ID: 1121027240

View in Genome Browser
Species Human (GRCh38)
Location 14:90625578-90625600
Sequence TAGGCTCACCTGGCGGAGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121027240_1121027248 15 Left 1121027240 14:90625578-90625600 CCGACCTCCGCCAGGTGAGCCTA 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1121027248 14:90625616-90625638 AGCTGTGCACGTCCTGGAGCTGG 0: 1
1: 0
2: 0
3: 20
4: 163
1121027240_1121027250 19 Left 1121027240 14:90625578-90625600 CCGACCTCCGCCAGGTGAGCCTA 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1121027250 14:90625620-90625642 GTGCACGTCCTGGAGCTGGGAGG 0: 1
1: 0
2: 1
3: 17
4: 246
1121027240_1121027247 9 Left 1121027240 14:90625578-90625600 CCGACCTCCGCCAGGTGAGCCTA 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1121027247 14:90625610-90625632 GATGACAGCTGTGCACGTCCTGG 0: 1
1: 0
2: 0
3: 16
4: 212
1121027240_1121027249 16 Left 1121027240 14:90625578-90625600 CCGACCTCCGCCAGGTGAGCCTA 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1121027249 14:90625617-90625639 GCTGTGCACGTCCTGGAGCTGGG 0: 1
1: 0
2: 1
3: 15
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121027240 Original CRISPR TAGGCTCACCTGGCGGAGGT CGG (reversed) Intronic
905318031 1:37096023-37096045 TGGACTCCCCTGGCTGAGGTAGG - Intergenic
914096960 1:144552213-144552235 TCGGCTGAGTTGGCGGAGGTTGG - Intergenic
915074504 1:153297421-153297443 AAGGCTCACCAGGCAGAGGCGGG + Intergenic
915414395 1:155729531-155729553 TTGGCTCACGAGGCTGAGGTGGG + Intronic
920446116 1:206019525-206019547 TTGGCTCACCTGGCTGGTGTAGG - Intronic
1063021993 10:2137999-2138021 GAGGCTCACATGGCGCAGGATGG - Intergenic
1066043672 10:31578385-31578407 TTGGCTCACCTGCTGGAGGCTGG - Intergenic
1069048851 10:63771090-63771112 AAGGCTCATCTGGAGGAGGAAGG - Intergenic
1069137776 10:64785555-64785577 TAGGCTCAGCTGGCAGAGAGAGG + Intergenic
1078368545 11:10726323-10726345 AAGGCTCACCAGGAGGAGGTAGG - Intergenic
1080322740 11:31032968-31032990 AAGACACACCTGGCAGAGGTGGG + Intronic
1081856590 11:46307987-46308009 CAGGCTCACCTGGTGGGGGATGG - Exonic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1082975715 11:59069930-59069952 TAGGCAAACCTGGCGGATGAAGG + Intergenic
1083266611 11:61549935-61549957 TATGATCACCTGGCAGAGGCAGG + Intronic
1090717383 11:129442389-129442411 GAGAATCACCTGCCGGAGGTGGG + Intronic
1091832159 12:3557522-3557544 TTGGCTCACCCAGCGGAGCTGGG + Intronic
1101847709 12:108375916-108375938 TAGTGTCACCTGGCAGAAGTTGG - Intergenic
1102770959 12:115475393-115475415 TAGGCTCACCCTGAGGAGGGGGG - Intergenic
1104841253 12:131827220-131827242 TGGGATCACCTGTAGGAGGTGGG - Intergenic
1105274220 13:18905500-18905522 TAGGCTCACCTCACTGCGGTTGG + Intergenic
1116734974 14:48677699-48677721 TAGCCTCACTTGGAGGAAGTGGG - Intergenic
1119374399 14:74177855-74177877 TGAGCGCACGTGGCGGAGGTTGG - Intronic
1121027240 14:90625578-90625600 TAGGCTCACCTGGCGGAGGTCGG - Intronic
