ID: 1121035940

View in Genome Browser
Species Human (GRCh38)
Location 14:90703726-90703748
Sequence ACATAGAAACTCAACAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 245}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121035936_1121035940 -7 Left 1121035936 14:90703710-90703732 CCAGTTCAAAACCATAACATAGA 0: 1
1: 0
2: 0
3: 10
4: 143
Right 1121035940 14:90703726-90703748 ACATAGAAACTCAACAGGGAAGG 0: 1
1: 0
2: 0
3: 11
4: 245
1121035934_1121035940 4 Left 1121035934 14:90703699-90703721 CCTACAGGCCTCCAGTTCAAAAC 0: 1
1: 0
2: 1
3: 10
4: 142
Right 1121035940 14:90703726-90703748 ACATAGAAACTCAACAGGGAAGG 0: 1
1: 0
2: 0
3: 11
4: 245
1121035935_1121035940 -4 Left 1121035935 14:90703707-90703729 CCTCCAGTTCAAAACCATAACAT 0: 1
1: 0
2: 1
3: 17
4: 177
Right 1121035940 14:90703726-90703748 ACATAGAAACTCAACAGGGAAGG 0: 1
1: 0
2: 0
3: 11
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121035940 Original CRISPR ACATAGAAACTCAACAGGGA AGG Intronic
900261861 1:1735190-1735212 ACATAAAAACTAACCAGGCATGG + Intronic
900698465 1:4027745-4027767 GCCTGGAAACTCAACAGCGAAGG - Intergenic
902249886 1:15147394-15147416 AAACAGAAACTCATCAGGAAAGG + Intergenic
903295111 1:22338780-22338802 CCATGAAAACTCACCAGGGAAGG - Intergenic
904497086 1:30893116-30893138 ACATGGAAAGGCAAAAGGGAGGG + Intronic
905883179 1:41477546-41477568 ACATAGAAAGAAAATAGGGAGGG - Intergenic
907168320 1:52435481-52435503 ACAAAGAAAATCAACAGATAAGG + Intronic
907776544 1:57521681-57521703 ACAGAGAAAGTGAACAGGGGAGG + Intronic
907804993 1:57810046-57810068 AGTTGGAAACTCATCAGGGAAGG - Intronic
908326255 1:63026884-63026906 AAATGGAAAATTAACAGGGAAGG - Intergenic
908828476 1:68156217-68156239 ACATAGAAACCCAACATTGATGG - Intronic
910011975 1:82475575-82475597 ACATTGAAACACAACATGGAAGG + Intergenic
910680021 1:89853433-89853455 TCGTTGAAACTCCACAGGGATGG + Intronic
910702971 1:90096424-90096446 ACAAATAAATTCAACAAGGAAGG + Intergenic
912647311 1:111405800-111405822 ACATAGAAACTAAATGGTGAAGG + Intergenic
915558250 1:156671890-156671912 AAAAAGAGACTCAACAGCGACGG - Exonic
923735010 1:236598147-236598169 ACTTAGAAATTCAAAAGAGAAGG + Intronic
924720513 1:246618683-246618705 CCAGAGAAACTCAACAGAAAGGG - Intronic
1063686060 10:8238061-8238083 ACATTGAAACTCAGCAGGCTTGG - Intergenic
1063835192 10:10004229-10004251 CCATAGAAACTCAACAGGACAGG - Intergenic
1064119829 10:12609082-12609104 GCATAGACACTCAACTGTGATGG + Intronic
1065720965 10:28628559-28628581 ACATGGCAAGTCAACAAGGAGGG - Intergenic
1065990626 10:31006361-31006383 AAATAGAAACCCAAAAGGGCAGG + Intronic
1066014056 10:31220361-31220383 ACAGAAAAACTCAACCTGGAAGG + Intergenic
1068405183 10:56578834-56578856 AAATAGCAAATCAGCAGGGAAGG - Intergenic
