ID: 1121036358

View in Genome Browser
Species Human (GRCh38)
Location 14:90707240-90707262
Sequence TCTTAGGTGGGCATGGTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 609
Summary {0: 1, 1: 7, 2: 48, 3: 108, 4: 445}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121036358 Original CRISPR TCTTAGGTGGGCATGGTTTG TGG (reversed) Intronic
901095811 1:6678434-6678456 TCATAGATGGCCCTGGTTTGGGG + Exonic
901261117 1:7871783-7871805 TCTTATATGGGCACTGTTTGTGG - Intergenic
903636112 1:24817969-24817991 TCTTATATGGGTGTGGTTTGTGG + Intronic
903881121 1:26510190-26510212 TCTTATATGGGCACAGTTTGTGG - Intergenic
904211994 1:28891938-28891960 AATTAGCTGGGCATGGTTGGTGG + Intronic
904640285 1:31922078-31922100 TCTAAGGTGGCTATGTTTTGGGG - Intronic
905701718 1:40021338-40021360 AATTAGCTGGGCATGGTTGGGGG + Intergenic
906311664 1:44758725-44758747 AATTAGCTGGGCATGGTTAGGGG + Intronic
907002025 1:50870668-50870690 TGTCTTGTGGGCATGGTTTGTGG - Intronic
907633162 1:56105563-56105585 TCTTATATGGGTATGGTTTGTGG + Intergenic
908975429 1:69891378-69891400 TCTTATATGGGCATGGTTCATGG + Intronic
909735581 1:78957081-78957103 TCTTATATGGGCATGGTTCATGG - Intronic
909792515 1:79696522-79696544 TCTCTGGTGGGCAGGGTTGGGGG + Intergenic
909844041 1:80367981-80368003 TCTTATGTGGGCATGGCTTGTGG - Intergenic
910078458 1:83309255-83309277 TCTTATGTGAGCATGGTTTGTGG + Intergenic
910373953 1:86549145-86549167 TGTTAGGTGGGGCTGGATTGGGG + Intronic
910997033 1:93116940-93116962 TCTTAGGTGGGCACGGTTTTTGG + Intronic
911173509 1:94795466-94795488 TCTTAAATTGGCATGGTTTTAGG + Intergenic
911409115 1:97479467-97479489 TCTTATATGGGCATGGTTTGTGG + Intronic
912118150 1:106433420-106433442 TCATAGGAGGGCAGGATTTGGGG - Intergenic
913127034 1:115801150-115801172 TCTTATATGGGTATGGTTTATGG + Intergenic
913156685 1:116106638-116106660 AATTAGCTGGGCATGGTTGGGGG - Intergenic
913216937 1:116628558-116628580 TCTTGGTGGGGAATGGTTTGGGG - Intronic
915305614 1:154975748-154975770 TCTTCCCTGGGCTTGGTTTGGGG + Intronic
915994956 1:160552822-160552844 TCTTGGGTGGACATGGGATGTGG + Intronic
916926012 1:169521413-169521435 TCTTAGGTGGCAATGGAGTGGGG + Intronic
917192301 1:172430951-172430973 TCTTATATGGGTATAGTTTGTGG - Intronic
917353277 1:174100698-174100720 TCTTACATAGTCATGGTTTGTGG + Intergenic
917353686 1:174104582-174104604 TCTAAAGTGGGCATCTTTTGTGG - Intergenic
918606169 1:186428871-186428893 TCTTATATGGGCATGGTTCATGG + Intergenic
919093908 1:193006725-193006747 TCTTACATGGGCATGGTTCATGG + Intergenic
919113295 1:193247301-193247323 TCTTATATGGGTGTGGTTTGTGG - Intronic
919123419 1:193368827-193368849 TCTTATACTGGCATGGTTTGTGG + Intergenic
919204081 1:194397640-194397662 TGTTATCTGGACATGGTTTGTGG + Intergenic
921276209 1:213523240-213523262 TCTTACATGGGCACAGTTTGTGG + Intergenic
921576448 1:216840825-216840847 TCTTATATGGGTATGGTTTGTGG + Intronic
922177854 1:223211058-223211080 TCTTTGCTGGGGATGGTATGGGG + Intergenic
922429469 1:225535062-225535084 TTTTAGGTGTGCATGTTGTGAGG - Intronic
922624187 1:227021055-227021077 TCTTATATGGGCATGGTTTGTGG + Intronic
922903145 1:229153912-229153934 TCTTATATGGACATGGTTTGCGG + Intergenic
923704958 1:236336543-236336565 TCCTAGGTGAGGATGGCTTGAGG + Intergenic
924079183 1:240375143-240375165 TCTTATGTGGGCATAGTTTGTGG + Intronic
924689442 1:246331898-246331920 TCTTATATGGGGATGGTTTGTGG - Intronic
1063149525 10:3323573-3323595 TCCCAGGTGGGCATGGATTTGGG - Intergenic
1063374712 10:5547273-5547295 TCTTAGGTGGGCATTTCTGGGGG - Intergenic
1063788543 10:9412757-9412779 TCTTTTATGGGCATGGTTCGTGG - Intergenic
1064590251 10:16882863-16882885 TATTAGCTGGGCATGGTGTCTGG + Intronic
1064778456 10:18806520-18806542 TCTTAGGAGGCCATGGTTGCAGG + Intergenic
1064842030 10:19603842-19603864 TCTTATATGGGCATGGTTCATGG - Intronic
1065666656 10:28070444-28070466 TCTTAGGTAGACATGTTTTTAGG - Intronic
1066237935 10:33505133-33505155 TCTTAGATGGGCACAGTTTGTGG + Intergenic
1067360040 10:45571372-45571394 TCTTTGGTGGGCAGGGGTCGGGG - Intronic
1067484189 10:46631375-46631397 TCTGAGGTAGGAATGTTTTGAGG + Intergenic
1067548119 10:47211131-47211153 TCTTGTGTGGGCATGGTTCCTGG - Intergenic
1067610570 10:47710272-47710294 TCTGAGGTAGGAATGTTTTGAGG - Intergenic
1067719097 10:48713467-48713489 ACAAAGGTGGGCTTGGTTTGTGG + Intronic
1068248275 10:54402717-54402739 TGTAATGTGGGAATGGTTTGCGG - Intronic
1068928083 10:62560450-62560472 TCCTAGCTGGGAATGGTTTCAGG - Intronic
1071324375 10:84497538-84497560 TCTTAGGTGGTTATAGTGTGTGG + Intronic
1071625982 10:87170529-87170551 TCTGAGGTAGGAATGTTTTGAGG - Exonic
1072474023 10:95741356-95741378 TCTTATATGGGCATGGTTCATGG + Intronic
1073781054 10:106838926-106838948 TCTTACATGGGCATGGTTCAGGG - Intronic
1074880286 10:117651427-117651449 TGTTAAGTGGGCTTGGTCTGAGG - Intergenic
1076856891 10:133121085-133121107 TCTTATACGGGCGTGGTTTGTGG + Intronic
1078193672 11:9115968-9115990 GCTTACATAGGCATGGTTTGTGG + Intronic
1078243260 11:9549978-9550000 TCTTGTATGGGCACGGTTTGTGG - Intergenic
1079272452 11:19001004-19001026 TCTTTTATGGGCATAGTTTGTGG - Intergenic
1079643949 11:22840001-22840023 TCTTAAGTGGGTATGGTTCATGG + Intergenic
1080359133 11:31492819-31492841 TCTTACATGGGCACGGTTTCTGG + Intronic
1080842342 11:35996368-35996390 TCTTATATGGGTGTGGTTTGAGG + Intronic
1081261551 11:40967660-40967682 TCTTATATGGGCATGATTTGTGG - Intronic
1081266171 11:41024998-41025020 TCTTATAAGGGCTTGGTTTGTGG - Intronic