1121434963 14:93913086-93913108 CAGGCTCACTTGGCAGAGTTGGG + Intergenic
1122118250 14:99538205-99538227 AAGGCTCACCTGCTGGTGGTGGG - Intronic
1125200292 15:37096566-37096588 TAGGCTCGCCTGATGGAGGAAGG - Intronic
1127634885 15:60859585-60859607 TAGTCTCACCAGGCTGAGATGGG - Intronic
1127843060 15:62846967-62846989 CAGGCTGACCTGGGGGTGGTGGG + Intergenic
1128221255 15:65970306-65970328 TGGGCTCACCTGGGGGAAGGAGG - Intronic
1131131762 15:89904846-89904868 AAGGCACCCCTGGCAGAGGTTGG - Intronic
1133286548 16:4693459-4693481 TAGGCTCTCCCGTCGGAGGCGGG + Intergenic
1134771205 16:16811286-16811308 TTTGCTCACCTGGCTGGGGTGGG + Intergenic
1137270099 16:46897724-46897746 GCGGCTCACCTGCCGGAGGAAGG - Exonic
1137291231 16:47053327-47053349 TGGGCACACGTGACGGAGGTCGG + Intergenic
1137579339 16:49623745-49623767 GGGGCTCACCTGGCGGAGAGTGG - Intronic
1141660359 16:85438041-85438063 CAGGCTCATCTGGGGGAGGCGGG + Intergenic
1142413374 16:89927293-89927315 GAGGATCACCTGGGGGAGGTGGG + Intronic
1143945379 17:10587142-10587164 TTTGATCACCTGGCTGAGGTAGG + Intergenic
1144554262 17:16267886-16267908 CAGGCTCTCCTGGTGGAGGCAGG + Intronic
1144957631 17:19027165-19027187 TAGGCCCACCTGGCTGGGCTAGG + Intronic
1144977525 17:19147351-19147373 TAGGCCCACCTGGCTGGGCTAGG - Intronic
1151815873 17:76471151-76471173 TGGGCTCACAGGGCAGAGGTAGG + Exonic
1152364964 17:79850200-79850222 CAGGCTCACGTGGCTGAGGGCGG + Intergenic
1152855491 17:82663040-82663062 AAGGCCCAGCTGGCGGAGGGTGG + Intronic
1158530540 18:58256236-58256258 CAGCCTCACCTGGCGCACGTCGG - Intronic
1160422773 18:78759012-78759034 TAGACACACCTGGCTCAGGTAGG + Intergenic
1160870446 19:1275420-1275442 GGGGCTCACCAGGCGGAGGCGGG + Exonic
1161091751 19:2363684-2363706 CAGGCTCACCTGGCTTAGCTGGG + Intergenic
1161244455 19:3241601-3241623 GAGGCTCACCTGGCGTGGGTGGG + Intronic
1161361448 19:3852272-3852294 GTGGCTCTCCTGGCTGAGGTGGG + Intronic
1168241426 19:55091056-55091078 CAGGCCCACCTGGCTGAGGCTGG + Exonic
1168691374 19:58379590-58379612 CATGCTCACCTGGGGCAGGTGGG - Intronic
926022588 2:9510180-9510202 TAGGCCCAACTGGCAGAAGTAGG - Intronic
937833089 2:126444874-126444896 TAGGCTGAGGTGGCTGAGGTGGG + Intergenic
937891216 2:126940454-126940476 CAGGCTCAACTGGCAGAGGGAGG - Intergenic
942624453 2:177884518-177884540 TAGGCTGACCATGGGGAGGTGGG + Intronic
944681053 2:202077086-202077108 TGGGGTCACCTGGAGGAGCTGGG - Intronic
947152647 2:227130853-227130875 GAGACTCACCTGGCGCAGTTGGG - Intronic
947203368 2:227637097-227637119 TGGGATCACCTGACGGGGGTGGG + Intergenic
947447105 2:230172502-230172524 TAGTCTCACCTGGCTGATGGAGG - Intronic
1176808663 21:13515842-13515864 TAGGCTCACCTCACTGCGGTTGG - Intergenic
1178795729 21:35742560-35742582 TAGGCACTCCTGGGGGAGGGAGG - Intronic
1178840789 21:36136044-36136066 TAAGCTCCCCGGGCGGGGGTGGG - Intronic
1180884611 22:19232467-19232489 TACGCTCACCTGGCTAATGTTGG + Exonic
1181644682 22:24224987-24225009 CAGCCTCACCTGGCTGAAGTTGG + Exonic
1181996437 22:26886542-26886564 TAGGTTTACTTGGAGGAGGTGGG + Intergenic
