ID: 1121028564

View in Genome Browser
Species Human (GRCh38)
Location 14:90636457-90636479
Sequence GTTGAAATCTACCACTGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121028564 Original CRISPR GTTGAAATCTACCACTGGGA TGG (reversed) Intronic
902567950 1:17326823-17326845 GTTGAAATCTTCAACTCTGATGG + Intronic
904799163 1:33081027-33081049 GTCGGAATCGACCAATGGGATGG + Intergenic
911059800 1:93738173-93738195 TTTGAAATCTACCAATAGTAAGG + Intronic
911585711 1:99688216-99688238 GTTTAAATGTAGAACTGGGATGG - Intronic
911932233 1:103919569-103919591 GTATAAATCTAGCAATGGGATGG + Intergenic
912708952 1:111936202-111936224 CTTGCAATCTACCACTGGTGAGG + Intronic
917507124 1:175637729-175637751 GAAGAAATCTACCACTAGGGGGG + Intronic
1065340116 10:24696637-24696659 GCTCAAATATACTACTGGGATGG + Intronic
1065747553 10:28856110-28856132 CTTGAACTCTACCACTGGAAAGG - Intronic
1066115428 10:32234485-32234507 GCTGAAATCTGCAACTGTGATGG + Intergenic
1067903474 10:50266211-50266233 GTTGACATCTCCAACAGGGAAGG - Intergenic
1068291686 10:55010372-55010394 GTTTAAATCACCCACTGGAAAGG - Intronic
1070220617 10:74439564-74439586 GATGAAATCTTCCACTGGGTAGG - Intronic
1070992922 10:80748276-80748298 GTTGAAATCTCCCAGTGTTAAGG - Intergenic
1073833857 10:107418273-107418295 GTTCAAATCAACCTCTGAGAAGG + Intergenic
1074463390 10:113659508-113659530 GTGCAAATCTACCACTGGGGAGG + Intronic
1080295856 11:30726529-30726551 ATTGAAATTTACAACTGGAAGGG + Intergenic
1080549070 11:33353385-33353407 GGTGAACTATGCCACTGGGATGG - Exonic
1081935123 11:46898945-46898967 CTCGACATCTACCACTGCGATGG - Exonic
1083564292 11:63700061-63700083 GTTGAAATTTTCCATTAGGAGGG + Intronic
1084549245 11:69831098-69831120 CTATAAATCTTCCACTGGGATGG + Intergenic
1085401788 11:76239927-76239949 GGAGAAACCTACCACTGGGATGG - Intergenic
1086992719 11:93323153-93323175 GTTGAAATCTTCACCTGGGCTGG - Intergenic
1089619947 11:119716339-119716361 GTTGTGAGCTACCACTGGGAGGG - Intronic
1091341829 11:134821917-134821939 GTTGAAACCCACCTCTGGGGAGG - Intergenic
1091496219 12:975186-975208 GTTTCAATCATCCACTGGGAGGG + Intronic
1092136357 12:6150595-6150617 GTTGACATCTCCCACTATGATGG - Intergenic
1094460683 12:30694751-30694773 ATTAAGAGCTACCACTGGGATGG - Intronic
1097313430 12:58146980-58147002 GTTGAAGTCTACCACTTTAAAGG + Intergenic
1098456815 12:70683720-70683742 GTTAAAATCTACCAAGGGCAGGG + Intronic
1100074468 12:90762861-90762883 GTTGAAATCTACACCTGGAAGGG - Intergenic
1101619694 12:106373187-106373209 GTTAAAATCTCCCACTATGATGG + Intronic
1104443379 12:128813516-128813538 GTTTCAATCTACCACGTGGAAGG + Intronic
1105908750 13:24840359-24840381 GTAGATATCTAGCAGTGGGAAGG - Intronic
1106985494 13:35343291-35343313 GTTGAAATCTTCCACAAAGATGG - Intronic
1114752868 14:25225268-25225290 ATTGAAATCCACAAATGGGAAGG + Intergenic