1068415461 10:56715452-56715474 ACTGAGACAATCAACAGGGATGG + Intergenic
1069563741 10:69449897-69449919 ATACACAAACTCAACAGAGAAGG - Intergenic
1073319148 10:102603568-102603590 ACTGAGAAACTCAGCAGTGATGG - Intronic
1073578579 10:104643880-104643902 ACAGAAAAACTCTTCAGGGAGGG - Intronic
1075450577 10:122549341-122549363 AACTAAACACTCAACAGGGAGGG - Intergenic
1076435459 10:130438252-130438274 ACATTGAACCTCAAAAGGGAGGG - Intergenic
1077197998 11:1291138-1291160 GCAAACAAACTCAACATGGATGG + Intronic
1077456963 11:2687110-2687132 ACACACAAACTGCACAGGGAGGG + Intronic
1077715216 11:4573874-4573896 ACATAGAGACTCAGAAGGGTGGG - Intronic
1080306150 11:30839020-30839042 TCAGAGAAACTCAACGGGGATGG + Intronic
1080870308 11:36230919-36230941 ACATAGAGACTATACACGGAGGG - Exonic
1081138106 11:39464382-39464404 AGATAGAAATTCAACAATGAGGG + Intergenic
1081273600 11:41119090-41119112 ATACAGAAAATCAAGAGGGAAGG - Intronic
1082678633 11:56141864-56141886 TCATAGAAACTACACAGGGCAGG - Intergenic
1083996317 11:66274782-66274804 ATGCAGACACTCAACAGGGAGGG - Intronic
1084591287 11:70092161-70092183 ACAGAGACACACAACAGAGAGGG - Intronic
1086026627 11:82301205-82301227 TAATAGGAACTCAACAGAGATGG + Intergenic
1086191825 11:84088701-84088723 ACAGAGAAAATCAAAAGAGAGGG + Intronic
1087225780 11:95596478-95596500 AAATAGAAGCTCATCAGGGGTGG - Intergenic
1090564559 11:127974198-127974220 GCATAGAAACTTACCAGAGAGGG + Intergenic
1092236776 12:6815368-6815390 ACATAGAACATCATCAGGGTTGG - Intronic
1093432591 12:19100882-19100904 GCATAGAAATTAAACAGGGGAGG + Intergenic
1093586425 12:20842718-20842740 ACATTAAAAGGCAACAGGGAAGG - Intronic
1095324135 12:40867226-40867248 ACATAGAAACTAAAAAGACAAGG + Intronic
1096243292 12:49970864-49970886 ACAGAGACACGCAGCAGGGACGG + Intronic
1097396719 12:59084019-59084041 GCTTAGAAACTCAAGAGGAAAGG + Intergenic
1098391674 12:69976253-69976275 AAGTAAAAACGCAACAGGGATGG - Intergenic
1098430747 12:70417387-70417409 ACAAAGCACCTAAACAGGGATGG + Intronic
1101370994 12:104130311-104130333 AAATAAAAATTCAACAGAGATGG - Intronic
1102495890 12:113319467-113319489 CCAGAGACACGCAACAGGGAGGG - Intronic
1103586845 12:121962599-121962621 ACATGTAAACTCCACAGTGATGG - Intronic
1107150360 13:37104510-37104532 ACATAAAACTTCAACAGGGGTGG + Exonic
1107337928 13:39375387-39375409 GCATAGAGAGTGAACAGGGATGG + Intronic
1107354439 13:39551586-39551608 ACTCAGAAACTTAAAAGGGAAGG - Intronic
1107359947 13:39607238-39607260 ACAAAAAAACTCAAGAGGGCTGG + Intergenic
1110160709 13:72374702-72374724 ACATAGAGACTGCACAGAGAGGG - Intergenic
1112563043 13:100530697-100530719 ACATAGAGACACAGCAGGAAAGG - Exonic
1113349563 13:109515026-109515048 AAACAGAGATTCAACAGGGAGGG - Intergenic
