ID: 1121032076

View in Genome Browser
Species Human (GRCh38)
Location 14:90666796-90666818
Sequence CACAGTGAGAGGAGTAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 281}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121032076 Original CRISPR CACAGTGAGAGGAGTAGAGT GGG Intronic
900865516 1:5266145-5266167 GACAGTGTGTGGAGTGGAGTCGG + Intergenic
901726280 1:11244872-11244894 CACAGAGCTAGGTGTAGAGTAGG + Intronic
901924685 1:12558628-12558650 CACAGAGACAGAAGTAGATTGGG + Intergenic
902402296 1:16164948-16164970 CACAGTGCAAGGAGGAGAGGAGG - Intergenic
904079382 1:27862541-27862563 GACAGAGAGAGGAGGAGAGGTGG - Intergenic
904880505 1:33693021-33693043 GACAGTGAGAGGAGAGGTGTCGG - Exonic
905474377 1:38215507-38215529 CACAGTGATGGGCCTAGAGTAGG - Intergenic
905858933 1:41333425-41333447 CACAGTCACAGGAGTGGAGGGGG - Intergenic
908826494 1:68137652-68137674 CCCAGTGTGAGGAGTATACTTGG + Intronic
909217936 1:72915561-72915583 CCCAGTGATAGAAGTAGAGGAGG - Intergenic
910432003 1:87168008-87168030 CCCAGTGTGAGGAGCAGAGATGG - Intronic
911008330 1:93251970-93251992 CACAGTGAGAGGAGGAAAAAAGG - Intronic
912236921 1:107862335-107862357 CTCAGTGAGAGGGGTAGTGTGGG - Intronic
912741007 1:112197394-112197416 CACACTGAGGGTAGAAGAGTTGG - Intergenic
913441235 1:118900142-118900164 AACAGAGAGAGGAGAAGTGTGGG + Intronic
914392413 1:147234261-147234283 CACAGTTTGAGAAGTAAAGTGGG - Intronic
914416355 1:147486857-147486879 GGCAGTGAGAGGGGTAGGGTTGG + Intergenic
914912533 1:151799408-151799430 GACAGGGAGAGGAGAGGAGTCGG - Intergenic
915956471 1:160224493-160224515 CACTGTGAGAGGAGTTGAAGAGG + Exonic
916671029 1:167020357-167020379 CACAGGCATAGGAGGAGAGTAGG - Intronic
917196862 1:172476086-172476108 CACAATCAGAGGAGCAGAGTAGG - Intergenic
917468711 1:175307615-175307637 CACAGTCAGTGGGGTGGAGTGGG + Intergenic
917921632 1:179755518-179755540 CTCAGTGAGTGGAGAAGAGTTGG + Intronic
920281938 1:204850056-204850078 CACAGTGAGAAGAGAGGACTTGG + Intronic
921578278 1:216864015-216864037 CACAGTGTTAGGAATAGAGAAGG + Intronic
922593227 1:226794613-226794635 CAGAGAGAGAGGAGAAGGGTAGG + Intergenic
1063089050 10:2845394-2845416 CACAGTGAGTAGATGAGAGTGGG - Intergenic
1063112331 10:3047870-3047892 CAGAGAGAGAGGGGGAGAGTGGG - Intergenic
1063333645 10:5187723-5187745 CACATGGAGAGGAGCTGAGTGGG + Intergenic
1067426669 10:46216149-46216171 CACAGAGAGAAGAGTACAGGAGG + Intergenic
1069814827 10:71187100-71187122 GAGAGGGAGAGGAGAAGAGTGGG - Intergenic
1069919213 10:71806130-71806152 CACAGTCAGAGGAAAAGACTGGG - Intronic
1071619428 10:87105652-87105674 AACAGAGAGAAGAGCAGAGTAGG - Intronic
1071743333 10:88387207-88387229 AGGAGTGAGAGGAATAGAGTGGG + Intronic
1072035955 10:91562991-91563013 CACAGTGAGAAGGGTCAAGTTGG - Intergenic
1072124037 10:92429824-92429846 CACAGTGAGTGGCACAGAGTAGG + Intergenic
