intronic
910032906 1:82753078-82753100 GAGGTGCATGTACAGTCGATGGG - Intergenic
913986975 1:143574615-143574637 GAGATGCATTTCCTGTGGTTGGG - Intergenic
915067712 1:153240329-153240351 GAAGAGCATGTCCAGTGGTGTGG - Intergenic
917086760 1:171311580-171311602 CAGGTGCCTGTCCAGTTGGTGGG - Intergenic
1062884618 10:1006828-1006850 AAGGTGCATCTCCAGTGCCTGGG - Intronic
1063347975 10:5328814-5328836 GAGGTGCATGTGCAGAGGAAAGG + Intergenic
1067037680 10:42932161-42932183 GAGGTGGGTGGCCAGTGGTCAGG + Intergenic
1067462359 10:46467052-46467074 GGTGTGTATGTCCAGTGTTTAGG - Intergenic
1067624838 10:47917585-47917607 GGTGTGTATGTCCAGTGTTTAGG + Intergenic
1070320309 10:75349933-75349955 GAGGTGCAGATTCAGTGGGTTGG - Intergenic
1070637366 10:78140045-78140067 GAGGGGCATGGCCAGAGGCTGGG + Intergenic
1075537015 10:123279755-123279777 GAGGTCTCTGTCCATTGGTTTGG + Intergenic
1076133110 10:128027452-128027474 GAGGTGCTTGTCCACTGGCCAGG + Intronic
1076357866 10:129865955-129865977 GACCTGCATGTGCAGTGGCTGGG - Intronic
1076901220 10:133338954-133338976 GAGGTGTGTGTCCAGTGTTTGGG - Intronic
1077437068 11:2547830-2547852 GAGGTGAAGGTCCAGATGTTGGG + Intronic
1083792949 11:64997572-64997594 AAGATTGATGTCCAGTGGTTAGG + Intergenic
1084272426 11:68036430-68036452 GAGGTGCAGGGACGGTGGTTAGG - Intronic
1086054161 11:82627900-82627922 CAGGTGCATGTCCAGTTGGTGGG - Intergenic
1087417198 11:97872012-97872034 GAGCTGCATGGCCTGGGGTTGGG + Intergenic
1090251747 11:125256419-125256441 GAGGTGCCTGCCCAGGGTTTAGG - Intronic
1090484291 11:127098776-127098798 AAGGTGTATTTCCAGAGGTTAGG + Intergenic
1091573446 12:1711451-1711473 TAGGTGCCTGTCCAGTTGGTGGG + Intronic
1092280044 12:7091767-7091789 GAGGAGAATGCCCAGTGGTATGG - Intronic
1095541545 12:43314408-43314430 TAGGTTCATGTTCAGTGATTTGG - Intergenic
1099534614 12:83828470-83828492 GAGGGGAGTGTCCAGTAGTTCGG + Intergenic
1100210372 12:92392915-92392937 CAGGTGCCTGTCCAGTTGGTGGG - Intergenic
1104306774 12:127616861-127616883 CAGGTGCCTGTCCAGTTGGTGGG - Intergenic
1104397031 12:128443020-128443042 GAGATGCATGTGGAGTGTTTAGG + Intronic
1104880741 12:132068722-132068744 GAAGTGCATGTCCTTTGGGTCGG + Intronic
1106170723 13:27285859-27285881 AAGGTGCAGGTCCTTTGGTTTGG + Intergenic
1109189833 13:59310714-59310736 GATGTGCATGTCAAGTGAATTGG - Intergenic
1110993629 13:82075297-82075319 GTGATGTGTGTCCAGTGGTTCGG - Intergenic
1111557480 13:89900320-89900342 GAAGTGCATGTGCAAAGGTTGGG - Intergenic
1112402479 13:99087710-99087732 GCGGCGCATGCTCAGTGGTTGGG + Intergenic
1112958350 13:105089864-105089886 TAAGGGCATGTCGAGTGGTTGGG - Intergenic
1113397493 13:109962168-109962190 CAGTTACATGTCCAGTGGTGTGG + Intergenic
1113507264 13:110825842-110825864 CAAGTGCAGGTCCAGTGTTTTGG + Intergenic
1113511125 13:110855524-110855546 CAGTTGCAAGGCCAGTGGTTGGG - Intergenic
1113550660 13:111190748-111190770 CAGGTGCCTGTCCAGTTGGTGGG + Intronic
1113720574 13:112553039-112553061 TAGGAGCATGGCCGGTGGTTGGG - Intronic
