ID: 1121037507

View in Genome Browser
Species Human (GRCh38)
Location 14:90718539-90718561
Sequence GAGATACACTACGACCACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 34}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121037507_1121037510 6 Left 1121037507 14:90718539-90718561 CCTAGGTGGTCGTAGTGTATCTC 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1121037510 14:90718568-90718590 TACCACAAAGAAACAAGAATAGG 0: 1
1: 0
2: 3
3: 38
4: 460
1121037507_1121037512 29 Left 1121037507 14:90718539-90718561 CCTAGGTGGTCGTAGTGTATCTC 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1121037512 14:90718591-90718613 AGCCGTAAGTTCCATGAAGCCGG 0: 1
1: 0
2: 0
3: 8
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121037507 Original CRISPR GAGATACACTACGACCACCT AGG (reversed) Intronic
921488131 1:215740324-215740346 GAGATACACTATGAACATTTTGG - Intronic
1063293254 10:4773614-4773636 GAAATACACTACAACCAAGTGGG + Intergenic
1085917310 11:80904634-80904656 GAGAAACACAAAGAACACCTGGG + Intergenic
1092002674 12:5044742-5044764 GAGATACGCTTCTACCAGCTGGG + Exonic
1099263270 12:80411081-80411103 GAGTTACAATAAGACCATCTGGG - Intronic
1114080180 14:19196996-19197018 AAGATGCACTGTGACCACCTTGG - Intergenic
1114387474 14:22269942-22269964 AAGCTGCACTGCGACCACCTTGG - Intergenic
1121037507 14:90718539-90718561 GAGATACACTACGACCACCTAGG - Intronic
1124033139 15:26029537-26029559 AAGCTGCACTCCGACCACCTTGG - Intergenic
1126662378 15:51045651-51045673 AAGATGCACCCCGACCACCTTGG + Intergenic
1139382554 16:66542770-66542792 GCTATACGCTAGGACCACCTGGG + Intronic
1139893796 16:70271865-70271887 GAGATCCACTACGACCGGATTGG - Exonic
1144637843 17:16922110-16922132 AAGCTGCACCACGACCACCTTGG + Intergenic
1145955007 17:28848570-28848592 GAGACACACTTTCACCACCTTGG - Intronic
1168027424 19:53652761-53652783 CAGAGTCACTAGGACCACCTGGG + Intergenic
928733533 2:34260351-34260373 GAGATAAACTACCACTACCCAGG - Intergenic
936984681 2:118297609-118297631 CAGATACCCTACCAACACCTTGG + Intergenic
937431609 2:121843422-121843444 GAGACCCAATAAGACCACCTAGG - Intergenic
937833396 2:126446851-126446873 GGGAGACACTACTTCCACCTGGG + Intergenic
943486342 2:188488696-188488718 GAGACTCAATACGGCCACCTTGG + Intronic
1168877414 20:1181110-1181132 GAGATGTACTACGCCCGCCTAGG - Exonic
1180500593 22:15925688-15925710 AAGATGCACTGTGACCACCTTGG + Intergenic
955251821 3:57290419-57290441 GTGTTACACTGGGACCACCTGGG + Intronic
1002574362 5:180163618-180163640 GAGATATACCACGACCAAGTGGG - Intronic
1003807563 6:9742695-9742717 GTGATCCACTACGATCAACTAGG - Intronic
1017987460 6:159456153-159456175 GAGCTTCACCACCACCACCTGGG + Intergenic
1019063004 6:169270512-169270534 AAGATGCACACCGACCACCTTGG + Intergenic
1024925730 7:54612552-54612574 GTAATACACTATGACCAACTAGG - Intergenic
1037016369 8:13912709-13912731 GAAATACACTATGACTATCTGGG + Intergenic
1041326356 8:56670319-56670341 GAACTACACTACCACCACCCAGG - Intergenic
1043277519 8:78418395-78418417 GAGACAAACTTCTACCACCTTGG + Intergenic
1046508531 8:115168590-115168612 AATATACACTACAACCAACTGGG + Intergenic
1051364553 9:16312217-16312239 GAGATGTAGTACGGCCACCTCGG - Intergenic
1052679038 9:31664898-31664920 GAAATAAACTACTATCACCTGGG - Intergenic
1186691174 X:11977595-11977617 AAGCTACACCCCGACCACCTTGG - Intergenic