1072554814 10:96506704-96506726 CACAGCGAGAGGAGAGGAGTGGG - Intronic
1074014116 10:109516023-109516045 TATGGTGAGAGTAGTAGAGTTGG + Intergenic
1074188734 10:111117672-111117694 CCCAGAGAGGGGAGCAGAGTGGG + Intergenic
1074192637 10:111150908-111150930 CACAGTGAGGACACTAGAGTTGG + Intergenic
1075124814 10:119691269-119691291 CACAGTGCCAGGTATAGAGTAGG - Intergenic
1075847506 10:125556563-125556585 CACAGTGAAAGGAGGTGCGTGGG + Intergenic
1077444947 11:2586542-2586564 CACTGTGGGAGGACTGGAGTAGG + Intronic
1077727420 11:4688724-4688746 CACAGTGGTAGCAGTAGAGATGG + Intronic
1078251071 11:9617010-9617032 CAGTGTGACAGGAGTGGAGTGGG + Intergenic
1078694102 11:13612416-13612438 CACAATGAGAGTAGAAGAGGAGG + Intergenic
1080163708 11:29211349-29211371 CACCTTGGAAGGAGTAGAGTAGG - Intergenic
1080842643 11:35998993-35999015 CACAGTGTCAGGTATAGAGTTGG - Intronic
1084192615 11:67505662-67505684 GAGAGTGAGAAGAGGAGAGTGGG - Intronic
1084783859 11:71430279-71430301 CACAGTGAGCTGAGTAGACGGGG - Intronic
1086215175 11:84370560-84370582 CACAGTGTGTGGTGTACAGTAGG + Intronic
1087660851 11:100986394-100986416 CATTGTGACTGGAGTAGAGTAGG + Intronic
1088096631 11:106108195-106108217 CACAGGGAGAGGGGGAGAGGAGG - Intergenic
1088990523 11:114949615-114949637 CACAGAGAGAGGAAGAGAGCTGG - Intergenic
1089170113 11:116505952-116505974 CAAAGTGAGAGGAGGAGAGAAGG - Intergenic
1089359577 11:117876843-117876865 GACAGGGAGAGGAGGAGAGGGGG - Exonic
1089497131 11:118913555-118913577 CACAGGGGGAGGGGTAGAGAGGG + Intronic
1090479936 11:127059177-127059199 CACCGTGAGAGGGGATGAGTAGG - Intergenic
1091172406 11:133530438-133530460 CACAGTGAGAGGAGGGGAAGCGG + Intronic
1091240561 11:134049466-134049488 CACAGAGTGAGGAGAAGAGCAGG + Intergenic
1091353960 11:134921401-134921423 CAAAGTGGGAGGAGAAGAGCAGG - Intergenic
1091838346 12:3601799-3601821 CTCTGTGAGGGGAGAAGAGTGGG + Intergenic
1092233890 12:6793475-6793497 TGCAGTGAGAAGAGTAGAATAGG - Intronic
1093134540 12:15434999-15435021 CACCTTGAGAGGAGAAGGGTAGG - Intronic
1094269932 12:28602253-28602275 CACATTGAGAGAAGCAGAGTGGG + Intergenic
1095748083 12:45682075-45682097 CACACTGAGAGGAGTTCAGCTGG + Intergenic
1096215440 12:49795591-49795613 TGGAGTGAGAGGAGTAGACTCGG + Exonic
1098171865 12:67755182-67755204 TAAAGTGAGAGGAGCAGGGTCGG - Intergenic
1098869394 12:75800312-75800334 CACAGTTAAATGAGTAGAGATGG + Intergenic
1099772960 12:87086687-87086709 CAAAGTGCTAGGAGTACAGTGGG + Intergenic
1100088455 12:90939438-90939460 CACAGTGGAAAGAGTAGAGAAGG + Intronic
1100122353 12:91383497-91383519 CCCAGTGAGAGAAGAAGAGATGG + Intergenic
1101319597 12:103661878-103661900 AAGAGAGAGAGGAGGAGAGTGGG + Intronic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1102704715 12:114870949-114870971 CATAGTGAGTGGAGAAGAGAAGG - Intergenic
1103174734 12:118852916-118852938 TACAGAGAGAGGGGTAGAGGAGG + Intergenic