1115708377 14:36022261-36022283 ACAGAGAGTCTCAACTGGGATGG + Intergenic
1120850501 14:89164860-89164882 ACATAGAAAGTGAAAGGGGAAGG + Intronic
1121035940 14:90703726-90703748 ACATAGAAACTCAACAGGGAAGG + Intronic
1121086025 14:91146699-91146721 ACATGGAAACTCAGAATGGAAGG + Intronic
1123113647 14:105884171-105884193 ACATAGGAGCTCACCAGTGAGGG - Intergenic
1123115873 14:105893810-105893832 ACATAGGAGCTCACCAGTGAGGG - Intergenic
1123117898 14:105902920-105902942 ACATAGGAGCTCACCAGTGAGGG - Intergenic
1123120115 14:105912525-105912547 ACATAGGAGCTCACCAGTGAGGG - Intergenic
1123402850 15:20004111-20004133 ACATAGGAGCTCACCAGTGAGGG - Intergenic
1123512189 15:21010765-21010787 ACATAGGAGCTCACCAGTGAGGG - Intergenic
1126684210 15:51233194-51233216 ACATAGAAAAAGAATAGGGAAGG - Intronic
1126732266 15:51695983-51696005 ACATAGAATCTCACCAAGGTAGG - Exonic
1131381232 15:91965546-91965568 ACATAGAAAAACAAAAGGGAAGG - Intronic
1133329349 16:4962330-4962352 ACCTAGAGACTCAACAGCGAAGG - Intronic
1135075134 16:19386723-19386745 AGCTAGAAACTCACCAAGGAGGG + Intergenic
1135856373 16:26014738-26014760 ACTTAAAAACTCATCAGTGATGG - Intronic
1136407721 16:30058284-30058306 ACAAGGAAACTGAAGAGGGAGGG - Intronic
1136916100 16:34199421-34199443 ACATAAAAACTACACAGGGCCGG - Intergenic
1137017148 16:35388977-35388999 ACATTGAAACTTAAGAGGCAAGG + Intergenic
1138160112 16:54745375-54745397 ACAAAGAAGCTGAAAAGGGAAGG + Intergenic
1139384176 16:66553588-66553610 ACAGAGAAACCTTACAGGGAAGG + Intronic
1140461500 16:75143540-75143562 ACATAAAAAATTAACAGGGCTGG - Intergenic
1141342074 16:83212667-83212689 TCAGTGATACTCAACAGGGATGG + Intronic
1143600166 17:7939944-7939966 AGACTGAAATTCAACAGGGATGG + Intronic
1144139553 17:12335837-12335859 ACTTATTAACTAAACAGGGAGGG - Intergenic
1144441681 17:15288186-15288208 AGATAGAAAGTTAAAAGGGAAGG + Intergenic
1146749791 17:35368207-35368229 AGATAGAAACTGAACAGAAAGGG + Intronic
1149087612 17:52737311-52737333 ACATAGATACCCATCAGTGATGG - Intergenic
1149427381 17:56568596-56568618 ACAAAGAATCTCATCAGAGAAGG + Intergenic
1155759466 18:29548066-29548088 CCATAAAAACTCAAGAGGAATGG + Intergenic
1156290558 18:35746038-35746060 CCATAGAAAACCAACATGGAAGG - Intergenic
1156428230 18:37039704-37039726 ACATAGAAAACTAACAGGCAGGG - Intronic
1156854469 18:41765984-41766006 AGGTAGAAACTAAACAGGTAAGG - Intergenic
1157431691 18:47633320-47633342 TCATAGACTCTCAAGAGGGAAGG + Intergenic
1158346266 18:56519933-56519955 ACATAGAAATTAGAGAGGGAAGG + Intergenic
1158612070 18:58950268-58950290 AAATAGAAACTGAAGAGGGGTGG + Intronic
1159154007 18:64558450-64558472 AAATAGAAACTTTACAGAGAAGG - Intergenic
1164141374 19:22468272-22468294 TCATAGAAACAAAACATGGAAGG - Intronic
1164677133 19:30109076-30109098 ACACAGAACCTCAACAGGACAGG - Intergenic
