ID: 1121039458

View in Genome Browser
Species Human (GRCh38)
Location 14:90733357-90733379
Sequence CAGATGAAGGAGAAGGAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 786
Summary {0: 1, 1: 1, 2: 11, 3: 74, 4: 699}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121039458_1121039464 20 Left 1121039458 14:90733357-90733379 CCCGGCTCCTTCTCCTTCATCTG 0: 1
1: 1
2: 11
3: 74
4: 699
Right 1121039464 14:90733400-90733422 TCCAAAACACAAGGGCAGCCAGG 0: 1
1: 0
2: 1
3: 15
4: 205
1121039458_1121039463 12 Left 1121039458 14:90733357-90733379 CCCGGCTCCTTCTCCTTCATCTG 0: 1
1: 1
2: 11
3: 74
4: 699
Right 1121039463 14:90733392-90733414 GAGCAAAGTCCAAAACACAAGGG 0: 1
1: 0
2: 1
3: 23
4: 245
1121039458_1121039462 11 Left 1121039458 14:90733357-90733379 CCCGGCTCCTTCTCCTTCATCTG 0: 1
1: 1
2: 11
3: 74
4: 699
Right 1121039462 14:90733391-90733413 AGAGCAAAGTCCAAAACACAAGG 0: 1
1: 0
2: 0
3: 30
4: 260
1121039458_1121039466 23 Left 1121039458 14:90733357-90733379 CCCGGCTCCTTCTCCTTCATCTG 0: 1
1: 1
2: 11
3: 74
4: 699
Right 1121039466 14:90733403-90733425 AAAACACAAGGGCAGCCAGGAGG 0: 1
1: 0
2: 3
3: 39
4: 326
1121039458_1121039467 26 Left 1121039458 14:90733357-90733379 CCCGGCTCCTTCTCCTTCATCTG 0: 1
1: 1
2: 11
3: 74
4: 699
Right 1121039467 14:90733406-90733428 ACACAAGGGCAGCCAGGAGGTGG 0: 1
1: 0
2: 2
3: 48
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121039458 Original CRISPR CAGATGAAGGAGAAGGAGCC GGG (reversed) Intronic
900001203 1:15795-15817 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
900321793 1:2088178-2088200 CAGATGAGGGAGGCGGAGTCTGG - Intronic
900465770 1:2824807-2824829 CAGAGGGAGGAGAGGCAGCCAGG - Intergenic
900667875 1:3827821-3827843 CAGACGAGGGAGAAAGACCCAGG - Intronic
901144334 1:7054940-7054962 AAGATGAAGGGGAAGTAGGCTGG + Intronic
901738784 1:11328944-11328966 CAGATGAGAGTGAAGGAGTCAGG - Intergenic
902554521 1:17239078-17239100 GAGAGGAAGGAGGAGAAGCCAGG + Intronic
902602672 1:17550833-17550855 CTGGTGGAGGAGGAGGAGCCAGG + Intronic
902619436 1:17642361-17642383 CAGATGAAGGGGAGGGAGGTAGG + Intronic
902792000 1:18775718-18775740 AAGCTGAAGGAGGAGGAGACAGG - Intergenic
902898021 1:19492840-19492862 TACATGAAGGAGGAGAAGCCAGG - Intergenic
903323080 1:22554085-22554107 CAGATCATGGAGAAGGAGCCAGG - Intergenic
903363561 1:22792368-22792390 CAGTTGAGGGAGAAGGAGGGGGG + Intronic
903418611 1:23201920-23201942 CAGATGAGGAAGAAGGGCCCAGG - Intergenic
903581268 1:24372788-24372810 CAGAAGCAGGAGGAGGAGCAGGG - Intronic
903666357 1:25009908-25009930 CAGGTGAATAGGAAGGAGCCTGG + Intergenic
904362990 1:29990568-29990590 CAGATTAAGGAGGTGGAGACAGG - Intergenic
904395693 1:30220020-30220042 CAAATAAAGGAGGAGCAGCCAGG + Intergenic
904946783 1:34205200-34205222 CAGAAGCAGCAGAAGGACCCTGG + Intronic
905514025 1:38548060-38548082 TAGATGAAGGAGATGCAGCAGGG + Intergenic
905595711 1:39204863-39204885 GAGATGGAGGAGAAGCTGCCAGG + Intronic
905850655 1:41272158-41272180 CAGAAGCAGGGGAAGCAGCCAGG - Intergenic
905873855 1:41419709-41419731 CAGCAGAAGGAGCAGGAGCTGGG - Intergenic