1104427512 12:128690205-128690227 CAGAGTGAGTGGAGTTCAGTGGG + Intronic
1105760680 13:23511556-23511578 CAGAGTGAGAGGAAGAGGGTGGG - Intergenic
1106688753 13:32090594-32090616 CACAGTTAGAGGGGTATATTGGG + Intronic
1108061206 13:46535169-46535191 CACAGTTTCAGGAGTAGGGTGGG - Intergenic
1108245666 13:48510640-48510662 CACAGTGACAGGAGTAGGATAGG + Exonic
1108611045 13:52084021-52084043 CAGAGTTAAAGGAGGAGAGTGGG - Intronic
1108996668 13:56743013-56743035 CACAGTGATAGTAGGGGAGTGGG + Intergenic
1109245561 13:59950453-59950475 CTGAGTAAAAGGAGTAGAGTAGG + Intronic
1109313882 13:60727259-60727281 CACAGTGGGAGGAGTAAATGGGG - Intergenic
1110454748 13:75678640-75678662 TACACTGAGAGGAGGAGAGCTGG - Intronic
1111006395 13:82255427-82255449 CAAACTGAGAGGGGTAGATTAGG + Intergenic
1112493432 13:99886879-99886901 GACAGTGAGAGGATGAGACTTGG - Intronic
1113438536 13:110311137-110311159 CACAGTGGGAGAAGCAGAGGAGG - Intronic
1113442715 13:110341603-110341625 CACTTTGAGAGGAGCAGAGCAGG + Intronic
1114264982 14:21068721-21068743 CACAGTTAGAGCCGTGGAGTTGG - Intronic
1114466500 14:22926722-22926744 CACACACAGAGGAGTACAGTGGG - Exonic
1115442910 14:33456725-33456747 CACACAGAGATCAGTAGAGTTGG - Intronic
1116623890 14:47241682-47241704 GACAGTCAGAGGAAAAGAGTTGG - Intronic
1116769572 14:49111478-49111500 TCAAGTGAGAAGAGTAGAGTGGG + Intergenic
1118016346 14:61664936-61664958 GACTGTGGGAAGAGTAGAGTAGG - Intergenic
1118752778 14:68818637-68818659 CACAGAGTCAGGAATAGAGTTGG - Intergenic
1120718256 14:87863351-87863373 GACAGTGAGAGCAGGAGAGTTGG + Intronic
1121032076 14:90666796-90666818 CACAGTGAGAGGAGTAGAGTGGG + Intronic
1121644287 14:95507233-95507255 CCCAGTGGGAGGAGTCCAGTGGG - Intergenic
1122118916 14:99541519-99541541 CCCAGGGAGAGGGGTAGAGAAGG + Intronic
1127569666 15:60229748-60229770 CAGAGGGAGAGGAGAGGAGTCGG - Intergenic
1127581707 15:60344745-60344767 CACAGGGAGAGGACTGGAGACGG + Intergenic
1128258252 15:66213967-66213989 CTCAGGGAGAGGAGAAGGGTTGG - Intronic
1129612463 15:77071332-77071354 CATAGTCATAGGAGGAGAGTGGG - Intronic
1129699592 15:77760014-77760036 CACTGTGAGAGGCGGTGAGTGGG - Intronic
1131352995 15:91718525-91718547 CAAAAAGAGAGGAGTAGATTGGG - Intergenic
1131991963 15:98101626-98101648 CACAGTTAAAGGAAGAGAGTGGG - Intergenic
1133358440 16:5154340-5154362 CGCAGTGAAAGGAATAGATTAGG + Intergenic
1133909637 16:10053147-10053169 AACAGTGAATGGAGAAGAGTAGG + Intronic
1134138309 16:11695364-11695386 TAGAGTGAGTGGAATAGAGTTGG - Intronic
1134885257 16:17785228-17785250 CACTGGAAGAGGAGTAGAGTTGG - Intergenic
1137263257 16:46848040-46848062 AACAGTGACAGGTGTAGAGGTGG - Intergenic
1141291127 16:82718894-82718916 CAGAGTGAAAGGAGTTGAGATGG + Intronic
1146712501 17:35054872-35054894 CACAGTGACAGGCTTAGAGTAGG + Intronic