1166631094 19:44408739-44408761 TCATAGAAACTCAAAAGGACTGG - Intergenic
1167110663 19:47458737-47458759 AGAAAGAAACTCACAAGGGAGGG - Intronic
1167110765 19:47459413-47459435 AGAAAGAAACTCACAAGGGAGGG - Intronic
925046514 2:777095-777117 ACAAAGAAACTCAGCCCGGAGGG - Intergenic
925318410 2:2942254-2942276 ACATTGAGACTCAAGAGGAAAGG - Intergenic
925636298 2:5944105-5944127 ACATAGAAACTCTAAAGATATGG - Intergenic
926455035 2:13056494-13056516 AAATAGACACTCATCAAGGATGG + Intergenic
927322279 2:21761260-21761282 ACATAGGAAGTTATCAGGGAAGG - Intergenic
928420103 2:31131764-31131786 ATTTATAAACTGAACAGGGACGG - Intronic
928917943 2:36493510-36493532 ACACACAGACCCAACAGGGATGG + Intronic
929897084 2:45970103-45970125 ACACAGAGACTGCACAGGGAAGG - Intronic
930564968 2:53007110-53007132 ACACTGAAACTCAACAGCCAAGG - Intergenic
933394518 2:81713747-81713769 ACAGAGAAAGTGAATAGGGATGG - Intergenic
935747365 2:106200302-106200324 ACCTAGAAACTCCACAATGATGG - Intergenic
937026121 2:118699184-118699206 AATTAGAAACTCAATAGGAAGGG + Intergenic
939017868 2:136922191-136922213 ACATAGGAACTCAGTATGGATGG + Intronic
939630340 2:144521008-144521030 ATAGAGAAACTTAGCAGGGAAGG + Intronic
940654158 2:156468308-156468330 ATATAGAACCTCATCAGAGAAGG - Intronic
944129535 2:196332176-196332198 ATTGAGAAACTCCACAGGGAAGG - Intronic
946151138 2:217771855-217771877 ATATAGAAACTAGAGAGGGAAGG + Intergenic
947561592 2:231158659-231158681 ACATAGTAACTAACCTGGGATGG - Intronic
947897848 2:233692144-233692166 ACATAAAAACTCAGAAGGGCAGG + Intronic
949067327 2:242000600-242000622 ACATAGAAATTCACCGTGGAAGG - Intergenic
1168959447 20:1858781-1858803 ATAAAGGAACTCCACAGGGAAGG + Intergenic
1170297542 20:14844810-14844832 ACTCAGAAAATCCACAGGGAAGG - Intronic
1173017184 20:39236371-39236393 AGGCAGAAGCTCAACAGGGAAGG - Intergenic
1173537380 20:43825916-43825938 CCAGAGAAAGTCAGCAGGGAGGG + Intergenic
1174837627 20:53873340-53873362 AAAAAGAACCTCAAAAGGGAAGG + Intergenic
1175013370 20:55763065-55763087 ATTTAGAAAGTCAATAGGGAGGG + Intergenic
1177308941 21:19361377-19361399 TCAGATAAACTCCACAGGGAAGG - Intergenic
1177908250 21:26998231-26998253 ACAAAGAAACTAAACAGGGCCGG - Intergenic
1179028383 21:37699308-37699330 AGGTAAAAACTCAACAGGCAAGG - Intronic
1180106729 21:45623524-45623546 ACACAGACACGCAAGAGGGATGG + Intergenic
949097651 3:104906-104928 AAAAAGAAACTGAAAAGGGATGG + Intergenic
949529236 3:4937550-4937572 GAAAAGAAAATCAACAGGGAAGG - Intergenic
949894230 3:8757544-8757566 ACCTAGAAATCCAAAAGGGAAGG + Intronic
951150378 3:19282449-19282471 AGATAGAAACACAAAAGGTAAGG + Intronic
953168917 3:40489761-40489783 GCATAGTAACTCATCAGGAATGG - Exonic
953183904 3:40620758-40620780 TCAAAGCAACTCAAGAGGGAAGG - Intergenic