1114564934 14:23623696-23623718 GAGGGGCATGTCCTGTGGTCTGG - Intergenic
1116877417 14:50126397-50126419 AAGTTGCATATCCAGTGGCTGGG - Intronic
1121027080 14:90624479-90624501 GAGGTGCATGTCCAGTGGTTGGG - Intronic
1122859858 14:104577670-104577692 GCGGAGCATGTCCAGTGGCTGGG - Intronic
1125146002 15:36469082-36469104 CAGGCGCATGTCATGTGGTTAGG - Intergenic
1125602073 15:40920976-40920998 GATGTGCATGTGCAGAGTTTGGG - Intergenic
1126644349 15:50859959-50859981 CAGGTGCATGTCCAGGGGTAAGG + Intergenic
1128254274 15:66185589-66185611 GGGGAGCAAGTCCAGAGGTTTGG - Intronic
1130239948 15:82178749-82178771 GAGGGGCATGTCCAGAGAATTGG - Intronic
1130284411 15:82542983-82543005 GAGATGCTTCTCCAGTGGATGGG - Intronic
1132886101 16:2182766-2182788 GAGGTGCCTGTGCAGTGGGATGG - Intronic
1135186405 16:20319652-20319674 GACTTTCATGTCCAGTGGGTAGG + Exonic
1136392120 16:29972315-29972337 AAGGTGCATGTCAAGTTCTTGGG - Intronic
1136628815 16:31477466-31477488 AAGGTGCATGTGAAGTGGTCCGG - Exonic
1138089232 16:54160635-54160657 GAGGTTCATGCCCAGTGCTTTGG - Intergenic
1138494029 16:57396265-57396287 CAGGTGCCTGTCCAGTTGGTGGG + Intergenic
1138860334 16:60748490-60748512 GAGGTGGATGGTAAGTGGTTGGG + Intergenic
1139287040 16:65825006-65825028 GAGGTGCATCGCCAGTGCTTTGG + Intergenic
1145391446 17:22459101-22459123 GGGGTGAATGCCCAGGGGTTTGG - Intergenic
1145804898 17:27719629-27719651 CAGGTGCCTGTCCAGTTGGTGGG - Intergenic
1147628108 17:41913010-41913032 GAGATGTATGAGCAGTGGTTAGG - Intronic
1148741915 17:49897854-49897876 GATGTGCATCTCCTGGGGTTTGG - Intergenic
1150346902 17:64411504-64411526 GATGGGCATGTGCAGTGGGTGGG + Intronic
1150346924 17:64411606-64411628 GATGGGCATGTGCAGTGGATGGG + Intronic
1150346928 17:64411623-64411645 GATGGGCATGTGCAGTGGGTGGG + Intronic
1150827613 17:68490650-68490672 GAGGGGCGTGTCCTGTGGTATGG + Intergenic
1152813050 17:82391218-82391240 GAGGTGACTGTCCAGGGCTTTGG - Intronic
1157808503 18:50676343-50676365 GAGGGGCGTGTCTAGTGGCTAGG - Intronic
1157995578 18:52550986-52551008 GAGGTACATGTGCAGATGTTAGG + Intronic
1159634117 18:70784534-70784556 GAGAAGCAAGTCCAGTGGCTTGG + Intergenic
1162000919 19:7744545-7744567 GATGTGCATGACCAGCAGTTAGG - Intronic
1165910241 19:39221394-39221416 GAGCTGAATCTGCAGTGGTTGGG + Intergenic
925501424 2:4509297-4509319 GAGCTGCAGCTGCAGTGGTTTGG - Intergenic
926836027 2:17022098-17022120 GAATTGCATGTCCTGGGGTTTGG + Intergenic
927588834 2:24335322-24335344 GATGTACATGTCCAGTGCTCTGG + Intronic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
929418883 2:41770861-41770883 TCTGTGCATGTCCAGTGATTTGG - Intergenic
933068838 2:77833304-77833326 GAGGGGCATGTCCTGTGGTATGG - Intergenic
935655874 2:105422332-105422354 GAGGTGCATGTCATGTGCATGGG + Intronic
936250034 2:110861372-110861394 CATATGCATTTCCAGTGGTTTGG - Intronic
939512696 2:143126495-143126517 GTGCTGCATGCCAAGTGGTTAGG + Intronic
941798280 2:169625956-169625978 GAGGTGGAGCTCCAGTGGTAAGG + Intronic