1147135572 17:38432088-38432110 CACAGTGTCAGGGGTAGAGCTGG - Intronic
1147803574 17:43112769-43112791 GAGATTGAGAGGATTAGAGTTGG - Intronic
1149211801 17:54312016-54312038 TAAGGTGAGAAGAGTAGAGTAGG - Intergenic
1150361175 17:64535591-64535613 CACAGTTAGAGGACGAGTGTTGG + Intronic
1151205558 17:72504046-72504068 CAGAGTGAGAGACGTATAGTAGG - Intergenic
1151378416 17:73707928-73707950 CACAGAGAGAGGTGGAGAGGAGG - Intergenic
1152494317 17:80660503-80660525 CACACTCTGAGGAGCAGAGTTGG + Intronic
1152825494 17:82462186-82462208 CAGGGTGAGAGGAGTTGGGTTGG + Intronic
1156509946 18:37627905-37627927 CACAGAGTGGGGAGTAGAGTGGG + Intergenic
1156909616 18:42395147-42395169 CTCAGTAATAGGAGTAGAGTTGG - Intergenic
1157307576 18:46528356-46528378 CAGACTGGGAGGAGTAGAGGCGG + Intronic
1157416771 18:47509902-47509924 CACTGTGAGAGTAGCAGAGGAGG + Intergenic
1160038618 18:75322999-75323021 AACAGTGGGAGGAGGAGAGGGGG - Intergenic
1160045708 18:75385501-75385523 TGCAGTGAGAGGAGAAGAGGAGG + Intergenic
1160986183 19:1839998-1840020 CACTGTGAGAGGAGGAGGGAGGG + Intronic
1161195401 19:2983610-2983632 CAGAGTGAGAGGAGGAGGGGGGG + Intronic
1162450485 19:10751347-10751369 CAAAGGGAGAGGAGAGGAGTAGG + Intronic
1162592666 19:11602857-11602879 CACTGTGAGGAGAGGAGAGTGGG + Intronic
1162792529 19:13070423-13070445 CACAGTGAAAGGAGCAGGGAAGG - Intronic
1164777346 19:30863113-30863135 CACAGGGAGAGGAGAAGAGCAGG + Intergenic
1166840807 19:45695815-45695837 CTCTGTGCGTGGAGTAGAGTGGG - Intronic
925135637 2:1523773-1523795 CACAGTGAGGGGATTAGAAGAGG - Intronic
925135816 2:1524485-1524507 CACAGTGGGAGGATTTGAGGAGG - Intronic
925135845 2:1524593-1524615 CACAGTGAGCGGATTTGAGGAGG - Intronic
925135990 2:1525209-1525231 CACAGTGAGGGGATTTGAGCAGG - Intronic
925136326 2:1526534-1526556 CACAGTGAGAGGATTTGAGGAGG - Intronic
925136433 2:1526968-1526990 CACAGTGTGGGGATTTGAGTAGG - Intronic
925136452 2:1527053-1527075 CACAGTGAGGGGATTTGAGGAGG - Intronic
925136496 2:1527221-1527243 CACAGTGGGGGGATTTGAGTAGG - Intronic
925137116 2:1529765-1529787 CACAGTGGGGGGATTAGAGGAGG - Intronic
925137705 2:1532129-1532151 CACAGTGAGGGGATTAGAGGAGG - Intronic
925138495 2:1535344-1535366 CACAGTGGGGGGATTTGAGTAGG - Intronic
925342377 2:3146434-3146456 CACAGTGAGAGGGGTGGAGCCGG - Intergenic
925749884 2:7078529-7078551 CCCAGGGAGGGGAGGAGAGTAGG - Intergenic
926197582 2:10773060-10773082 CACAGTGACAGGAGGAGAGCGGG + Intronic
927241687 2:20925044-20925066 CACAGTGAGAGCAGCAGAAGTGG + Intergenic
929624543 2:43393136-43393158 GACAGAGAGATGAGTAGAGAGGG + Intronic
930922244 2:56770145-56770167 CACAGTGATATGAGAAGAGAAGG - Intergenic
932193853 2:69765810-69765832 GAAAGTGAGAGGAGGAGAGGGGG + Intronic
933158626 2:79000558-79000580 CACAGTGAGAGGTGTATATGTGG - Intergenic
935164153 2:100555033-100555055 CAGGGTGAGAGGAGTGGAGGCGG - Intergenic