1082170899 11:49003942-49003964 TCTTAGCTGGGCATGGTGGTGGG - Intergenic
1085436516 11:76509019-76509041 TCTTACACGAGCATGGTTTGTGG + Intronic
1085500508 11:77018286-77018308 TCTTCTATGTGCATGGTTTGTGG - Intronic
1085683050 11:78596025-78596047 TTATACGTTGGCATGGTTTGGGG - Intergenic
1086104833 11:83136129-83136151 GGTTAGGTGGGCATGGTTAATGG - Intergenic
1086318601 11:85620216-85620238 TCTTATGTGGGTATGATTTGTGG - Intronic
1087144910 11:94801482-94801504 TCTTAGGTAGGGATGGTAAGTGG + Intronic
1087339858 11:96890244-96890266 TCTTACGTGGGAACAGTTTGTGG + Intergenic
1087421933 11:97940046-97940068 TCTTTTATGGGCATGATTTGTGG - Intergenic
1087452254 11:98339795-98339817 AATTAGCTGGGCATGGTTTTGGG + Intergenic
1087657816 11:100946677-100946699 TCTTATGTGGACATGGTTAATGG + Intronic
1087671201 11:101109046-101109068 TCTTACATGGGCAAGGTTTGTGG - Intronic
1087913961 11:103786474-103786496 TCTTACATGGGCATGGTTTATGG + Intergenic
1088389492 11:109298444-109298466 TCTTACATGGGCATGGTTGGTGG + Intergenic
1088439704 11:109856169-109856191 TCTTATGTGGGCATGATTCGTGG + Intergenic
1088662050 11:112057111-112057133 TCTTATATGGGCATGGTTCATGG - Intronic
1090147777 11:124345016-124345038 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1091427105 12:400665-400687 TCTTATATGGGCATGGTTCATGG + Intronic
1091865186 12:3828019-3828041 TGTTATATGGGCATGTTTTGGGG - Intronic
1092623648 12:10302012-10302034 TCTTATATGGGCATGGTTCCTGG + Intergenic
1093907386 12:24709271-24709293 TTTTTGGTGGGGATGGGTTGAGG - Intergenic
1094250416 12:28353683-28353705 TCTGATATGGGCATGGTTTGTGG + Intronic
1095523075 12:43091578-43091600 TCTTATATGAGCATAGTTTGTGG - Intergenic
1095611443 12:44133257-44133279 TCTTTGGTGGGCATCAGTTGAGG + Intronic
1095754601 12:45750303-45750325 TCTTATGTGGGTACAGTTTGGGG + Intronic
1098427399 12:70380289-70380311 CCTCATATGGGCATGGTTTGTGG + Intronic
1098699251 12:73603433-73603455 TCTAAGGTGAGCATGGATTCTGG - Intergenic
1098785665 12:74751091-74751113 TCTTATGTGGGTATAGTTTGTGG - Intergenic
1098800728 12:74953985-74954007 TCTTATATGGGCATGTTTTCTGG + Intergenic
1099937933 12:89150414-89150436 TCTTACGTGGGCATGGTTTGTGG - Intergenic
1100516446 12:95332860-95332882 TTTTATATGGGCTTGGTTTGTGG + Intergenic
1100695635 12:97089794-97089816 TCTAATGTGGGCACAGTTTGTGG + Intergenic
1101489198 12:105196294-105196316 CCTTCTTTGGGCATGGTTTGAGG - Intronic
1102504321 12:113374224-113374246 TCTTAAGTGGGGCTGATTTGGGG + Intronic
1102741623 12:115212470-115212492 TCTTGGCTGGGCATGCTGTGTGG - Intergenic
1102826295 12:115950340-115950362 TCTCAGGTAGGCATGGATTTGGG - Intergenic
1103549135 12:121723684-121723706 TCTGGGGTGGGCATGGGTTGAGG + Intronic
1104534068 12:129601742-129601764 TCTTACATGGGCATGGTTCATGG + Intronic
1104553524 12:129779436-129779458 TATTAGCTGGGCATGGTGGGTGG - Intronic
1105393001 13:19999452-19999474 TCTCATATGGGTATGGTTTGTGG - Intronic
1105983973 13:25547657-25547679 ACTTGGGTGGGGATGGTTTTGGG - Intronic
1106075640 13:26458682-26458704 TCTTAGATTGGCAAGCTTTGGGG + Intergenic
1106352847 13:28950693-28950715 TCTTATATGGGCATGGTTCATGG + Intronic
1106946646 13:34835213-34835235 TCTTATATGGGCATGGTTCATGG - Intergenic
1107275670 13:38676196-38676218 TCTTAGCTGGGCATGGTGGCAGG - Intergenic
1107402788 13:40085778-40085800 TCTTTGGTGGGAATGGATTTGGG - Intergenic
1107689617 13:42939615-42939637 TCATTTGTGGGCAGGGTTTGTGG + Intronic
1108015835 13:46074776-46074798 TCAGTGGTGGGGATGGTTTGGGG + Intronic
1108255480 13:48605763-48605785 TCTTTGGTTGTCATAGTTTGAGG + Intergenic
1108277981 13:48830916-48830938 TCATTTGCGGGCATGGTTTGTGG - Intergenic
1108393395 13:49970327-49970349 ACTTAGGTGGGCATGGTGGCAGG + Intergenic
1109131266 13:58589167-58589189 TCTTAAATGGGTATGGTTTATGG - Intergenic
1109350466 13:61174090-61174112 TCTTATGTGGGCACAGGTTGTGG - Intergenic
1109629947 13:65033039-65033061 TCTGAGGTGGGCAGGGGGTGGGG + Intergenic
1109735411 13:66478185-66478207 TCTAATATGGGCATGGCTTGTGG - Intronic
1109815633 13:67579551-67579573 TCTTATATAGACATGGTTTGTGG + Intergenic
1109853886 13:68103396-68103418 TCTTATATGGGTATGGATTGTGG + Intergenic
1109953251 13:69530410-69530432 TTTTATATGGTCATGGTTTGTGG - Intergenic
1110022023 13:70486875-70486897 TCTTACATTGCCATGGTTTGTGG + Intergenic
1110091216 13:71450387-71450409 TCTTATATGGGCATAGTTCGTGG - Intronic
1111324240 13:86670808-86670830 TCTTATATGGGCATGGTTCGTGG + Intergenic
1111936641 13:94564462-94564484 TCTTACATGGGCATGATATGCGG + Intergenic
1112728795 13:102335905-102335927 TCTTACATGGGCACAGTTTGGGG - Intronic
1113554956 13:111225710-111225732 TCTTACATGGGCATGGTTCATGG - Intronic
1113695023 13:112339153-112339175 TCTTATATGGGCACTGTTTGTGG - Intergenic
1114682480 14:24497781-24497803 ACTTAGCTGGGCATGGTGTCGGG - Intergenic
1114734261 14:25027401-25027423 TCATTTTTGGGCATGGTTTGTGG - Intronic
1115050960 14:29062296-29062318 TCTTAGGAGGGCTAGGTTTGAGG - Intergenic
1115249695 14:31332256-31332278 TTTTGCGTGGGCATAGTTTGTGG - Intronic
1115379156 14:32714168-32714190 TCTTATATGGGTGTGGTTTGTGG + Intronic
1117370324 14:55072670-55072692 TATTAGATGTGCATTGTTTGGGG - Intergenic
1117764498 14:59066894-59066916 TCTTATTTGGTCATGGTTGGTGG + Intergenic
1117887013 14:60374990-60375012 TCTTATATGGGCATGGTTCATGG - Intergenic
1118260603 14:64243259-64243281 GCTTATATGGGCATAGTTTGTGG + Intronic
1119463561 14:74833399-74833421 AATTAGCTGGGCATGGTGTGTGG - Intronic
1119883383 14:78119999-78120021 CCTTCTGTGGGCATGGTTGGTGG + Intergenic