905923927 1:41736633-41736655 CAGATGCAGGCCAAGGAACCAGG + Intronic
906656261 1:47550441-47550463 CTGAGGAGGGAGAAGGATCCTGG - Intergenic
906708060 1:47909447-47909469 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
907269995 1:53285409-53285431 ATGATGTAGGAGAAAGAGCCTGG + Intronic
907385670 1:54123981-54124003 CAGATGATGAAAGAGGAGCCAGG + Intergenic
907901536 1:58746012-58746034 CAGCAGAGGGAGAAAGAGCCAGG - Intergenic
908391816 1:63690111-63690133 GAGATGAAAGAGAAAGATCCTGG - Intergenic
908768015 1:67571548-67571570 CAGCTGAAGGAGAAGGGGCTGGG + Intergenic
908803225 1:67902260-67902282 CAGATGTAGGAGAATGAAACTGG - Intergenic
910336598 1:86139159-86139181 AAGATGAGGGAGAAGGAGAAAGG + Intronic
912144804 1:106780392-106780414 CAGATGCAGGATAAGGTGCAGGG - Intergenic
912153921 1:106892440-106892462 CAGAGGTAGGAGTAGGAGCTGGG - Intergenic
912551932 1:110490293-110490315 AAGAAGGAGGAGGAGGAGCCCGG - Intergenic
912956471 1:114157062-114157084 CAGATGCAGGAAGAGGAGCTGGG + Intergenic
913022951 1:114805230-114805252 CTGATGCAGGAGAAGCAGGCAGG + Intergenic
913070227 1:115292005-115292027 GAGATGGAGGAGGAGGAGGCTGG - Intronic
913388694 1:118286963-118286985 CTGAGGCAGGAGAATGAGCCCGG + Intergenic
913557710 1:119985076-119985098 TAGATGCATGAGAAGGAGACTGG + Intronic
913705739 1:121420714-121420736 TAGAAAAATGAGAAGGAGCCAGG + Intergenic
914345417 1:146794581-146794603 GAGAAGAAGGAGAAGGACCTGGG + Intergenic
914449815 1:147781137-147781159 CAAATGAAGGCGCTGGAGCCAGG - Intergenic
915370304 1:155344215-155344237 CAGATGAAGTAGACACAGCCAGG + Exonic
915735508 1:158082120-158082142 CAGAACAAGGAGGAAGAGCCAGG + Intronic
915770480 1:158417122-158417144 CAATTGAAGGAGTAGGAGGCTGG + Intergenic
916026662 1:160838938-160838960 AAGAGGAAGGAGAAGCAGTCAGG - Exonic
916181629 1:162088960-162088982 GAGATGAAGGGGAAGGAGAATGG - Intronic
916252749 1:162754632-162754654 CAGAAGAAGGGGATGGAGCCTGG + Exonic
917966827 1:180184071-180184093 CAGAGGAAGGAGAAGAAGTGAGG - Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918038250 1:180896195-180896217 CAGATCAGGGATAAGGAGGCTGG + Intergenic
918039146 1:180901655-180901677 CAGCTGTAAGAGAAGGAGGCAGG + Intergenic
918118444 1:181516944-181516966 CAGAGGAAGGAGGAAGAGCCAGG - Intronic
918434836 1:184500716-184500738 CAGTTAAAGGAGAAGGAGCTGGG + Intronic
918702230 1:187619763-187619785 CAGAAGAAGGAGAAAGAACTTGG + Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919879942 1:201894811-201894833 CAGGTGCAGGGGAAGGAGCTAGG + Intergenic
920222064 1:204411401-204411423 AAGAAAAAGGAGATGGAGCCGGG - Exonic
920435848 1:205946628-205946650 CAGCGGACAGAGAAGGAGCCGGG + Intergenic
920874465 1:209821396-209821418 CAGATGAAGAAGAACCAGCAAGG - Intergenic
921190997 1:212708678-212708700 CTGATGAAGGAGAAGAAATCAGG + Intergenic
921279860 1:213555853-213555875 AAGATGAAGGAAAAGGAGCCAGG - Intergenic
921328664 1:214013766-214013788 CAGATAAAGGAGAGGTGGCCTGG - Intronic
922239767 1:223748068-223748090 CAGATGGAGGGGAAGGTGGCAGG - Intronic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
923099501 1:230801110-230801132 GAGCTGAAGGAGAAGTAGCATGG - Intronic