935959432 2:108410107-108410129 CACAGTGAGAAAACTGGAGTGGG - Intergenic
938569800 2:132552370-132552392 CAGAGTGAGAGCAAGAGAGTTGG - Intronic
939769213 2:146293737-146293759 CAGAGTGGGCAGAGTAGAGTGGG + Intergenic
939879171 2:147610545-147610567 CACAGGGATAGGAGTAGCTTTGG - Intergenic
940765731 2:157787890-157787912 CCCAGAGAGAGAGGTAGAGTAGG - Intronic
942183886 2:173405999-173406021 CACAGTGAGTGCAGAAGAGGTGG + Intergenic
942427516 2:175875826-175875848 AACAGGGTGAGGAGTAGATTAGG - Intergenic
943544356 2:189256382-189256404 CACAGTGAGAAGAGAAGCCTTGG - Intergenic
945989176 2:216379304-216379326 CCCAGTGATAGGTGTACAGTAGG + Intergenic
948923041 2:241075136-241075158 CACAGAGAGGGGAGAAGAGCCGG - Intronic
1168808957 20:690398-690420 CCCAAGGAGAGGAGTAGGGTTGG + Intergenic
1169609094 20:7359167-7359189 CAAAGAGAGAGGAGGAGAGTGGG + Intergenic
1172094182 20:32452617-32452639 GACAGGGAGATGAGCAGAGTTGG - Intronic
1172501261 20:35429392-35429414 CACAGTGAGAGGGGCAGAGGAGG - Intergenic
1173416837 20:42864327-42864349 CACAGAGAGAGGAGGGGAGAGGG + Intronic
1173970524 20:47148802-47148824 CAGAGTGAGTGCAGTAGAGTGGG - Intronic
1175290689 20:57873185-57873207 CACAGTGAGAGGAATGAAGGTGG - Intergenic
1177172510 21:17669915-17669937 CACATTGAAAGTAGTAGAGCTGG + Intergenic
1180046434 21:45308416-45308438 CACTGTGCGAGGACGAGAGTAGG - Intergenic
1180181634 21:46120870-46120892 CACACTGAGTGGAGTAGGCTGGG - Intronic
1180515325 22:16135597-16135619 CAAAGTGAGAGGTTTAAAGTTGG + Intergenic
1180750280 22:18119681-18119703 CACAGAGACAGGACTAGAGTGGG + Intronic
1182696451 22:32202232-32202254 CACAGTGAGAGGAGGAGATGTGG - Intronic
1183692065 22:39395999-39396021 CACAGAGAAAGGAGGAGATTTGG - Intergenic
1183696994 22:39429089-39429111 CACAGGCAGGGGAGGAGAGTGGG - Intronic
950143678 3:10632889-10632911 CAGGGTGAGAGGAGGAGAGCAGG - Intronic
950984080 3:17341582-17341604 CACAGAGTAAGGAGTAGAGTTGG + Intronic
951923070 3:27876998-27877020 CATAGTCAGAGCAGCAGAGTGGG + Intergenic
952810943 3:37402016-37402038 AACAGTGAGAGGAGCAGGTTGGG - Intronic
952964694 3:38613889-38613911 CACAGTCAGAGGAGGAAAGGGGG + Intronic
953154198 3:40354030-40354052 CAGGGTGGGAGGAGTAGAGGTGG - Intergenic
953435087 3:42871630-42871652 CACAAGGAGAAGAGTTGAGTAGG - Intronic
954803346 3:53200407-53200429 CACAGTGAGAGGAAGAGTGAAGG - Intergenic
954965235 3:54604656-54604678 CAGGGTGAGAGCAGTGGAGTGGG - Intronic
956740413 3:72271334-72271356 CAAAGTAAGAAGAGTAAAGTGGG - Intergenic
958801311 3:98759324-98759346 CACAGGCAGAGAAGTAGAGGAGG + Intronic
959935639 3:112025667-112025689 GAGAGTCAGAAGAGTAGAGTAGG + Intergenic
961096325 3:124159632-124159654 CACAGCTAGAGGAGCAGAGAAGG - Intronic
961333934 3:126158962-126158984 CACAGAGTGAGCAGTAGAGGGGG - Intronic
961445419 3:126978770-126978792 CACAGTGTGGAGAGCAGAGTTGG + Intergenic
964682867 3:159361712-159361734 CACAGTGGGAGGAGAAGAGTTGG + Intronic