1120264678 14:82233912-82233934 TTTTATATGGGCATGGTTTCTGG - Intergenic
1120318715 14:82931169-82931191 TCTTATTTGGGCATGGTTTCTGG + Intergenic
1120726924 14:87954172-87954194 TCTGAGGTAGGAATGTTTTGAGG - Intronic
1121036358 14:90707240-90707262 TCTTAGGTGGGCATGGTTTGTGG - Intronic
1121766604 14:96492850-96492872 TCTTATATGGGCATGGTTTGTGG + Intergenic
1121997993 14:98620319-98620341 TCTTATATGGACATGGTTTATGG - Intergenic
1122317211 14:100833124-100833146 CCTTAAGAGGGCATAGTTTGGGG + Intergenic
1124091420 15:26606176-26606198 TATTAGGTGGGGATGGTTAATGG + Intronic
1124461003 15:29891716-29891738 TCTTATATGGGCAGGGTTTGTGG - Intronic
1124629917 15:31330233-31330255 TCTGAGGTGTCCGTGGTTTGTGG + Intronic
1125810477 15:42536090-42536112 TCTTATATTGGCATGGTTTGTGG + Intronic
1126828224 15:52572196-52572218 TCTTATGTGGGAGTGGTTTGTGG - Intergenic
1129049166 15:72763926-72763948 TCTTATGTGGGAATGATCTGTGG - Intronic
1129126446 15:73445763-73445785 TCTTCTATGGGCATGGTTTGTGG + Intronic
1129326232 15:74801611-74801633 TCTTGGATGGGTAGGGTTTGAGG + Intronic
1129948813 15:79567318-79567340 TCTTAGATGGGCATGGCTTGTGG - Intergenic
1130290444 15:82594942-82594964 TCTTACATGGGAATGGTTTGTGG + Intronic
1130408158 15:83621493-83621515 TCTTATATAGGCATTGTTTGTGG + Intergenic
1131626022 15:94121858-94121880 TCTTCTATGGGCATGGCTTGTGG - Intergenic
1131878860 15:96841000-96841022 TCTTATATGGGCATGGCTTATGG - Intergenic
1132032414 15:98449623-98449645 ACTTACACGGGCATGGTTTGTGG + Intronic
1132475414 16:133974-133996 TCTTATGTGGACATGGTTCTTGG + Intronic
1132781694 16:1630026-1630048 TCTGAGGTGGACAGGGTTGGGGG + Intronic
1134272994 16:12750528-12750550 CCTTAAATGGACATGGTTTGTGG + Intronic
1136025586 16:27466388-27466410 TCTTATGTGGGCATGGTTTGTGG - Intronic
1136501538 16:30672466-30672488 TCTTACATGGGCACTGTTTGTGG + Intergenic
1137740374 16:50765350-50765372 TCTTATATGGGTGTGGTTTGTGG - Intronic
1138415772 16:56870552-56870574 TCCTAGGTGGGCAGAGTCTGGGG + Intronic
1139014005 16:62668027-62668049 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1139125900 16:64077031-64077053 TCTTATATGGGCACAGTTTGTGG - Intergenic
1141148339 16:81547487-81547509 TCAGAGGAGGGCCTGGTTTGCGG + Intronic
1141292323 16:82730490-82730512 TCTTGTATGGGCATGGTTTGTGG + Intronic
1141304465 16:82848598-82848620 TCTTATATGGGCACAGTTTGTGG - Intronic
1142138062 16:88460638-88460660 TCTAAGGTGGGCATTGGCTGAGG - Intronic
1142439685 16:90088418-90088440 ACTTAGCTGGGCATGGTGTTAGG + Intronic
1142539685 17:648399-648421 ACTTAGCTGGGCATGGGTGGTGG + Intronic
1142922732 17:3205213-3205235 TCTTATATGGGCATGATTTGTGG - Intergenic
1143073794 17:4321729-4321751 ACTTGGGTGGGCAGGGTTGGGGG - Intronic
1144265661 17:13566296-13566318 TCTTCTATGGGCGTGGTTTGAGG - Intronic
1144616954 17:16785156-16785178 TCTTACGTGAACATAGTTTGAGG + Intronic
1144884970 17:18451593-18451615 ACTGAGGTGAGCATGGTTGGTGG - Intergenic
1144895738 17:18530518-18530540 TCTTATGTGAACATAGTTTGAGG - Intergenic
1145136479 17:20413714-20413736 TCTTATGTGAGCATAGTTTGAGG + Intergenic
1145147251 17:20492784-20492806 ACTGAGGTGAGCATGGTTGGTGG + Intergenic
1145726862 17:27137169-27137191 TGTGATGTGGGAATGGTTTGTGG - Intergenic
1147766565 17:42840456-42840478 AATTAGCTGGGCATGGTTGGCGG + Intronic
1148696215 17:49560600-49560622 TCTTATATGGGCATGGTTTGTGG - Intergenic
1149380670 17:56090416-56090438 CTTTAGGTGATCATGGTTTGGGG - Intergenic
1149621651 17:58049885-58049907 TTTTAGGTGGGCCTCCTTTGAGG - Intergenic
1150947972 17:69767772-69767794 TCTTAGAGGGGCACAGTTTGTGG - Intergenic
1151027414 17:70694865-70694887 TCTTACATGGGTAGGGTTTGTGG - Intergenic
1151076762 17:71282296-71282318 TGTTAGGTGGGAATGGTTTTTGG - Intergenic
1151849252 17:76680531-76680553 TCTAAGGTGTGCAGGGTGTGTGG + Intronic
1152957882 18:55247-55269 ACTTAGCTGGGCATGGTGTCAGG - Intronic
1152978963 18:254778-254800 TCTTAGATGGGCACAGTTTGTGG - Intronic
1153683420 18:7522422-7522444 TAATAGCTGGGCATGGTTAGGGG + Intergenic
1153886636 18:9474018-9474040 CATTTGGAGGGCATGGTTTGTGG - Intergenic
1154341642 18:13507681-13507703 TCTTATATGGGTATGGTTTGTGG - Intronic
1154392157 18:13947241-13947263 TTGCAGGTGGGGATGGTTTGGGG - Intergenic
1155266176 18:24096021-24096043 TCTTATGTGGGCATGGTTTGTGG + Intronic
1155662989 18:28274212-28274234 AATTAGCTGGGCATGGTTGGGGG - Intergenic
1155741197 18:29290327-29290349 TCTTATATGGGCAAGGTTTCTGG - Intergenic
1155809958 18:30219821-30219843 TCTTATATGGGCACAGTTTGTGG + Intergenic
1156040364 18:32814053-32814075 TCTGAAGTGGGCTTGTTTTGGGG + Intergenic
1156110625 18:33722035-33722057 TCTTATGAGGGCATGGTTTGTGG - Intronic
1156489163 18:37486112-37486134 TATTAGGAGGGCCTGGCTTGGGG - Intronic
1156785631 18:40910497-40910519 TCTTATGTGGGCGTGGTTCATGG + Intergenic
1157727785 18:49978189-49978211 TCTTAGGGAGGCATGGATGGAGG - Intronic
1159332133 18:67009447-67009469 TCTTATATGGGTGTGGTTTGTGG + Intergenic
1159514503 18:69440200-69440222 TCTTATATGGGCATGGTTTATGG + Intronic
1159695119 18:71547317-71547339 TCTTACATGGGCGTGGTTTGTGG + Intergenic
1160117408 18:76093661-76093683 TCTTATATGGGCATGGTTTGTGG + Intergenic
1160166218 18:76514765-76514787 TCCTATATGGGCGTGGTTTGTGG + Intergenic
1160520304 18:79504470-79504492 TCTTAGATGGGCACAGTTCGTGG + Intronic
1160552051 18:79700024-79700046 TCTTATGTGGGTGTGGTTCGTGG - Intronic
1162434038 19:10646027-10646049 TTTTAGGTGGGCATGGTAACAGG - Intergenic