1116478578 14:45369803-45369825 GTTGTAATGAACAACTGGGAAGG + Intergenic
1118933887 14:70268186-70268208 GTTAAAATCTTCCTCTGTGATGG - Intergenic
1120695139 14:87636378-87636400 GTTGAAATAGAGCACTGGGGTGG - Intergenic
1121028564 14:90636457-90636479 GTTGAAATCTACCACTGGGATGG - Intronic
1121616042 14:95314497-95314519 GCTCAAATCCACCCCTGGGAAGG - Intronic
1126608807 15:50507646-50507668 GTTGAAATCTTCCATTATGATGG - Exonic
1127838780 15:62812052-62812074 AATAAAATCTGCCACTGGGAAGG + Intronic
1129487842 15:75893487-75893509 GTTGAAATCTCCAACTGTGATGG - Intronic
1130375100 15:83322009-83322031 TGTGAAAGCAACCACTGGGAAGG - Intergenic
1130885264 15:88087428-88087450 GTGGAAATTTATTACTGGGATGG - Intronic
1134897584 16:17902974-17902996 GTTGAAATATAATATTGGGATGG - Intergenic
1137763150 16:50956908-50956930 GTTGAAATCTGTCATTGTGATGG + Intergenic
1147114929 17:38291990-38292012 GATGTCATCTGCCACTGGGAGGG + Intergenic
1148414688 17:47497215-47497237 GATGTCATCTGCCACTGGGAGGG - Intergenic
1149085616 17:52711755-52711777 GTTGATGTCAACCACTGGAATGG + Intergenic
1153330382 18:3867493-3867515 GATGAAATTAACCACTGGTATGG + Intronic
1158042694 18:53115553-53115575 GCCGAATTCTAGCACTGGGATGG - Intronic
1158555340 18:58470352-58470374 TCTGAAGTCCACCACTGGGAGGG + Intergenic
1160162224 18:76482226-76482248 GTTCACATCTACCAACGGGAGGG + Intronic
1163408824 19:17140781-17140803 GTTGAAATCTAACCCTGGCCGGG - Intronic
1165494150 19:36142015-36142037 ACTGAAATCTGCCACTGGGTAGG + Intronic
925708987 2:6719272-6719294 GTTGAAAAAGACCAGTGGGATGG - Intergenic
929106633 2:38371556-38371578 GTAGATATTAACCACTGGGAAGG + Intronic
942008057 2:171728772-171728794 GTTGACATCTCCAACAGGGAAGG - Exonic
945443930 2:209913427-209913449 GTGGAAATCTACTATTAGGAAGG + Intronic
946813725 2:223554157-223554179 CTTGAAATCGACCACAGTGAGGG - Intergenic
948410713 2:237757960-237757982 TTTGAAATCTTCCCCAGGGAAGG + Intronic
1169113991 20:3050932-3050954 GTTGAAATGGACAACTAGGAAGG + Intergenic
951103561 3:18717247-18717269 GTTCAAATCTACCACATGCATGG - Intergenic
951447208 3:22796667-22796689 GCTGAAGGCTTCCACTGGGATGG - Intergenic
952021111 3:29021399-29021421 GTTAAAATCTCCCACCGTGATGG - Intergenic
952464078 3:33562542-33562564 CTTGAAATCTACCACGGGATAGG + Intronic
952697422 3:36284336-36284358 GTTAAAATCTGCCATTTGGATGG - Intergenic
953538361 3:43793149-43793171 GTGGAGAGCTGCCACTGGGAGGG - Intergenic
953696565 3:45164620-45164642 GTTGAGAACTACTTCTGGGAAGG - Intergenic
956897243 3:73675283-73675305 GATGAAATATACAACTGGAAAGG + Intergenic
960221850 3:115121534-115121556 GTTGAAGTCTACTAGTGAGATGG + Intronic
961607676 3:128109247-128109269 GTTTAAAACTGGCACTGGGATGG + Intronic
963285892 3:143434493-143434515 GTTGCAATCGAACACTGGAAAGG - Intronic
963919629 3:150893159-150893181 GCTGGATTCTGCCACTGGGAAGG - Intronic