965679356 3:171234469-171234491 CACAGTGAGTGGTGTTGAGATGG - Intronic
966549788 3:181192511-181192533 TACAGTGAGAGGAGAGGAGTGGG + Intergenic
966731833 3:183158115-183158137 CACAGGGAGAAGAGGAGAGTGGG - Intronic
967852997 3:194096099-194096121 CACAGTGACTGGAATATAGTAGG - Intergenic
968554048 4:1238393-1238415 CACAGTGGGTGGCGTGGAGTGGG - Intronic
969466712 4:7361666-7361688 CACAGTGAGAGAAGGGGTGTGGG + Intronic
969875314 4:10131872-10131894 CACAGTGAGGGGAGCTGACTTGG + Intergenic
970065378 4:12087756-12087778 CACAAGGAGAGGAGTATGGTGGG + Intergenic
972810038 4:42573772-42573794 CAGAGTGAGTGGGGAAGAGTGGG + Intronic
978068513 4:104436664-104436686 CACAGTTAGACAAGTAGATTTGG - Intergenic
981563038 4:146067659-146067681 CACAGTGAGAGGGTGAGGGTAGG + Intergenic
982307625 4:153949949-153949971 CTCAGTTAGATGAGTAAAGTGGG - Intergenic
982942925 4:161581363-161581385 CACAGTGGGAGGAGAAGAGAGGG + Intronic
983054923 4:163090635-163090657 CACAGTGAGAGGATAATAATAGG + Intergenic
983648781 4:170018487-170018509 CCCAGTGAAAGGAGGAGAGGCGG + Intronic
984755166 4:183319469-183319491 CACAGTGAGATGACTAGAGCGGG + Exonic
986008359 5:3687215-3687237 CATAGAGAGAGGAGTGGGGTGGG + Intergenic
986017748 5:3772611-3772633 CACAGTGCTAGGAGTTTAGTTGG + Intergenic
986171172 5:5316008-5316030 CCCACTGAGAGGAGAAAAGTTGG - Intronic
990365414 5:55065697-55065719 CACAGTGGGTGGAGGGGAGTAGG - Intergenic
993838671 5:92848167-92848189 CACAGGCAGAGAAGTAAAGTTGG - Intergenic
994294208 5:98069474-98069496 CAAAGGGAGAGGACAAGAGTAGG + Intergenic
995839620 5:116430929-116430951 CACTGTGTGAGGAGTAGCCTAGG - Intergenic
996160235 5:120152826-120152848 CAAAGTGAGAGGAGTGGTGCTGG + Intergenic
998091549 5:139373813-139373835 CACAGTGGGCACAGTAGAGTGGG + Intronic
998489143 5:142530899-142530921 CACAGTGAGAGCTGCAGAGGTGG - Intergenic
998669489 5:144337796-144337818 CATAGTGAAGGGAGAAGAGTGGG + Intronic
999366966 5:151029543-151029565 CTGAGTGAGAGAAGCAGAGTGGG - Intergenic
1002823717 6:753783-753805 CACGGTGAGAAGAGTGGGGTTGG + Intergenic
1003568694 6:7241708-7241730 CTCAGTGGGAGGCGTAGAGATGG - Intronic
1004755032 6:18601710-18601732 CACTGTGACAGGAGCAGTGTGGG + Intergenic
1004787223 6:18982698-18982720 TTTAGTGAGAGGAGTGGAGTAGG + Intergenic
1004807553 6:19220955-19220977 GACAGTGAGAGCAGGACAGTGGG + Intergenic
1005294582 6:24412941-24412963 CAGAGTGGGAGGAGGAGAGAGGG + Intronic
1006181002 6:32153513-32153535 TATAGGGAGGGGAGTAGAGTAGG + Exonic
1006300832 6:33192807-33192829 CACAGTGGGAGGGGGAGAGGCGG + Intergenic
1006460490 6:34154996-34155018 CACTGTGGGAGGCGTAGACTGGG - Intronic
1007394603 6:41570391-41570413 CACAGTGAGAGAAGGACAGGTGG + Intronic
1008763263 6:54879596-54879618 GAGCGTGAGAGAAGTAGAGTAGG + Intronic
1010454987 6:76044419-76044441 CACAGTGAGAAGAATGGAGAAGG - Intronic