1185102343 22:48848085-48848107 GAGGCACACCTGTGGGAGGTGGG + Intronic
950461578 3:13125334-13125356 GGGCCTCACCTGGTGGAGGTGGG - Intergenic
951735275 3:25856679-25856701 TAGCCTCACATGGTGGAGATGGG + Intergenic
952301302 3:32106642-32106664 AAGGCTGAACAGGCGGAGGTGGG + Exonic
954608937 3:51934130-51934152 TAGGGTGACCTGGGGGAGGGTGG - Intronic
954720166 3:52554748-52554770 CAGGCACACCTGGCGGAAGATGG + Exonic
961497004 3:127300904-127300926 TATGGTCACCTGGCAGAGTTAGG + Intergenic
962368885 3:134804607-134804629 TAGGCTCACCTTCCAGAGGAAGG + Intronic
963326658 3:143870465-143870487 TAGGCACACTTGCAGGAGGTTGG + Intergenic
966742936 3:183250852-183250874 TCCTCTCACCTGGCAGAGGTAGG - Intronic
969605533 4:8200433-8200455 TCGGCTCACCTGGAGGAGGGAGG - Intronic
973293283 4:48490541-48490563 ATGGCTCTCCTGGCGCAGGTGGG + Exonic
983943870 4:173564747-173564769 TAGTCTCAGCAGGCTGAGGTGGG - Intergenic
984812563 4:183807691-183807713 GAGGCTGAGCTGGGGGAGGTGGG + Intergenic
985688561 5:1294762-1294784 GAGGCCCACCTGGCGGAAGGAGG + Exonic
986195149 5:5531597-5531619 TCGGCACAGCTGGGGGAGGTGGG - Intergenic
988520000 5:31937281-31937303 TGGGCTAACATGGAGGAGGTTGG + Intronic
997720460 5:136074531-136074553 TAGCCTCACTTGGTGGAGGGAGG - Intergenic
1003065536 6:2901667-2901689 CAGGCTCACCTGGAGGAGTCAGG - Intronic
1003086649 6:3065578-3065600 CAGGCTCACCTGGAGGAGTCAGG + Intronic
1005401539 6:25439276-25439298 TAGCCTCACCTAGTGGAGCTTGG - Intronic
1007108356 6:39298459-39298481 TAGGTTCACCTGGGGCAGCTGGG - Intergenic
1008186681 6:48401163-48401185 TTGGCTCACCTGCTGGAGTTGGG - Intergenic
1017764240 6:157593655-157593677 TAGCCTGTCCTGGCGGAAGTTGG - Intronic
1018992607 6:168685652-168685674 TCGGCTCACGTGGCTGAGGCTGG + Intergenic
1022115697 7:27258642-27258664 CAGGATCACCTGGGGGAGCTTGG - Intergenic
1026024491 7:66733723-66733745 TAGGCGCACCTGGCCTAGGAGGG - Intronic
1026966238 7:74441878-74441900 CAGGCTCACATGGAGGCGGTGGG - Intergenic
1029480262 7:100808000-100808022 AAGGCTCACCTGAGGGAGTTGGG - Intronic
1032336227 7:131027567-131027589 TAGGCTCATCTGGCGGCCCTCGG + Intergenic
1032339328 7:131056229-131056251 TAGGCTCAGATGGCAGTGGTGGG - Intergenic
1049387014 8:142347996-142348018 TAGGTTCACGTGGCTCAGGTGGG - Intronic
1049797842 8:144504680-144504702 GAGCCTCACCTGGCGCAGGAAGG - Exonic
1050104391 9:2150422-2150444 TAGTCTCACCTGATGGAGATGGG - Intronic
1050158881 9:2696543-2696565 CAGGCTCAGCTAGCGGAGTTGGG + Intergenic
1056922355 9:90801876-90801898 TCGCCTCACCTGGCGCAGGTAGG + Exonic
1057028634 9:91756553-91756575 GAGGCTGACCTGGCTGGGGTGGG - Intronic
1057371590 9:94479397-94479419 ATGGCTCACCTCGCTGAGGTTGG + Intergenic
1058189618 9:101897070-101897092 GAGGCTGACCTAGAGGAGGTGGG + Intergenic
1061804042 9:133128334-133128356 TGGGCACACCTGGCTGAGGAAGG + Intronic
1061899595 9:133666147-133666169 CAGGGTCACCTGGAGGGGGTGGG + Intronic
1193926160 X:87487882-87487904 TGGGCTCACCTGGGGGAACTTGG + Intergenic