924043483 1:240006285-240006307 CAGAAGAAAGAGAAGAAGCATGG - Intergenic
924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG + Intronic
924645341 1:245872429-245872451 CCGGTGAAGGAGAAGGCGGCAGG - Intronic
924869749 1:248028208-248028230 CAGCTGAAGGAGGAAGAGACAGG - Intronic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1063231290 10:4067872-4067894 CTGATGAATGAGGAGGAGCCGGG - Intergenic
1063847246 10:10144336-10144358 AAGATGAAGGAGATGGTGGCTGG - Intergenic
1064117674 10:12592913-12592935 AAGATGAAGAGGAGGGAGCCAGG - Intronic
1064283287 10:13970309-13970331 CAGGTGAAGAAGCAGGAGCAGGG + Intronic
1065360491 10:24884899-24884921 GACATGGAGGAGAAGGACCCAGG + Intronic
1065497980 10:26349620-26349642 TAGAGGAAGGAGAGGAAGCCCGG + Intergenic
1065523022 10:26590178-26590200 CACTTGAAGGAGAAACAGCCCGG + Intergenic
1065528937 10:26649434-26649456 CACTTGAAGGAGAAACAGCCCGG + Intergenic
1065860913 10:29871777-29871799 AAGATGAAGCAAAAGGAGCTGGG + Intergenic
1065890805 10:30119476-30119498 CAGATGAAGGAAAAGCAGAGAGG - Intergenic
1066005228 10:31140836-31140858 CATATGAAGGGCAAGGAGTCAGG - Intergenic
1066348530 10:34614245-34614267 CAGAGGAAGGACCAGGAACCTGG + Intronic
1068303537 10:55176180-55176202 CTGAGGGAGGAGAAGAAGCCTGG - Intronic
1068716158 10:60191029-60191051 CAGATGAAGGAGAATGAAACTGG + Intronic
1068916466 10:62437739-62437761 CAAAGGAAGGAAAAGAAGCCAGG - Intronic
1069714931 10:70514557-70514579 GAGATGAAGGAGTCGGGGCCAGG + Intronic
1069881931 10:71598566-71598588 CAGCTGATGGGGAAGGAGGCAGG + Intronic
1069889736 10:71645453-71645475 CAGAGGAAGGAGGAGGAGAGAGG - Intronic
1069906158 10:71733750-71733772 AAGACGAAGGAGTAAGAGCCTGG - Intronic
1070457487 10:76631793-76631815 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1070874249 10:79787461-79787483 CAGCTGAAGGAGAATTAGACTGG + Intergenic
1070882376 10:79861358-79861380 CAGAGGTAGGAGGAGGAGCTGGG - Intergenic
1071648946 10:87377669-87377691 CAGAGGTAGGAGGAGGAGCTGGG - Intergenic
1072380497 10:94864251-94864273 CACATGTAGGAGAATGAACCTGG - Intergenic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1073104813 10:101026500-101026522 CTGATGAGGGGGAAAGAGCCAGG + Intronic
1073178210 10:101569288-101569310 CACAGGAAGGTGAAGGAGACAGG - Intergenic
1073305381 10:102499740-102499762 CAGAAGAAGCACAAAGAGCCTGG + Intronic
1074405385 10:113176797-113176819 CAGGGGAAGGAGAAGCAGCCAGG - Intergenic
1074569968 10:114615364-114615386 CAGAAGGAGGAGAGGGAGCTGGG - Intronic
1074615369 10:115062054-115062076 CAGTTGGAGGAGGAAGAGCCTGG - Intergenic
1074712669 10:116190441-116190463 CAGGAGAAGGAAAGGGAGCCTGG + Intronic
1074987195 10:118668939-118668961 CAGATGAGGAAGAAGGAGGGTGG + Intergenic
1075396315 10:122130294-122130316 CAGATGAAGAAGGGGGAGTCTGG - Intronic
1075427602 10:122353944-122353966 AAGAGGAAGGAGGAGGAGCCAGG - Intergenic
1076489709 10:130850072-130850094 AAGATGAAGGAGAAGGAGAGGGG - Intergenic
1076490831 10:130860198-130860220 CACATGAAGGAGGAGCAGACTGG - Intergenic
1076773029 10:132677394-132677416 CAGAGGAAGGAGAAAGTGCCGGG + Intronic