1010730731 6:79388190-79388212 GACAGAAATAGGAGTAGAGTTGG - Intergenic
1010790327 6:80056515-80056537 CACAGTGACTGGAGTATACTTGG + Intergenic
1013091707 6:106906155-106906177 CCAAGTGATAGGAATAGAGTAGG - Intergenic
1013163266 6:107566558-107566580 CACCGTGAGAGAAGGAGAGGTGG - Intronic
1013619712 6:111875848-111875870 CAGAGAGAGAGGAGGAGAGAGGG - Intergenic
1014063647 6:117101269-117101291 GACAGTGAGTGAAGGAGAGTGGG - Intergenic
1014550038 6:122779585-122779607 CACAGAGAGAGGAGAAGGGAAGG - Exonic
1014741276 6:125150353-125150375 CAAAGCCAGAGGAGTAGAGATGG + Intronic
1014769745 6:125447085-125447107 CTCAGTGAGAAGAGCAGAGAGGG - Intergenic
1015116634 6:129656687-129656709 CACAGTAAGAGGAGGTGAGAAGG + Intronic
1015202719 6:130600983-130601005 AACAGTGAGAGTAAGAGAGTTGG - Intergenic
1016344477 6:143097677-143097699 CTGAGTGAGAGGATTAGAGAGGG - Intronic
1016399612 6:143665471-143665493 AACAGTGAGTGGAGTGGATTTGG - Intronic
1016527116 6:145014285-145014307 GAGAGTGAGGGGAGAAGAGTTGG + Intergenic
1017698332 6:157041853-157041875 CTTAGTAAGAGGAGTTGAGTGGG - Intronic
1018340575 6:162846989-162847011 CACAGTGTGGGGAGCACAGTGGG - Intronic
1020559732 7:9716001-9716023 CACAGTGGGATGAATAGAGGAGG + Intergenic
1021613945 7:22483181-22483203 CTCAGTGTGAGGTATAGAGTCGG - Intronic
1021692162 7:23241231-23241253 CATAGTGAGAGAAGCAGAATGGG - Intronic
1021962503 7:25886991-25887013 CACAGTGACAGGAGATGAGATGG - Intergenic
1022389681 7:29932686-29932708 TACACTGAGAGGAGAAGAGGAGG + Intronic
1022408390 7:30114989-30115011 CACACTGAAAAGAGTAGATTAGG - Intronic
1024804025 7:53114914-53114936 CACAGGGAGAGGAACAGAGTAGG + Intergenic
1026452280 7:70539967-70539989 AACAGTGGGAGGAGTAGGGCTGG - Intronic
1027045891 7:74991297-74991319 TACAGTGAGATGACTAGCGTGGG - Intronic
1027441033 7:78219452-78219474 CTCAGTGAGAAGAGAAAAGTGGG - Intronic
1027669826 7:81082126-81082148 CATAGTGAGTAGAGTACAGTTGG - Intergenic
1028618722 7:92800284-92800306 CACAGTGTGAGGAGAAGAGGAGG - Intronic
1029255278 7:99265445-99265467 GACAGTGACAGGAGAAGACTGGG + Intergenic
1029796098 7:102896082-102896104 CAGAGTGGCTGGAGTAGAGTTGG + Intronic
1030960531 7:115915261-115915283 CACAGTGCGATGTGTAGACTGGG - Intergenic
1033659544 7:143393999-143394021 CACAGTGGGAGGATCAGGGTGGG + Intronic
1033754838 7:144389797-144389819 CACTGAGAGATGTGTAGAGTAGG - Intergenic
1033809556 7:144995481-144995503 GCTAGGGAGAGGAGTAGAGTAGG - Intergenic
1036600030 8:10252281-10252303 CTCACTGAGAGGAGCAGAATGGG - Intronic
1038053570 8:23836611-23836633 CATAGTGGGAGGGGTAGAGTAGG + Intergenic
1038335313 8:26641154-26641176 CACAGGGAGAGGATGAGCGTCGG + Intronic
1038394241 8:27235367-27235389 CACAGTGTGCAGAGCAGAGTGGG + Exonic
1038515126 8:28181669-28181691 CAGAGTCAGGGGAGTTGAGTGGG + Intronic
1039358753 8:36850805-36850827 CACAATGAAAAGAGTAAAGTTGG - Intronic