953272057 3:41455411-41455433 ACATAGAAACTCAAGAGATCAGG + Intronic
954519848 3:51215099-51215121 ACAAAAAAACTCAACTGAGAGGG - Intronic
956073815 3:65483724-65483746 ACAACAAATCTCAACAGGGAGGG + Intronic
956788470 3:72661958-72661980 CTATAGAAATTCAAGAGGGAAGG + Intergenic
959365850 3:105456464-105456486 ACATAGAAAAACAGCAGGAAAGG - Intronic
959871709 3:111336507-111336529 ACAGAAAATCTGAACAGGGAGGG + Intronic
960640777 3:119820717-119820739 ACTTAGAAACTAAAAAGGCAGGG + Intergenic
960731250 3:120729800-120729822 TCATAGAAAGTCAAGAGGAAGGG + Intronic
962296732 3:134196270-134196292 ACATAGAAATTCAGCATGAAGGG + Intronic
962333619 3:134504980-134505002 AAAGAGAAATTCAACAGAGATGG - Intronic
965684397 3:171286318-171286340 ACATGGAAATTCAATAGGGAAGG + Intronic
965975665 3:174618120-174618142 AGATAGTAACTCAACATAGATGG + Intronic
966990340 3:185223743-185223765 ATAGAGAAACTCATCAGGGCTGG + Intronic
968201334 3:196758182-196758204 ACGTATAAACTCCACAGGCAAGG - Intronic
968242038 3:197098688-197098710 ACATAAAAATTAAACAGGCATGG - Intronic
1202736856 3_GL000221v1_random:9602-9624 ATATAGAAACTGAAAAGGTAAGG + Intergenic
968971069 4:3794402-3794424 AAATAGAAACTCCACAATGATGG + Intergenic
970564160 4:17315136-17315158 ACATAGACAATCAAATGGGAAGG + Intergenic
970874018 4:20848669-20848691 ACAGAGAAACCCTACGGGGATGG + Intronic
971027105 4:22599476-22599498 AGAGAGAAACACAACAGGGCAGG - Intergenic
974465743 4:62253450-62253472 CCATAGACAAGCAACAGGGAAGG + Intergenic
974508156 4:62804213-62804235 AGACAGAAAATCAACAGAGAAGG - Intergenic
976078504 4:81326909-81326931 AAATTGAAAATAAACAGGGAGGG + Intergenic
976319003 4:83690236-83690258 ACAAAAAAAATCAACAGGCATGG - Intergenic
976341461 4:83950152-83950174 CCATGGAAATTCAACAGGAAAGG - Intergenic
977718349 4:100209378-100209400 GCATAAAAACTCAGAAGGGAGGG + Intergenic
978009558 4:103663031-103663053 ACACAGAAAGTAAAGAGGGAAGG + Intronic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
979951005 4:126893609-126893631 ACAAAGATAAGCAACAGGGAAGG - Intergenic
981196322 4:141925167-141925189 ACATAAAAACTGATCAGTGAAGG + Intergenic
982926634 4:161345539-161345561 AAATGGAGATTCAACAGGGATGG - Intergenic
983079996 4:163373022-163373044 CCATAAAAACTCAAGAGGGCAGG - Intergenic
984250280 4:177323922-177323944 ACATAGGTACTCTCCAGGGAGGG - Intronic
985393814 4:189519933-189519955 ACATATAAACTGAACAGTAAAGG - Intergenic
986190719 5:5494306-5494328 ACTGAAAAACTCAAAAGGGAAGG + Intergenic
987016041 5:13820522-13820544 ACATTGAAACACAACAATGATGG + Intronic
987057444 5:14207871-14207893 AAATAGACACTCAACAAAGAAGG + Intronic
987095021 5:14541780-14541802 AAAGAGAAATTCAACAAGGATGG - Intergenic
987247737 5:16065404-16065426 GCATAGAAACTCAAAAGAGGCGG - Intergenic