1076800144 10:132817964-132817986 GAGAAGCAGGAGAAGGAGCCTGG - Intronic
1076849441 10:133085949-133085971 TAGGTGAAGGAGAGAGAGCCAGG - Intronic
1076886885 10:133267100-133267122 GAGTGGAAGGAGAAGGAGCCAGG + Intronic
1077202030 11:1313567-1313589 CAGATGAAGAAGAATGAAACTGG - Intergenic
1077258487 11:1601714-1601736 CTAATGATGGAAAAGGAGCCAGG + Intergenic
1077426924 11:2484920-2484942 CAGGTGAAGGTGAGAGAGCCAGG - Intronic
1077545634 11:3168429-3168451 CAGATGTAGCAGAAGGGGCAGGG - Intergenic
1077902749 11:6502941-6502963 CAGGGGGAGGAGAAGGGGCCTGG - Intronic
1078215315 11:9306928-9306950 AAGATGAAGGGAAAGGAGCAAGG - Intronic
1078340473 11:10495111-10495133 CAGAGGGAGGGGAAGGGGCCAGG - Intronic
1078612938 11:12837707-12837729 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1079471302 11:20780749-20780771 AAGCTGAAGGAGAAGGAGTCAGG + Intronic
1079724568 11:23865126-23865148 CAGAAGAAGGAAAAGGAGTAGGG - Intergenic
1081006898 11:37755753-37755775 CAGATGAAGGACCAGCAGGCTGG - Intergenic
1081016850 11:37892529-37892551 CATATGTTGGAGGAGGAGCCTGG + Intergenic
1081583411 11:44367667-44367689 CATATGACGGAGGAGGAGCTTGG + Intergenic
1083478757 11:62930189-62930211 CAGATTAAGGTGCAGGAGCCTGG - Intergenic
1083810851 11:65105907-65105929 GAGGTGTAGGAGAAGGAGCATGG + Intronic
1083880575 11:65546486-65546508 CAGGTGCAGCGGAAGGAGCCCGG + Exonic
1083969087 11:66061704-66061726 CGACTGAAGGAGAAGAAGCCAGG + Exonic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084691725 11:70731404-70731426 GAGATGGGGGAGAAGGAGCGGGG - Intronic
1084803038 11:71558273-71558295 CTAATGATGGAAAAGGAGCCAGG - Intronic
1085976241 11:81659383-81659405 CCTATGTTGGAGAAGGAGCCTGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086458879 11:86985832-86985854 CATTTGCAGGGGAAGGAGCCTGG + Intergenic
1087016570 11:93559937-93559959 GAGATGAAGGAAGAGCAGCCAGG + Intergenic
1087307073 11:96500597-96500619 CAGCTGAATGAGAAGGAGGAGGG - Intronic
1087843276 11:102942271-102942293 AAGGAGAAGGAGAAGAAGCCAGG - Intergenic
1088180019 11:107098662-107098684 CACATGAAGGAGAATGAAACTGG + Intergenic
1088952353 11:114584638-114584660 AAAATGAAGGAGGAGAAGCCAGG + Intronic
1089070516 11:115696106-115696128 AGGATGTAGGAGCAGGAGCCAGG + Intergenic
1089155378 11:116398057-116398079 GAGATGCAGGAGAAGTGGCCAGG + Intergenic
1089596043 11:119580963-119580985 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1090397983 11:126431776-126431798 CAGAGGAAGGAGAGCGAGGCAGG + Intronic
1090480034 11:127059869-127059891 CAGAGGAAGGAGCAGGGGACAGG + Intergenic
1090660022 11:128875562-128875584 TAGAGGAAGGAGAAGCAGCATGG + Intergenic
1090664991 11:128909016-128909038 CACATGAAGGAGCAGGAAGCAGG + Intronic
1090745215 11:129699838-129699860 CAGAAGTGGCAGAAGGAGCCGGG - Intergenic
1090827999 11:130401439-130401461 CACCTGAAGAAGAACGAGCCAGG + Intergenic
1090962878 11:131572837-131572859 CTGATGAAGGAGAATGTTCCCGG + Intronic
1092446733 12:8564776-8564798 GAGGTGGAGGAGGAGGAGCCGGG + Intergenic
1092939122 12:13391053-13391075 CACATGGAGGAGATGAAGCCAGG - Intergenic
1093061537 12:14612300-14612322 CTGATGAAAGATCAGGAGCCTGG + Intergenic