1042255218 8:66795819-66795841 GAGAGTGAGAGGGGTAGGGTGGG - Intronic
1043122564 8:76346599-76346621 CCCAGTGAGAAGAGTAGAGCTGG + Intergenic
1043918165 8:85948870-85948892 CACGGTGGGAGTACTAGAGTTGG + Intergenic
1045879983 8:107027235-107027257 AAGAGTGAAAGGAGAAGAGTGGG + Intergenic
1046042138 8:108918605-108918627 CTCCGGGAGAGGAGCAGAGTCGG - Intergenic
1047198837 8:122746469-122746491 CAGAGTGGGAGTCGTAGAGTGGG - Intergenic
1050077650 9:1881728-1881750 GAAAGTGAGAGGAGGAGAGAGGG + Intergenic
1050221637 9:3397603-3397625 CAAGGTGACAGGAGTAGACTTGG + Intronic
1050634843 9:7601274-7601296 CACAACGAGAGGGATAGAGTAGG - Intergenic
1050762518 9:9089859-9089881 CACAGTGAAAGGAGTAAATATGG - Intronic
1053729294 9:41036252-41036274 CTCAGGGAGACAAGTAGAGTGGG + Intergenic
1054699218 9:68395814-68395836 CTCAGGGAGACAAGTAGAGTGGG - Intronic
1054977325 9:71163190-71163212 CACAGTGTGAAGAATAGATTGGG + Intronic
1055463213 9:76538590-76538612 CACAGTGAGAGAGGGAGAGATGG - Intergenic
1056292448 9:85157309-85157331 CTCAGTGAGAGGTGGGGAGTGGG - Intergenic
1058177933 9:101759862-101759884 GACAGTGATAGGAGAAGAGGAGG - Intergenic
1058683515 9:107460619-107460641 CAGAGAGAGAGGAGTAAAGTAGG + Intergenic
1059227407 9:112684936-112684958 CAGAATGAGAGGAGAAGAGCAGG - Exonic
1059591981 9:115671773-115671795 CAGAGTGACAGCAGTAGAGATGG + Intergenic
1061994552 9:134177053-134177075 CACAGGGGGAGGAGGAGAGACGG - Intergenic
1062002891 9:134225751-134225773 GACAGAGAGAGGAGTGGGGTTGG + Intergenic
1062005518 9:134236699-134236721 CACAGAGAGTGGAGTAGGGAAGG + Intergenic
1062179041 9:135180799-135180821 CACAGTGGGAAGGGCAGAGTGGG - Intergenic
1185885302 X:3777011-3777033 CACAGTGGGAGGAAGAGAGATGG + Intergenic
1186348208 X:8716434-8716456 CACAGTCAGAGGAGAAGGTTTGG - Intronic
1186595678 X:10979159-10979181 CAAAGTGAGCGGAGTTGAGCAGG - Intergenic
1188237533 X:27748236-27748258 CACTGTGAGAGGAGTTGAAGAGG - Exonic
1188572837 X:31610017-31610039 CAGAGAGAGAGGAATGGAGTGGG - Intronic
1189590133 X:42502125-42502147 TACAGTGAGAGAACTAGAGCTGG - Intergenic
1190984056 X:55484772-55484794 CACAGTGAGAGGAATAAAGAGGG + Exonic
1191666395 X:63707001-63707023 CACAGTGAATGGTGTATAGTTGG - Intronic
1192502409 X:71662714-71662736 CAAAGTGGGAGGAGAAGAGGAGG + Intergenic
1192511149 X:71721071-71721093 CAAAGTGGGAGGAGAAGAGGAGG - Intergenic
1192515548 X:71760482-71760504 CAAAGTGGGAGGAGAAGAGGAGG + Intergenic
1193705790 X:84819508-84819530 CACAGAGAGAGGGATAGAGTGGG + Intergenic
1197866986 X:131029445-131029467 GAGAGTGAGAGGAGCAGAGATGG + Intergenic
1198111996 X:133509993-133510015 CCCAGTGTGAGGAGGAGATTGGG - Intergenic
1198992464 X:142530697-142530719 CACTGTGAAATGAGCAGAGTGGG + Intergenic
1200311186 X:155079373-155079395 CACAGTGGGAAGAGCAGACTTGG - Intronic
1201913468 Y:19157259-19157281 CACAGTGGGAGGATAAGAGATGG - Intergenic