942310832 2:174655233-174655255 GAGGTGGATGGCCAATGGTATGG - Intronic
942646138 2:178112799-178112821 GAGATGCATGGCCAGTGCCTCGG + Exonic
1169067372 20:2701626-2701648 AAAGGGCATGTCCAGTGGTCTGG + Intronic
1169789782 20:9397649-9397671 CAGTTGCATGTCCAGTCCTTGGG + Intronic
1171235848 20:23524066-23524088 GAGGTGATTGTCCTGTGGCTCGG + Intergenic
1171444877 20:25196058-25196080 GGGGGGCAAGTCCAGTGTTTTGG + Intronic
1171789103 20:29502126-29502148 TAAGTTCATGTCCAGTTGTTTGG + Intergenic
1173941093 20:46912098-46912120 GTGGAGCATGGGCAGTGGTTGGG + Intronic
1175227161 20:57451313-57451335 GAGGTGGATGCCCAGAGGTGAGG - Intergenic
1180165316 21:46022748-46022770 GATGTGCATTTCCAGTGATGTGG + Intergenic
1180206588 21:46264871-46264893 GAAGGGCATGTCCTGGGGTTGGG - Intronic
1183804290 22:40194882-40194904 CTGGTGCATCTGCAGTGGTTTGG + Intronic
949558252 3:5177873-5177895 GAGGTGCTTCTTCAGTAGTTGGG + Intronic
950416656 3:12872773-12872795 CATGTGCATGGCCAGTGGCTCGG + Intergenic
950586588 3:13896423-13896445 GAGCTGCTGATCCAGTGGTTTGG + Intergenic
953018756 3:39100681-39100703 GAGGTCCATGCCCAATGGTCAGG + Intronic
954577094 3:51682485-51682507 GAGCTGCATATTCAGAGGTTTGG + Intronic
959426103 3:106190667-106190689 AGGGTTGATGTCCAGTGGTTAGG + Intergenic
959678436 3:109064896-109064918 GAGGTGCAAGTGTAGAGGTTAGG - Intronic
960708950 3:120507881-120507903 CAGGGGCATGTCCTGTGGTATGG - Intergenic
962435539 3:135363092-135363114 GAGCTGCATGTCAAGTGATTGGG - Intergenic
963458559 3:145577653-145577675 GAGGTGCATGTCCTGTGGTATGG + Intergenic
963726509 3:148928042-148928064 CAGGAGCATGTCCAGTGGAGGGG - Intergenic
964538643 3:157755037-157755059 GAGGTGCATGTGGGGTGTTTGGG - Intergenic
969223427 4:5777511-5777533 GAGGGGCATGCCCAGTCTTTGGG - Intronic
971294966 4:25379810-25379832 GAGGAGCATGTGCAGTGGTGAGG + Intronic
979110251 4:116744620-116744642 GAGGCACATGACCAGTGTTTAGG - Intergenic
980419529 4:132542087-132542109 GAGGAGCATGTCCTCTGGTATGG - Intergenic
980921446 4:139090268-139090290 GCTATGCAAGTCCAGTGGTTTGG + Intronic
984571036 4:181394186-181394208 GAGATGCATGTACATTTGTTAGG - Intergenic
990895663 5:60698251-60698273 GAGGTGCATGTGGAGAGGATGGG - Intronic
997195051 5:131973694-131973716 GAGGCCCATGTCCAGGGTTTGGG - Intronic
999559496 5:152785462-152785484 GAGCTGCATTGCCTGTGGTTTGG - Intergenic
1003480829 6:6531288-6531310 GAGATGCATGTCCTGCTGTTGGG - Intergenic
1003929480 6:10909780-10909802 GAGGTGGATGCCCAATGGGTCGG + Intronic
1004022878 6:11790469-11790491 CAGGTGCCTGTCCAGTTGGTGGG - Intronic
1006388231 6:33744128-33744150 GAGCTGCGTGTCCAGGGGTCAGG - Intronic
1007030677 6:38623201-38623223 CAGGTGCCTGTCCAGTTGGTGGG - Intronic
1011529187 6:88301250-88301272 GAGGTGCATGCTCAGTGGTTTGG + Intergenic
1012497137 6:99845774-99845796 GAGGTGCTGGTGCTGTGGTTAGG + Intergenic
1013303591 6:108827234-108827256 GTGGTGGATTTCCAGTGGTTGGG + Intergenic