1162573275 19:11484558-11484580 AATTAGCTGGGCATGGTTGGTGG - Intronic
1162961890 19:14132969-14132991 AGTTAGCTGGGCATGGTTTCGGG + Intronic
1163135318 19:15306778-15306800 TCTTAGATGGACATGGTTTGTGG + Intronic
1163184596 19:15628860-15628882 TCTGAGGTGGGCATGGGCTGAGG + Intronic
1163510972 19:17734656-17734678 GCTTCGCTGGGCCTGGTTTGGGG + Intergenic
1164880679 19:31730271-31730293 TCCTGGGTGGGCATGGTATGGGG + Intergenic
1166392181 19:42414817-42414839 TCTTACGTGGACATGGTTGGTGG - Intronic
1167397590 19:49241389-49241411 TTTTATATGGGCATAGTTTGTGG + Intergenic
1168337441 19:55604643-55604665 TCTGAGGTGGGCGTGGTTCAGGG + Intergenic
925360084 2:3272603-3272625 TCTTACATGGGCATGGTTCGTGG + Intronic
925540082 2:4957337-4957359 GATTAGGTGGGTCTGGTTTGAGG - Intergenic
925871453 2:8275058-8275080 TCTTATATGGGCCTGGTTTGTGG + Intergenic
925954271 2:8946731-8946753 TCTTATGTGGGCACAGTTTGTGG - Intronic
926235988 2:11044363-11044385 TCTGAGGTGGGCCTGGTGAGAGG + Intergenic
926834842 2:17007067-17007089 TCTTATATAGGCATGGTTTCTGG - Intergenic
927543853 2:23935899-23935921 AATTAGCTGGGCATGGTTGGGGG + Intronic
927731323 2:25474913-25474935 TCTTATGTGGGCATGGTTTGTGG - Intronic
928171484 2:29007331-29007353 TCTTGGGAGGGGGTGGTTTGGGG - Intronic
928264021 2:29794742-29794764 CCTTATAGGGGCATGGTTTGTGG + Intronic
928769953 2:34694693-34694715 TCTCAGGCGGGCAGGGTTGGGGG - Intergenic
928792075 2:34969494-34969516 TCTTATATGGGCATGGTTTGTGG + Intergenic
929529771 2:42741738-42741760 TCTTATATGGGCATGGCTTGTGG + Intronic
929704070 2:44192362-44192384 AATTAGCCGGGCATGGTTTGTGG - Intronic
929975322 2:46628258-46628280 AATTAGCTGGGCATGGTTGGCGG - Intergenic
929996555 2:46829642-46829664 CCTTGGGTGGGCATGGGATGTGG - Intronic
930583135 2:53236572-53236594 TCATATGTGGGTGTGGTTTGTGG - Intergenic
930831332 2:55746724-55746746 TCTTACATGGGCATGATTTATGG - Intergenic
930949574 2:57123098-57123120 TCTCAGAAGGGCATGGTTCGTGG + Intergenic
930988921 2:57626942-57626964 ACTTAGGTGGGCAGGGGTAGAGG - Intergenic
933351861 2:81163182-81163204 GCTTTGGAGTGCATGGTTTGTGG + Intergenic
934058968 2:88276370-88276392 TCTCAAGTGGGCATGGTTCATGG - Intergenic
934121680 2:88846164-88846186 TCTGAGGTGGGGCTGGTTGGGGG + Intergenic
934869664 2:97851710-97851732 TCTTATGTGGGCATAATTTGTGG - Intronic
936079848 2:109424678-109424700 TCTTATGTGGGCATGGTCCATGG - Intronic
936409544 2:112244751-112244773 TCTTATGTGGGCATGGTTCATGG - Intronic
936726564 2:115324987-115325009 TCTTATGTGGTCATGGTTCATGG + Intronic
936920170 2:117680467-117680489 TCTTATATGGGTATGGTTGGAGG - Intergenic
937004245 2:118496773-118496795 TCTCAGGTGGGCATACTGTGGGG - Intergenic
937174027 2:119908491-119908513 TCTTATATGGGTGTGGTTTGTGG - Intronic
938174189 2:129109248-129109270 CCTTATATGGGCATGATTTGTGG + Intergenic
938423884 2:131167987-131168009 TCTTATATGGGTGTGGTTTGTGG - Intronic
938562556 2:132487157-132487179 TCTTATATGGGTATGGTTTGTGG + Intronic
938621305 2:133057099-133057121 TCTTATATGGGCACGATTTGTGG - Intronic
938987237 2:136589290-136589312 TCTCATATAGGCATGGTTTGTGG + Intergenic
939274311 2:139980471-139980493 TCATATGTGGGTGTGGTTTGAGG + Intergenic
939398216 2:141659589-141659611 TTTTGGGTGGGTCTGGTTTGGGG + Intronic
939722739 2:145675200-145675222 TCTTAAATGGGCACGGTTTGTGG + Intergenic
939867783 2:147493638-147493660 TCTTATGTGGGCACGGTTTGTGG - Intergenic
940103465 2:150070011-150070033 TGTGGGGTGGGCATGGTTTAGGG - Intergenic
940756653 2:157690574-157690596 CCTTAGATGGGCATGGTTCATGG + Intergenic
940806505 2:158193420-158193442 TCCTAGGAGGGTATGGCTTGTGG + Intronic
941016426 2:160362565-160362587 TCCTATATGGGAATGGTTTGTGG + Intronic
941077465 2:161022171-161022193 TCTTTTATGGGCATGGTGTGTGG - Intergenic
941104760 2:161340478-161340500 TCTAAGGTGTGCAGGGTGTGTGG + Intronic
941433877 2:165444329-165444351 TCTTCCATGGGCATGGTTTGTGG - Intergenic
941650195 2:168084168-168084190 TTTCAGGTGGGCATGGTGGGGGG + Intronic
942787374 2:179715043-179715065 ACTTGGATGTGCATGGTTTGGGG - Intronic
942876851 2:180810840-180810862 TCTTATATGGGCAAGGTTTGTGG - Intergenic
943695112 2:190918933-190918955 TCTTATATGGACATGGCTTGTGG + Intronic
944387103 2:199179613-199179635 TCTCTGGTGGGCAGGGTTGGGGG - Intergenic
944623034 2:201538629-201538651 TCTTAGATGGGTGTGGTTTGTGG - Intronic
946853209 2:223928044-223928066 TCTTATGTGGGCACAGTTTGTGG + Intronic
947020737 2:225672878-225672900 TCTTATATGGGCATGGTTCGTGG + Intergenic
947456295 2:230257084-230257106 TATGAGGTGGGCATGGGTTGGGG + Intronic
948107134 2:235423611-235423633 TCTTATATGGGCATGGTTCATGG - Intergenic
948686312 2:239671963-239671985 GCTCAGGGGGTCATGGTTTGTGG + Intergenic
948845300 2:240680213-240680235 TCTGCAGTGGGCATGGTTTGGGG - Intronic
948848560 2:240694666-240694688 TCTGCAGTGGGCATGGTTTCGGG + Intronic
1169322206 20:4642506-4642528 TCTTATGTGGGTATGGTTTGTGG - Intergenic
1172257763 20:33534814-33534836 TCTTATATGGGCACAGTTTGTGG + Intronic
1172775406 20:37403975-37403997 TCTAAGGAGGGCAGGGTTTGAGG - Exonic
1173077421 20:39832820-39832842 TCTTAGGTGGGCATGTTCCATGG + Intergenic
1173243207 20:41316744-41316766 ACTTAGGTGGGGAGTGTTTGAGG - Intronic
1173259068 20:41417145-41417167 TCAAAGCTGGGAATGGTTTGGGG + Intronic
1173707368 20:45121794-45121816 TCTTATGTGGGCACAGTTTATGG + Intergenic
1173942087 20:46920033-46920055 TCTTATATGGGCACAGTTTGTGG + Intronic
1174692545 20:52521973-52521995 CCTTATATGGACATGGTTTGTGG + Intergenic
1174991396 20:55514302-55514324 TCTTCTGTGAACATGGTTTGTGG + Intergenic