987491841 5:18590932-18590954 ACCTATAAAATCAACACGGATGG + Intergenic
987790403 5:22558880-22558902 ACATAGGAAATTAACAGAGAAGG + Intronic
988413527 5:30916434-30916456 ACACAGAAACTCAGCAGGACTGG + Intergenic
989409532 5:41102461-41102483 ACATAGCCACTCAAAAGGAAAGG - Intergenic
990874174 5:60465937-60465959 ACAGAGTAATTCAACAGGAAGGG + Intronic
992581014 5:78175663-78175685 ACATAGAAACTCTTCAGATAAGG + Exonic
994336980 5:98578510-98578532 ACATAGATAATAAAAAGGGAAGG - Intergenic
996395341 5:123007924-123007946 AAATAGAAACTGAACCGGGGCGG + Exonic
996610809 5:125377347-125377369 AGCCAGAAACTCAGCAGGGAAGG - Intergenic
996968968 5:129340431-129340453 ACAAAGAAACTCAACAAGAATGG - Intergenic
997278203 5:132616820-132616842 ACATGAAAACTCTACAAGGAAGG - Intronic
998601099 5:143586029-143586051 AGAAAGAAAGTGAACAGGGAGGG - Intergenic
998957124 5:147450302-147450324 AAATAAACACTCAACAGGTATGG + Intronic
999415884 5:151395550-151395572 TTATAGAAACTCAAAAGGGGAGG - Intergenic
1000161243 5:158599693-158599715 ACGTATTAACCCAACAGGGAAGG + Intergenic
1000218988 5:159193370-159193392 GCATAGAAAATCAACCAGGAAGG + Intronic
1000244930 5:159441504-159441526 TCTTAGAAACTGCACAGGGAAGG + Intergenic
1000396993 5:160786498-160786520 AAATAGAAGCTCAAGAGAGAGGG + Intronic
1000891061 5:166803168-166803190 ACATAAAAAATCATCAGGAATGG + Intergenic
1001439184 5:171725724-171725746 ACAAAGAAACTGAACTAGGATGG - Intergenic
1001590834 5:172863897-172863919 ACATGAAAACTCAACATGGCCGG + Intronic
1001737423 5:174017933-174017955 AGACAGAAAGTCAACAAGGAGGG - Intergenic
1004764590 6:18711683-18711705 ACATATAAACTCTACAAGGTAGG + Intergenic
1007509494 6:42364341-42364363 AAAGAGAAATACAACAGGGAAGG - Intronic
1007768259 6:44173882-44173904 AGATAGAAAGTAAACAGGGCTGG - Intronic
1008564466 6:52753613-52753635 ACAGAGAATTTCACCAGGGAAGG - Intronic
1011111211 6:83838234-83838256 ACACAGAAACTCAAAATGGCTGG - Intergenic
1011175384 6:84553816-84553838 ACATGGAAACTCCAGAGGAAAGG - Intergenic
1012764961 6:103356269-103356291 ACATAAAAAATTAACATGGATGG - Intergenic
1017611198 6:156188258-156188280 AAAAAAAAACTCAACAGGAAGGG + Intergenic
1017730973 6:157315260-157315282 GCTTAGAAAGTCAACAGGTAAGG + Intronic
1017911602 6:158797788-158797810 ACATAGTGACTCAACATGAAAGG - Intronic
1018237340 6:161739250-161739272 ACATAAAAATTCACCAGGTATGG + Intronic
1020712377 7:11623950-11623972 ACATAGAAACAAAATAGGGCAGG + Intronic
1021523643 7:21562139-21562161 ACATAGCAACTCTTCAAGGAAGG - Intronic
1022834746 7:34102847-34102869 ACAAAGAAACACAGCAGGGGAGG + Intronic
1024751761 7:52474432-52474454 ACATACAAATACAACAGGCACGG + Intergenic
1025071922 7:55907129-55907151 ACATAGGAAGCAAACAGGGAAGG - Intronic