1015791167 6:136965926-136965948 GAGGTGGATCTCCTGAGGTTGGG - Intergenic
1016553002 6:145302817-145302839 TAGGGGCAATTCCAGTGGTTGGG + Intergenic
1019316507 7:389408-389430 CTGGTGCATGACCAGTGGTTAGG - Intergenic
1022327211 7:29343313-29343335 CAGGGACATGGCCAGTGGTTTGG + Intronic
1022961211 7:35428766-35428788 GAGGTGCATGTGCAGTGCTGAGG - Intergenic
1023845802 7:44119535-44119557 GAGTTACATGTACAGTGCTTAGG - Intronic
1026767128 7:73167114-73167136 CAGGTCCATGTCCAGGGCTTAGG + Intergenic
1027043597 7:74976825-74976847 CAGGTCCATGTCCAGGGCTTAGG + Intronic
1027080050 7:75225534-75225556 CAGGTCCATGTCCAGGGCTTAGG - Intergenic
1027419924 7:78008888-78008910 AAGGGGCATGTCCTGTGGTATGG - Intergenic
1028019375 7:85750673-85750695 GAGGTGCATGTGCGTTGGTTAGG - Intergenic
1029389269 7:100264139-100264161 CAGGTCCATGTCCAGGGCTTAGG - Intronic
1029608998 7:101616669-101616691 CAGCTGCATGACCAGTGGTCTGG + Intronic
1032433626 7:131882586-131882608 AAGGTGCATGGCCAGTGGCTAGG + Intergenic
1032722725 7:134564001-134564023 CAGGTGCCTGTCCAGTTGGTCGG - Intronic
1033793920 7:144824933-144824955 GAGGTGCATATCCACTTTTTTGG - Intronic
1035540163 8:428440-428462 GAGGTGCATGTCCGAGGGATGGG - Intronic
1039906527 8:41790525-41790547 GAGGTGTTGGTGCAGTGGTTAGG - Intronic
1040555075 8:48471215-48471237 GAGGTGCATGTCCCTTGCTTTGG + Intergenic
1040796073 8:51291252-51291274 CAGGTGCCTGTCCAGTTGGTGGG + Intergenic
1041393489 8:57368521-57368543 GAGGGGCATGGCCTGTGGTATGG - Intergenic
1042217320 8:66439289-66439311 GAAGACCTTGTCCAGTGGTTGGG - Intronic
1042920214 8:73912752-73912774 CAGGTGCCTGTCCAGTTGGTGGG - Intergenic
1043628437 8:82293923-82293945 GTGGTGCATGTCCACTGGCTAGG - Intergenic
1044659232 8:94579016-94579038 GAGGGGCATGTCCTGTGATATGG + Intergenic
1046387213 8:113520369-113520391 GAGGGGCATGTCATGTGGTATGG - Intergenic
1047500113 8:125433657-125433679 GAGGTGCAGGTCATGTAGTTAGG + Intronic
1048008101 8:130435422-130435444 GAGGTGCAAGGGCAGTGGTAGGG - Intronic
1049186804 8:141259486-141259508 GAGATGCATGGCCGGTGGTGTGG - Intronic
1049691595 8:143963351-143963373 GAGGTGCAGGTGCAGAGGGTGGG + Intronic
1053618491 9:39793122-39793144 CAGGAGCATGTTCAGTGGCTGGG - Intergenic
1057205675 9:93171053-93171075 GAGGGGCATGTCCCGTGACTGGG + Intergenic
1057945887 9:99327722-99327744 GTGGTGCAAGACCAGGGGTTGGG + Intergenic
1060791260 9:126487078-126487100 GAGGTGCAGAGCCAGGGGTTGGG + Intronic
1061905863 9:133696535-133696557 GGGGAGCATGTCCTGTGCTTGGG - Intronic
1189175843 X:38956346-38956368 GAAGTGCTGGTCCACTGGTTGGG - Intergenic
1190114951 X:47620174-47620196 TGGGTGCTTGTCCAGTGGGTCGG + Intergenic
1191797231 X:65034533-65034555 GAGGTGCCTGTCGAGGGGCTGGG + Intronic
1197551854 X:127901398-127901420 AAGGGGCATGTCCTGTGGTATGG - Intergenic
1199445397 X:147914391-147914413 GAGTTGCTTGTCCAGTGGGATGG + Intronic
1199786566 X:151111793-151111815 GGGGTGCATGCTCATTGGTTGGG + Intergenic
1201907612 Y:19101670-19101692 CAGGTGCCTGTCCAGTTGGTGGG + Intergenic