1175637074 20:60593730-60593752 AATTAGCTGGGCATGGTTTCAGG + Intergenic
1176086780 20:63299050-63299072 TCTTTGGTGGGCATTTTGTGAGG + Intronic
1176859243 21:13996889-13996911 ACTTAGCTGGGCATGGTGTCCGG - Intergenic
1177235595 21:18385890-18385912 AATTAGGTGGGCATGGTGTCGGG - Intronic
1177335717 21:19723465-19723487 GCTTATATGGGCATGGTTTGTGG + Intergenic
1177366316 21:20142808-20142830 TATTAGGTGGGCATGGTGGTGGG - Intergenic
1177654639 21:24002184-24002206 TCTTATATGGGCACAGTTTGTGG - Intergenic
1178070661 21:28962484-28962506 TCTTATATGGCAATGGTTTGTGG - Intronic
1178100546 21:29264129-29264151 TCTTATATGGGCGGGGTTTGTGG + Intronic
1178177095 21:30114989-30115011 TCTTATATGGGCATGGTTTGTGG + Intergenic
1179465875 21:41572290-41572312 CCTTATGTGGGCATGGTGTCAGG + Intergenic
1180878980 22:19190390-19190412 TCTTATAGGGGCATGGTTTGTGG + Intronic
1182904178 22:33921518-33921540 TCGGAGGTGGGCATGCTGTGGGG + Intronic
1183587664 22:38762436-38762458 ACTTGGGTGGGCATGGGGTGGGG - Intronic
1185084321 22:48730716-48730738 TCTTACACGGGCATGGTTTGTGG - Intronic
949626410 3:5871737-5871759 TCTTACATGGGCACGGTTTGTGG - Intergenic
949732056 3:7125086-7125108 ACTTAGGTGGGCATGGTGGTGGG - Intronic
949779625 3:7671269-7671291 TATTAGGATGGCATGGGTTGGGG + Intronic
949813554 3:8034188-8034210 CTTTATATGGGCATGGTTTGTGG + Intergenic
950112654 3:10429508-10429530 TCTGATATGGGCATGGTTTGTGG - Intronic
950118509 3:10466655-10466677 TCATCTGTTGGCATGGTTTGGGG - Intronic
950291138 3:11785472-11785494 ACTTAGCTGGGCATGGTAGGGGG - Intergenic
951422178 3:22499810-22499832 TCTTATATGGGCATGGTTTATGG - Intergenic
951741373 3:25928102-25928124 TTATATGTGGGCATGGTTTGTGG + Intergenic
952167917 3:30771380-30771402 TCTTAGGTTTTAATGGTTTGGGG + Intronic
952661465 3:35854697-35854719 TATTATGTGGGCATAGTTAGTGG + Intergenic
952806039 3:37353121-37353143 TCTTATATGGGCATGGTTTGTGG + Intronic
952938362 3:38419966-38419988 AATTAGCTGGGCATGGTTGGGGG - Intronic
953660573 3:44888597-44888619 CCTGAGGTGGGCATGGGTTGTGG + Intronic
954502973 3:51038243-51038265 TGGTAGGTGGGCAGGGTTTTAGG + Intronic
954654766 3:52187206-52187228 AATTAGCTGGGCATGGTGTGGGG + Intergenic
954772461 3:52984156-52984178 TCTGAAGTAGGAATGGTTTGAGG + Intronic
954871718 3:53772421-53772443 TCTTTTGTGGGTATGTTTTGGGG - Intronic
955290336 3:57686690-57686712 TCTTATATGGGCATGGTTTGTGG - Intronic
955426560 3:58796929-58796951 TCTTATATGGGCATGGTTCCTGG - Intronic
955678306 3:61472719-61472741 CCTTATATGGGCATGATTTGTGG + Intergenic
956063558 3:65373343-65373365 TCTTATGTGGGTATGGTTTGTGG + Intronic
956098223 3:65739783-65739805 TCTTATATGGGTATAGTTTGTGG + Intronic
957499733 3:81038954-81038976 TCTAAGATGGGTGTGGTTTGTGG + Intergenic
957782914 3:84842777-84842799 TCTTACATGGGTGTGGTTTGTGG - Intergenic
957863734 3:85994795-85994817 TCCTATATGAGCATGGTTTGTGG + Intronic
959039106 3:101400579-101400601 TCTTATGCATGCATGGTTTGTGG - Intronic
959238595 3:103757770-103757792 TCTTATGTGGGTGTTGTTTGTGG + Intergenic
959270796 3:104207445-104207467 TTTGGGGTGGGCATGGTTTGGGG - Intergenic
959923921 3:111900564-111900586 TCTTATATGGGCATGGTTTGTGG + Intronic
960154627 3:114286261-114286283 TCTTATATGGGCCTGGTTTGTGG + Intronic
960179853 3:114562867-114562889 TCTTATATGGGTGTGGTTTGTGG + Intronic
960844734 3:121995094-121995116 CCTTAGGTGGGGCTGGTCTGAGG + Intronic
961092142 3:124122654-124122676 TTTTATATGGGCATGGTTTGTGG - Intronic
961444144 3:126971170-126971192 TATAAGGTGGGGATGGTGTGGGG - Intergenic
962461396 3:135616842-135616864 TCTTATGTGGGCATGGTTCATGG + Intergenic
963195217 3:142520154-142520176 TCTTATATGGGCACAGTTTGTGG - Intronic
963608806 3:147439364-147439386 TCTTGTGTGGGCATGGTTTGTGG + Intronic
963773265 3:149411246-149411268 TCTTATATGGGCATGGTTTGTGG + Intergenic
963946524 3:151151675-151151697 TCTTATATGGGAATGGTTCGTGG + Intronic
963990559 3:151648622-151648644 CCTTAGGTGGGGAGGGTGTGAGG - Intergenic
964677186 3:159296624-159296646 ACTTAGCTGGGCATGGTGGGGGG + Intronic
964930176 3:162009934-162009956 TCTTATATGGACATGGTTTGTGG + Intergenic
965224176 3:165966599-165966621 TCTTATGTGAGCATGGTTTGTGG - Intergenic
965280896 3:166751190-166751212 TCGTAGGTGGGGATTGTTTCAGG + Intergenic
965437284 3:168667533-168667555 TTTTAGGTGGGAATGGGATGGGG + Intergenic
965918630 3:173883360-173883382 TCTTATATGGGTGTGGTTTGTGG + Intronic
966503024 3:180667564-180667586 TCTTAGAGAGGCACGGTTTGTGG - Intronic
966820677 3:183921879-183921901 AATTAGCTGGGCATGGTTGGCGG + Intronic
967008652 3:185409930-185409952 TGGTGGGTGGGAATGGTTTGAGG + Intronic
967034794 3:185640241-185640263 TGCCACGTGGGCATGGTTTGTGG - Intergenic
967491840 3:190101057-190101079 TCTTATATGGGCATGGTTTGTGG - Intronic
967710797 3:192705561-192705583 TCTTATGTGGGCATGGCTTGTGG + Intronic
968153586 3:196359252-196359274 TCTTGTGTGGGCGTGGTTTGTGG - Intronic
1202744053 3_GL000221v1_random:82023-82045 TCTTAGGTGGGTTCGGGTTGAGG - Intergenic
970578792 4:17454135-17454157 TCTTATATGGGCATGGTTAGTGG - Intergenic
970605391 4:17676327-17676349 TCTTCTACGGGCATGGTTTGTGG + Intronic
971295557 4:25386521-25386543 TTTTATATGGCCATGGTTTGTGG + Intronic
971679865 4:29683933-29683955 TATTATATGGGCATGGTTTTTGG - Intergenic
971709065 4:30088079-30088101 TCTCATATGGGCATGGTTTGTGG + Intergenic
971830828 4:31692530-31692552 TTTTATGTGGGCATAGTTTTTGG - Intergenic
971868554 4:32205636-32205658 TATTAATTGGGTATGGTTTGTGG - Intergenic