1093245463 12:16730771-16730793 CGGATGCTGGAGAAGGACCCAGG + Intergenic
1093815028 12:23535124-23535146 AAGATGAAGCAGAAGAACCCAGG + Intronic
1094094499 12:26688539-26688561 CAGAGGAAGAAGAAGGAGAAGGG + Intronic
1094201878 12:27803417-27803439 CTGATGGAGGAGAAGGAGGATGG + Intergenic
1094371584 12:29744245-29744267 AAGATGAAGCAGAATGAACCAGG + Intronic
1094404002 12:30094945-30094967 CAGGAGAAGAAGAAGGAGCGGGG - Intergenic
1095111970 12:38305574-38305596 CTGATGAAGGAGTAGGTTCCTGG - Intergenic
1095214987 12:39537920-39537942 CAGATGAATCAGAATGAGGCAGG + Intergenic
1096114230 12:49045919-49045941 CCCATGAAGGTGAAAGAGCCAGG - Exonic
1096149468 12:49299564-49299586 AAGAAGAAGAAGAAGAAGCCCGG + Intergenic
1096192750 12:49631052-49631074 CAGATGAAGGGGCAGAAGGCAGG - Intronic
1096226599 12:49870168-49870190 CAGATGCAGGAGAGAGACCCAGG - Exonic
1096509977 12:52122263-52122285 AAGGTGAAGGTGAAGGAGGCTGG + Intergenic
1096559318 12:52424435-52424457 GAGAGGAAGGAGGAGGACCCTGG + Exonic
1096565805 12:52477824-52477846 CCGATGTTGGAGGAGGAGCCTGG + Intergenic
1096632086 12:52934263-52934285 AAGGAGAAGGAGAAGAAGCCGGG + Intronic
1096650971 12:53061823-53061845 CTGCTGAAGGACAAGGACCCTGG + Exonic
1096689215 12:53309164-53309186 CAGCTGAAGGAGTGGTAGCCAGG + Exonic
1096863478 12:54547068-54547090 GAGAGGAATGAGAAGGAGCCTGG + Exonic
1097285560 12:57874386-57874408 CGGAAAAAGGAAAAGGAGCCTGG - Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098385546 12:69914960-69914982 CTGATGATGGAGGAGAAGCCCGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1099157900 12:79202521-79202543 AAGAAGAAAGAGAAGGAGTCAGG + Intronic
1099236610 12:80090308-80090330 CATATGAAGGAGAATGAAACTGG + Intergenic
1099248079 12:80217756-80217778 CACATGAAGGAAAGTGAGCCAGG + Intronic
1099305411 12:80948562-80948584 CATATAAAGGAAAAGGATCCAGG + Intronic
1099379781 12:81939605-81939627 TGGAGGAAGGAGAAGGAGACAGG - Intergenic
1099508838 12:83509028-83509050 CAGATGCTGGACAAGGACCCAGG - Intergenic
1099802760 12:87477555-87477577 CAGATGAAGGAGAAGGTTATAGG - Intergenic
1100692973 12:97058568-97058590 AATATCAAGGAGATGGAGCCAGG + Intergenic
1100779395 12:98008003-98008025 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1100809155 12:98320593-98320615 CAAATGAAGGAGTAGGAGAAAGG + Intergenic
1102166750 12:110813006-110813028 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1102594377 12:113981334-113981356 CACACGAAGGAGATGGAGCCAGG + Intergenic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1102733541 12:115136712-115136734 AAGATGAAGAAGAAGGAGCAAGG + Intergenic
1102736438 12:115164953-115164975 GAGATGATGGGGAAGCAGCCTGG + Intergenic
1103371578 12:120423335-120423357 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1103401903 12:120649051-120649073 GAGATGGAGGAGGAGGAGCCTGG - Intronic
1103558780 12:121781249-121781271 CGGGTGAAGGGGAAGGGGCCAGG + Exonic
1103904247 12:124319374-124319396 CAGATGGAAGCGAAGGAGCCAGG + Intergenic
1104371168 12:128225150-128225172 TTGATGAAGGTGAGGGAGCCAGG + Intergenic
1105477091 13:20737722-20737744 CAGCTGTAGGAGAAGGTGGCAGG - Exonic