967934003 3:194711974-194711996 GTTGAAATAGGCCACTGGGCTGG - Intergenic
978634322 4:110785679-110785701 GCTGAAGTTTGCCACTGGGACGG - Intergenic
981665338 4:147218727-147218749 GTTGAAGTCTAAGGCTGGGATGG + Intergenic
983701895 4:170607129-170607151 GTTGAGATCTACTACTCAGAAGG - Intergenic
984609991 4:181827088-181827110 GTTGAATTCTGCCCCTTGGAAGG - Intergenic
986437564 5:7748905-7748927 CTTGCTATATACCACTGGGAAGG - Intronic
987788434 5:22532587-22532609 GTTTAATTTTACCATTGGGAAGG + Intronic
1002145726 5:177179691-177179713 TTTGAAAACTACCTCTGTGATGG + Intronic
1003812939 6:9804836-9804858 GTTAAACTCAACCACTTGGAGGG + Intronic
1005347649 6:24906234-24906256 GTTGATACCTACCATTGGGTAGG + Intronic
1007620181 6:43207949-43207971 GCTAAAATCTACCACTATGATGG + Intronic
1009691674 6:67042318-67042340 GTGGAAATCAAACACTCGGAAGG + Intergenic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1020342979 7:7132479-7132501 GTTGAAATCTGCCTGTGTGAGGG + Intergenic
1023331847 7:39126302-39126324 GTTAAAAGCCACCACTTGGAGGG + Intronic
1023683522 7:42712964-42712986 GATGACATCTATCACAGGGATGG - Intergenic
1024531785 7:50399827-50399849 GCTGAAATCTACAACCGGGGAGG - Intronic
1026411249 7:70125473-70125495 GAGGAAAACCACCACTGGGAAGG - Intronic
1027735312 7:81925273-81925295 GCTGAACTCTAGCACGGGGACGG - Intergenic
1032506740 7:132441107-132441129 GTTGTGATTTACCATTGGGAGGG - Intronic
1035138722 7:156735300-156735322 CTTGAATTCTACCAATGTGATGG + Intronic
1036131961 8:6123820-6123842 GTTGAAATCTAACAGTGGCAAGG - Intergenic
1039102452 8:33955663-33955685 GTTGAAGTCTCCCACTGTTAAGG + Intergenic
1039421596 8:37448032-37448054 GTTGATATCAAACACTGGCAAGG + Intergenic
1041943586 8:63416900-63416922 GTTAACATTTACTACTGGGATGG + Intergenic
1043346738 8:79306664-79306686 TTTGAAATCAAGCACTGTGAAGG + Intergenic
1045383540 8:101649463-101649485 GTTGAAGTCTCCCACAGTGAAGG + Exonic
1046654548 8:116878806-116878828 ATTAAAATCTACAAATGGGAAGG - Intergenic
1047810645 8:128405239-128405261 GTCGGAATCTACTTCTGGGAAGG - Intergenic
1048117975 8:131546330-131546352 CTAGAAACCTTCCACTGGGATGG + Intergenic
1051225845 9:14898395-14898417 TTTAAAAGCTACCACTGTGATGG + Intronic
1052006890 9:23360104-23360126 TTTGAAATCAACCAATGGGAGGG - Intergenic
1056938961 9:90938749-90938771 GTTGAAATATAGTGCTGGGACGG + Intergenic
1059891728 9:118811772-118811794 GTTGAAAGCTATCATTCGGAAGG + Intergenic
1188470652 X:30534777-30534799 GTTGAAATCTCCCACCATGATGG - Intergenic
1188687638 X:33088456-33088478 GTTGAATTCTACCAATTGCAAGG - Intronic
1188722864 X:33544283-33544305 AATGTAATCTGCCACTGGGAAGG - Intergenic
1189009470 X:37031917-37031939 GTTGACCTCTACCAATGGCATGG + Intergenic
1193431656 X:81413687-81413709 TTTGAAATCTTCCACTTAGATGG + Intergenic
1196456084 X:115892677-115892699 GTAGAACTCCAGCACTGGGAAGG + Intergenic