972383720 4:38543420-38543442 TCTTATATGAGCATGGTTGGTGG + Intergenic
974316227 4:60284711-60284733 TCTTATATGGGCACAGTTTGTGG - Intergenic
974423336 4:61707153-61707175 TCTTATATAGGCATGGTTCGTGG + Intronic
974997018 4:69174152-69174174 TCTTATATGGGCGTGGATTGTGG - Intronic
975008033 4:69314634-69314656 TCTTATATGGGCGTGGATTGTGG + Intronic
975065375 4:70056417-70056439 TCTCAGGTTTTCATGGTTTGGGG - Intronic
975567884 4:75779095-75779117 TCTTATATGGGCACTGTTTGTGG - Intronic
976513102 4:85933039-85933061 TCTTAAGTTGGCATGGTTTTAGG - Intronic
976885359 4:89976769-89976791 TCTTATATGGGCATGGTTAATGG + Intergenic
977072087 4:92403927-92403949 TCTTATGTGGGCATAGTTCATGG + Intronic
977356059 4:95948320-95948342 TCTTATATGGGCACAGTTTGTGG + Intergenic
977981271 4:103325314-103325336 TCTTATATGGGCATGGTTTGTGG + Intergenic
978181309 4:105799617-105799639 TCTTAAGTGGGCATGGTTCGTGG + Intronic
978249424 4:106612240-106612262 TCTTATATGGGAGTGGTTTGTGG + Intergenic
978528161 4:109687208-109687230 TATTAGGTGGGCATGGTGGTGGG + Intronic
979374358 4:119928060-119928082 TCTTATATGGGCATGGTTCATGG - Intergenic
979659088 4:123231906-123231928 TCTTATATGGGCATGGTTTGTGG + Intronic
979811560 4:125042608-125042630 TCTTACAAGGGCATGGTTCGTGG - Intergenic
980529465 4:134033225-134033247 TCTTATATGGGTGTGGTTTGTGG - Intergenic
980549720 4:134318853-134318875 TCTTATATGGGCATAGTTTGTGG + Intergenic
981200635 4:141975389-141975411 TCTTATATGGACATAGTTTGTGG - Intergenic
981493002 4:145361112-145361134 TCTTACATGGGTGTGGTTTGTGG - Intergenic
981640715 4:146940736-146940758 TCTTAGGTTGCCATGATGTGAGG - Intronic
981764578 4:148233763-148233785 TCTTACGTGGTCATGGTTTGTGG + Intronic
981984784 4:150840575-150840597 TCTTAAATGGGTGTGGTTTGTGG + Intronic
982036182 4:151348396-151348418 TCTTATGTGGGCATGGTTTGTGG - Intergenic
982169975 4:152652049-152652071 TCTTCTGTGAGCATGGTTTCAGG + Intronic
982344650 4:154344122-154344144 TCTTTCATGGCCATGGTTTGTGG + Intronic
982575694 4:157107093-157107115 TCTTATGTGGGCATGATTTGTGG - Intronic
983086710 4:163454016-163454038 TCTTATACGGGCATGGTTTGTGG + Intergenic
983300878 4:165923983-165924005 TCTTATATGGGCATGGTTCATGG - Intronic
984314702 4:178113013-178113035 TCTGAGCTGGGGATGGGTTGGGG + Intergenic
984685546 4:182664336-182664358 TCTTATGTGGGTGTGGTTTCTGG - Intronic
986682200 5:10244173-10244195 TCTTATTTGGGCATGGCTTGTGG + Intronic
986738636 5:10686129-10686151 TCTTATATGGGCACGGTTCGTGG - Intronic
987966324 5:24880584-24880606 TCTTATATGGGAGTGGTTTGTGG - Intergenic
988431600 5:31125460-31125482 TCTTATACGGGCATGGTTCGTGG - Intergenic
988669778 5:33368912-33368934 TTTTATAGGGGCATGGTTTGTGG + Intergenic
988889109 5:35595267-35595289 TCTTATATGGGTGTGGTTTGCGG + Intergenic
989397741 5:40976450-40976472 TCTTAGGTGGGCATGTGTTAGGG + Intronic
989762047 5:45027569-45027591 TCTTACGTGGGCATGCTTCATGG - Intergenic
990832646 5:59976903-59976925 TCTTACATGGGCATGGTTTGTGG - Intronic
990874583 5:60469742-60469764 TCCTATATGGGCATGGTTTGTGG - Intronic
991394132 5:66185660-66185682 TCTTATATGGGCACGGTTTGTGG - Intergenic
991978073 5:72202636-72202658 ACTTAAGTGGGCTTGGGTTGGGG - Intronic
992262206 5:74982600-74982622 TATTAGCTGGGCATGGTTGCAGG - Intergenic
992362956 5:76061048-76061070 TCTTATATGGGCATAGTTTGTGG + Intergenic
992794054 5:80239653-80239675 TGGAAGGTGGGCATGGTCTGTGG - Intronic
992918353 5:81483099-81483121 TCTTGTATGGGCACGGTTTGTGG + Intronic
993082121 5:83314742-83314764 TATTTTATGGGCATGGTTTGTGG - Intronic
993124338 5:83814090-83814112 TCTTATATGGGCACTGTTTGTGG + Intergenic
993270230 5:85787026-85787048 ACTTATTTGGGCATTGTTTGAGG - Intergenic
993400469 5:87443578-87443600 TCTTCTGTGGGTGTGGTTTGTGG + Intergenic
994174538 5:96697010-96697032 AATTAGCTGGGCATGGTGTGTGG + Intronic
994255809 5:97594707-97594729 TCTTGTATGGTCATGGTTTGTGG + Intergenic
994466992 5:100148812-100148834 TCTTATGTGGGCATGGTTTGTGG + Intergenic
994987994 5:106962480-106962502 TCTTAAGTGGGCCTGCTATGGGG + Intergenic
995426157 5:112025795-112025817 TCTTATATGGGCATGGTTTGTGG - Intergenic
995431234 5:112080228-112080250 TCTTATATGGGCATGGTTCATGG - Intergenic
995505817 5:112859890-112859912 TCTTATCTGGGCATGGTTCATGG + Intronic
996512521 5:124332880-124332902 TCTTATATGGGCATGGTTTGTGG + Intergenic
996574526 5:124966865-124966887 TCTCTGGTGGGCAGGGGTTGGGG + Intergenic
996586612 5:125095380-125095402 TCTTATATGGGTGTGGTTTGTGG - Intergenic
996673159 5:126143287-126143309 TCTTATATGGGTATGGTTTGTGG - Intergenic
997162904 5:131627933-131627955 TCTTACATGGGCACAGTTTGTGG - Intronic
997274305 5:132571088-132571110 TCTTATATGTGGATGGTTTGTGG + Intronic
997675376 5:135708723-135708745 CCTGAGCTGGGCCTGGTTTGGGG + Intergenic
998863646 5:146472493-146472515 TCTTACATGGGTGTGGTTTGTGG - Intronic
1000129264 5:158279661-158279683 TCTTCTATGGGCATGGTTTGTGG - Intergenic
1000578183 5:163002423-163002445 TCATAGATGGGCATTCTTTGAGG - Intergenic
1000821259 5:165987190-165987212 TCTTATATGGGCATGCTTTGTGG - Intergenic
1001091338 5:168743448-168743470 TCTTTGATGGGCATGGTTCGTGG - Intronic
1002813092 6:653052-653074 TCTCATATGAGCATGGTTTGTGG - Intronic
1003204075 6:3991166-3991188 TCTGAGGCAGGCATGCTTTGGGG + Intergenic
1003598781 6:7499446-7499468 TCTTATATGGGCGTGGCTTGTGG + Intergenic
1003662776 6:8078380-8078402 TCTTATATGGGCATGGCTTGTGG + Intronic
1003822875 6:9919683-9919705 CCTTATATGGGCATGGTTTATGG - Intronic
1004654279 6:17643471-17643493 TTTTTGGTGGGGATGGTTGGGGG - Intronic