1025761237 7:64396083-64396105 TCATAAAAACTCAATAGGCAAGG + Intergenic
1029125016 7:98289604-98289626 ACAGAAAAACACAACAGGGTGGG - Intronic
1032840529 7:135710153-135710175 AAATAAAAATTCAACAGGAAAGG + Intronic
1033081862 7:138306247-138306269 TCATAAAAACTCAAAAGGGCAGG - Intergenic
1033344590 7:140517475-140517497 TCACAGAAACACAAAAGGGAGGG - Intergenic
1033865547 7:145686931-145686953 ACATAGGAACTCAAAAGGCTGGG - Intergenic
1034677185 7:152900409-152900431 ACACAGACACCCAGCAGGGAGGG - Intergenic
1035411243 7:158644362-158644384 ACATAAAAGCTCAAAAGTGAGGG - Exonic
1038712289 8:29958727-29958749 ATCTGAAAACTCAACAGGGAAGG - Intergenic
1041191115 8:55355238-55355260 ACATGAAAACTCAACTGGAAGGG + Intronic
1043005068 8:74808692-74808714 AAATAGAATTTCAACAGAGAGGG - Intronic
1044304986 8:90628642-90628664 ACATAGAAAAATAACAGGCATGG + Intronic
1045063228 8:98425951-98425973 ACAGAGAAACACCAAAGGGAGGG + Intronic
1046109827 8:109709260-109709282 AAATAAAAACTCACCAGTGAGGG - Intergenic
1047137298 8:122094264-122094286 ACATGGAAACTAAACAGCCAGGG - Intergenic
1047317094 8:123744880-123744902 ACATGGAAGCTCTAAAGGGAAGG - Intergenic
1048038161 8:130697401-130697423 ACATAAAAAGTCAACACAGAGGG - Intergenic
1049635041 8:143683586-143683608 ACATTGAAGCACCACAGGGAGGG - Intergenic
1049768266 8:144365825-144365847 ACATTGAAGCACCACAGGGAGGG - Intergenic
1049837627 8:144748481-144748503 ACATAAAAACACAAAAGGGATGG - Intronic
1050138495 9:2493455-2493477 AGAGAGAAACACAAAAGGGAGGG + Intergenic
1053106658 9:35415467-35415489 ACATAGTATCTCTGCAGGGAAGG + Intergenic
1053108540 9:35436350-35436372 AAATGGAAAATCAACAGTGAAGG + Intergenic
1054908575 9:70432402-70432424 ACATACAAACCCAACAGGCCGGG - Intergenic
1055412696 9:76048044-76048066 AGAAAGAAAATCAACAAGGACGG - Intronic
1055632815 9:78240805-78240827 ACAAAAAAACTCACCAGGCATGG + Intronic
1057435181 9:95033400-95033422 GTAGAGAAACACAACAGGGAGGG - Intronic
1062327261 9:136018226-136018248 ACAGAAAAACTCTACAGGGGTGG + Intronic
1185491144 X:517866-517888 AATTAGAAACTCAACAGGACCGG - Intergenic
1188571057 X:31585355-31585377 ACATATAAACTCCAGAGGGTGGG + Intronic
1188629068 X:32328590-32328612 ATATAGAAACTTAGCAGGAATGG + Intronic
1188635440 X:32424971-32424993 GCATAGAAAATCAAAAGCGAAGG - Intronic
1190377904 X:49807985-49808007 CCATAGAAACACAAAAGGGCAGG - Intergenic
1190625913 X:52338322-52338344 ATAAAGAAACTCAAAATGGAAGG + Intergenic
1193109292 X:77711536-77711558 ACATAAAAAGTCAACTGGGCTGG + Intronic
1194895529 X:99434977-99434999 ACATAGAAAGACAACAGGAGAGG + Intergenic
1196394121 X:115241225-115241247 AAAGACAAACTCAACAGGCACGG + Intergenic
1198676982 X:139141518-139141540 ACAGAGAAATTCAGCAGGGCTGG - Intronic
1200080274 X:153572782-153572804 ATATGGACACCCAACAGGGAGGG - Intronic