1004978605 6:20996580-20996602 TCTTATATGGGCGCGGTTTGTGG + Intronic
1005560042 6:27030519-27030541 CATTAGCTGGGCATGGTGTGGGG - Intergenic
1005689879 6:28293716-28293738 TTTTAAACGGGCATGGTTTGTGG - Intronic
1008152267 6:47968288-47968310 TCTTACATGGGTGTGGTTTGTGG + Intronic
1009590015 6:65656080-65656102 TCTTATATGGGCATGGTTTGTGG - Intronic
1010608478 6:77921837-77921859 TCTGATATGGGCATGGTTTGTGG + Intronic
1010693143 6:78934182-78934204 TCTTATATGGGTGTGGTTTGTGG + Intronic
1012918432 6:105196166-105196188 TCTTATGTGGGTGTGGCTTGTGG - Intergenic
1012983317 6:105852256-105852278 TCTTATATGGGCACAGTTTGTGG + Intergenic
1013414684 6:109914035-109914057 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1013454061 6:110314092-110314114 TCCTAGGTGGTCAGGGTTAGGGG - Intronic
1013729760 6:113151265-113151287 TCTTATATGGGCATGACTTGTGG + Intergenic
1013739795 6:113268897-113268919 TCTTATATGGGCATGGTTTGTGG - Intergenic
1013943575 6:115695258-115695280 TTTTATATGGGCATGGTTTGTGG - Intergenic
1014076404 6:117240445-117240467 TCTTATATAGGCATGGTTTGTGG - Intergenic
1014528296 6:122527619-122527641 TTTTATATGGGAATGGTTTGTGG + Intronic
1015337014 6:132050954-132050976 TGTTTTGTGGGCATGGTTTGTGG - Intergenic
1015433407 6:133156432-133156454 TCTTACATGGGCACAGTTTGTGG + Intergenic
1015939723 6:138435946-138435968 TCTTATGTGGGTGTGATTTGTGG - Intronic
1016081599 6:139863928-139863950 TCTTATATGGGCACAGTTTGTGG - Intergenic
1016616948 6:146061141-146061163 TCTTATATGGGCATGGTTCATGG + Intronic
1016794053 6:148098906-148098928 TCTTATATGGGCATGGTTTGTGG - Intergenic
1016847995 6:148587968-148587990 TCTTATCTGAGCATGGTTGGTGG - Intergenic
1016903262 6:149123107-149123129 TCTTATCAGGGCATGGTTTATGG - Intergenic
1016946161 6:149536140-149536162 TCTTATATGGGCACAGTTTGTGG - Intronic
1017049236 6:150374948-150374970 TCTGAAGTTGGCATGCTTTGGGG + Intronic
1017314359 6:153013296-153013318 TCTTATATGGGCATGGTTCATGG - Intronic
1017816457 6:158019697-158019719 TCACAGGTGGGCAGGGGTTGGGG - Intronic
1018036802 6:159888806-159888828 TCAGAGGTGGGCAGAGTTTGAGG - Intergenic
1018250592 6:161866163-161866185 TCTTATTTGGGCATGGTTTTTGG + Intronic
1019278689 7:189104-189126 TGTGAGGTGGGCATTGTGTGAGG - Intergenic
1020409229 7:7872451-7872473 TCTTACATGGGCATGGTTCGTGG + Intronic
1020549014 7:9574325-9574347 TCTTAGATAAGCATGATTTGTGG + Intergenic
1022186804 7:27977387-27977409 TCTTATGTGGGTTTGGTTTTAGG + Intronic
1022951366 7:35341348-35341370 TCTTATATGGGCACAGTTTGTGG - Intergenic
1023169620 7:37378016-37378038 TCTTAGGGTTGCATGGTCTGAGG - Intronic
1023635374 7:42204230-42204252 TGTTGGATAGGCATGGTTTGGGG - Intronic
1024133292 7:46379394-46379416 TCTTATGTGGGCATGGCTTGTGG - Intergenic
1024336713 7:48215350-48215372 TCTTATATGGGCATGGTTTGTGG + Intronic
1024920507 7:54549247-54549269 TCATAGGGTGGCATGGCTTGGGG - Intronic
1026092686 7:67314675-67314697 TCTTATATGGGCATGGTTCGTGG + Intergenic
1026206760 7:68264282-68264304 TGTTAGGTGTGCATTGTTGGTGG + Intergenic
1027296240 7:76774523-76774545 TCTTATGTGAGCATGGTTTGTGG + Intergenic
1027518756 7:79176632-79176654 TCTAAGGTGAGCTTGGTTTTAGG - Intronic
1027596045 7:80175744-80175766 TCTTATGTGGGCAGAGTTTATGG - Intronic
1028578230 7:92377348-92377370 TCTTATATGGGCATGGTTCATGG + Intronic
1028870519 7:95766610-95766632 TCTTTTGTGGGCATGGTTCATGG - Intergenic
1029378124 7:100194452-100194474 TCTTATATGGGCACGGTTTGTGG + Intronic
1029969799 7:104777998-104778020 GCTTAGGTGAGCACTGTTTGGGG - Intronic
1030479130 7:110080250-110080272 TTTTATATGGGCACGGTTTGTGG + Intergenic
1030483686 7:110138346-110138368 TCTTAAGTGTGCATGGTTCATGG - Intergenic
1030698305 7:112610576-112610598 TCTTATGTGGGCATGGTTCATGG - Intergenic
1030992958 7:116323461-116323483 TCTTATATGGGCATGGTTAGTGG - Intronic
1031654876 7:124342347-124342369 TCTTATATGGGCATGGTTCCTGG + Intergenic
1033107574 7:138542430-138542452 TCTTACATGGGTGTGGTTTGTGG + Intronic
1034611679 7:152376135-152376157 TCTTATGTGGGCGTGGTTCATGG - Intronic
1035167124 7:156998165-156998187 TCTTATATGGGCAAGGTTTGTGG + Intronic
1035548596 8:502687-502709 GCTGAGGTGGGCATGGGTTCCGG - Intronic
1035796117 8:2358481-2358503 TCCTAGATGGTCAGGGTTTGGGG + Intergenic
1037191741 8:16134446-16134468 TCTTTTACGGGCATGGTTTGTGG - Intronic
1038526891 8:28282462-28282484 TCTTCCATGGGCACGGTTTGTGG - Intergenic
1038630538 8:29239140-29239162 TATTACGTGTGTATGGTTTGGGG - Intronic
1039076803 8:33697854-33697876 TCTTCAGCGGACATGGTTTGTGG + Intergenic
1039306733 8:36271221-36271243 TCTGAGCTGGGCATGTTGTGGGG - Intergenic
1039903563 8:41769696-41769718 TCTTATGTGGCCATGGTTTCAGG - Intronic
1040774128 8:51018470-51018492 TCTTATATGGGCGTGGTGTGTGG + Intergenic
1041100153 8:54388336-54388358 TCTTATGTGGGTGTGGCTTGTGG + Intergenic
1041372570 8:57178169-57178191 TCTCAGGTGGGCACGGTTTGCGG + Intergenic
1042409843 8:68451653-68451675 TCTTACATGGGTGTGGTTTGTGG + Intronic
1042686755 8:71450480-71450502 TCTTATATGGGCATGGTTTGTGG + Intronic
1042882423 8:73508438-73508460 TCTTATATGGGCATGATTTGTGG + Intronic
1043098999 8:76016115-76016137 TCTTATATGGGAATAGTTTGTGG - Intergenic
1043862719 8:85339380-85339402 TCTTACTTGGACATGGTTTATGG - Intronic
1043990891 8:86752662-86752684 TCTTATATGGGCATAGTTTGTGG + Intergenic
1044030897 8:87235590-87235612 TCTTATATGTGCATAGTTTGCGG + Intronic
1044114304 8:88315564-88315586 TCTTAAATGGGCAGAGTTTGTGG - Intronic
1044289506 8:90451265-90451287 TCTTACGTGAGCATGGTTTTTGG + Intergenic
1044461189 8:92446356-92446378 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1044807729 8:96025396-96025418 TCTTATATGGGTAGGGTTTGTGG - Intergenic
1044946873 8:97397517-97397539 TCTTGGGTGGGAATGGAGTGGGG - Intergenic
1045067906 8:98468313-98468335 TTTTAGAATGGCATGGTTTGTGG + Intronic
1045355141 8:101380339-101380361 AATTAGGTGGGCATGGTGTAGGG - Intergenic
1045399813 8:101802222-101802244 TATTTTATGGGCATGGTTTGTGG - Intronic
1045417772 8:101984095-101984117 CCTTAGGTGCTCATGGTTTGTGG - Intronic
1045507194 8:102787252-102787274 TATTAGCTGGGCATCGTTGGGGG - Intergenic
1047106512 8:121736791-121736813 TCTTCTATGGGCATAGTTTGTGG + Intergenic
1048902460 8:139051866-139051888 TCTTATGTGAACATGGTTTGTGG - Intergenic
1050565105 9:6874025-6874047 TCTTATGTGGGCATGGTTTGTGG + Intronic
1051085039 9:13338517-13338539 TCTTACATGGGCATGGTTCATGG + Intergenic
1051234636 9:14986384-14986406 TGTAAGGATGGCATGGTTTGAGG - Intergenic
1051251286 9:15161464-15161486 AATTAGCTGGGCATGGTTTCAGG - Intergenic
1051253681 9:15189545-15189567 TATTAGGTGGGAATTATTTGGGG - Intronic
1051305466 9:15703866-15703888 TCTTCTATGGGCATGGTTTGTGG + Intronic
1051721608 9:20042886-20042908 TCTTACATGGGCATGGCTTGTGG - Intergenic
1053208709 9:36209589-36209611 TCTTATCTGGGAACGGTTTGAGG + Intronic
1053296470 9:36917950-36917972 TCTTATATGGGCACAGTTTGTGG - Intronic
1054994493 9:71370039-71370061 TGTTATGTGGGTATGGTTTGTGG - Intronic
1055438684 9:76317958-76317980 TTTTGGGTTGGGATGGTTTGTGG + Intronic
1055781388 9:79825085-79825107 TTTGAGCTGGGCATGGTTTGGGG - Intergenic
1055873983 9:80920614-80920636 TCTTACATGGGTATGGTTTGCGG + Intergenic
1055978817 9:81980528-81980550 TCTTAGGTGGTGTTGGTTTTAGG + Intergenic
1056227201 9:84507315-84507337 TCTTATATGTGCATGGCTTGTGG - Intergenic
1057000716 9:91506337-91506359 TATTAGCTGAGCATGCTTTGAGG - Intergenic
1057437652 9:95057146-95057168 TCTTAGGTGGTGATGCTTGGAGG + Intronic
1057823714 9:98355157-98355179 TCTTATCTGGGCATGGTTTGTGG + Intronic
1059158097 9:112007613-112007635 TCTTATATGGGCATGGTTTGTGG - Intergenic
1059264747 9:113016623-113016645 TCTTATATGTGCATGGTCTGTGG - Intergenic
1059290102 9:113215449-113215471 TTTTATGTGAGCGTGGTTTGTGG + Intronic
1059742962 9:117171017-117171039 TCTCAGGATGGCATGGTTGGTGG - Intronic
1059909197 9:119023588-119023610 TATTAGCTGGGCATGGTTGTGGG - Intergenic
1060460424 9:123848427-123848449 TCTTATATGGGCATGGTTTATGG - Intronic
1061155837 9:128860887-128860909 TCTTATATGGGCATGGTTTGTGG + Intronic
1061710451 9:132483727-132483749 GCTGAGGTGGGCATGGGGTGGGG - Intronic
1061762337 9:132859383-132859405 TATTAGCTGGGCATGGTGGGGGG - Intronic
1185503787 X:618011-618033 TCTTTGGGGGACATGTTTTGGGG - Intergenic
1186367447 X:8910393-8910415 TCCTAGGTGGGCATTGTTCAGGG - Intergenic
1186453759 X:9694444-9694466 ACTTAGCTGGGCATGGTGTCGGG + Intronic
1186953321 X:14652645-14652667 TCTTATATGGGCATGGTTCCTGG - Intronic
1186969877 X:14830173-14830195 TCTTATATGGGTGTGGTTTGTGG + Intergenic
1187800397 X:23055959-23055981 TCTTATATGGGCATGGTTCATGG - Intergenic
1188221912 X:27551028-27551050 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1188291452 X:28393695-28393717 TCTTGTATGTGCATGGTTTGTGG + Intergenic
1188329900 X:28856676-28856698 TCCTATGTGGGCATGGTTTGTGG - Intronic
1188469131 X:30517619-30517641 TCTTATATGGTCATAGTTTGTGG - Intergenic
1189060166 X:37745207-37745229 TCTTATATGGGTGTGGTTTGTGG + Intronic
1189930869 X:46008395-46008417 TCTTATATGGGCATTGTTTGTGG + Intergenic
1190460827 X:50672133-50672155 TCTTATATGGGCACAGTTTGTGG + Intronic
1191803813 X:65111748-65111770 TCTTATATGGGCATGGTTTGTGG - Intergenic
1191957784 X:66664951-66664973 TGTCATATGGGCATGGTTTGTGG + Intergenic
1192328684 X:70156076-70156098 TCTTCTGTGGGCATGGTTTGTGG + Intronic
1193569038 X:83118807-83118829 TCTTGTATGGGCATGGTTCGTGG + Intergenic
1193833359 X:86314009-86314031 TTTTACATGGGCATGGTTTGTGG - Intronic
1193850018 X:86525782-86525804 TCTCATTTGGGGATGGTTTGAGG - Intronic
1194100510 X:89697422-89697444 TTTTACATGGGTATGGTTTGTGG + Intergenic
1194326333 X:92522387-92522409 TCTTATCTAGGCCTGGTTTGTGG + Intronic
1194940208 X:100000104-100000126 TCTTAAAAAGGCATGGTTTGTGG - Intergenic
1195231184 X:102849921-102849943 TCTTAGATGGGTGTAGTTTGTGG + Intergenic
1195534686 X:105997892-105997914 AATTAGCTGGGCGTGGTTTGGGG + Intergenic
1195628394 X:107028474-107028496 TCTTATATGGGCATAGTTTGTGG + Intergenic
1195818955 X:108921688-108921710 TCTTATATGGGTATGGTTTGTGG - Intergenic
1195987931 X:110651438-110651460 TCTTATATGGGCATGGTTTGTGG + Intergenic
1196564041 X:117183726-117183748 TCTTACATAGGCATGGTTGGTGG - Intergenic
1197473708 X:126894291-126894313 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1197561591 X:128029226-128029248 TCTTTTATGGGCATGGTTTGTGG + Intergenic
1198255746 X:134922936-134922958 AATTAGCTGGGCATGGTTGGTGG - Intergenic
1198323152 X:135539879-135539901 TCTTATGTGGGTATGGTTCATGG + Intronic
1199090659 X:143688139-143688161 TCTTATATGGCCATGGTTTGTGG + Intergenic
1199103011 X:143827911-143827933 TTTTATATGGGCATAGTTTGTGG - Intergenic
1199359239 X:146898342-146898364 TCTTACATAGGCGTGGTTTGTGG - Intergenic
1199807313 X:151313118-151313140 TCTTAGCTGGGCATGGTGGCGGG + Intergenic
1200453462 Y:3358483-3358505 TTTTACATGGGTATGGTTTGTGG + Intergenic
1200635054 Y:5641589-5641611 TCTTATCTGGGCCTGGTTTGTGG + Intronic