1105592849 13:21810653-21810675 CAGAAGAAGGAGAGACAGCCAGG + Intergenic
1106375498 13:29182910-29182932 CAGCTGAAGGGGAGGGAGCAGGG + Intronic
1106607762 13:31247030-31247052 CTGATGAAGGAGGAGGACACTGG - Exonic
1106720827 13:32433154-32433176 CAGCTGAAGGACAAGGAGTTGGG - Intronic
1106771517 13:32965290-32965312 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1107242107 13:38248690-38248712 CAGAAGAAGGAGGAGGAGAAAGG - Intergenic
1107649125 13:42526524-42526546 CAGATCAAAGAGAAAGAGGCAGG + Intergenic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1109226223 13:59699373-59699395 CAGCTGAAGGGGAGTGAGCCAGG + Intronic
1109585097 13:64390062-64390084 CAGATGATGAAGAAAGAACCAGG + Intergenic
1110244241 13:73303658-73303680 AAGAAGAAGGAGGAGGAGCTAGG - Intergenic
1110370790 13:74737854-74737876 CAGATGGAGGAGGAAGAGCCAGG + Intergenic
1111975495 13:94962693-94962715 CAGATGAGGGAGGGGGACCCTGG + Intergenic
1112155729 13:96815190-96815212 CAGACGAAAGAGAAGAGGCCTGG - Intronic
1112374531 13:98826366-98826388 CAGAGGAAGGAGAGGGGGCGAGG - Intronic
1113077427 13:106480864-106480886 GAGATGAGGGAGGAGGAGCCAGG + Intergenic
1113672434 13:112184150-112184172 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1113909507 13:113835557-113835579 CAGAGGCAGGAGTAGGAGCCGGG + Exonic
1114260713 14:21034250-21034272 AAGCTGGAGGAAAAGGAGCCGGG + Exonic
1114598547 14:23935006-23935028 AAGAGAAAGGAGAAGGTGCCAGG + Intergenic
1115154540 14:30323052-30323074 CAGAGGAAGGAGAGGCAGGCAGG - Intergenic
1115305258 14:31927372-31927394 CAGTGGAAGGAGAAGGAGTTGGG - Intergenic
1115529365 14:34312808-34312830 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1115664878 14:35534970-35534992 AAGATCAAGGAGGAGGAGCCCGG + Exonic
1116134391 14:40901981-40902003 CAGATGAAGAAGGTGAAGCCTGG + Intergenic
1116378884 14:44239772-44239794 AAGATGGAGGAGAAAGAGCAAGG - Intergenic
1116433063 14:44868504-44868526 CATAGGAAGGAGAAAGAGCCAGG + Intergenic
1116976892 14:51126397-51126419 CACATGTAGGAGAAGGAAACTGG - Intergenic
1117232851 14:53739438-53739460 TTGAGGAAGGAGAAGGAGCAAGG + Intergenic
1118162717 14:63306731-63306753 CAAATGTAGGAGAATGAGACTGG + Intergenic
1118516334 14:66532407-66532429 CAGAGGAAGCAGAAGATGCCAGG + Intronic
1118716086 14:68561086-68561108 CAGAGGAAGGTGTAGGAGGCAGG - Intronic
1118899919 14:69978029-69978051 TAGATGAGATAGAAGGAGCCTGG + Intronic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1119430125 14:74561828-74561850 CATATCTAGGAGAAGGATCCAGG + Intronic
1119748281 14:77059801-77059823 CAGCTGGAGGAGCGGGAGCCAGG + Intergenic
1120242140 14:81961826-81961848 CTGAGGCAGGAGAAGAAGCCAGG - Intergenic
1120246788 14:82016136-82016158 CTGATGAACGAAAAGGAGCCAGG - Intergenic
1120281459 14:82443675-82443697 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1120469498 14:84904240-84904262 CACATGTTGGAGAAGGAGCCTGG + Intergenic
1120502642 14:85316010-85316032 CTGATGAAGTAAAAGGAGACAGG - Intergenic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121115361 14:91339248-91339270 CAAAGGTAGGAGAAGCAGCCGGG + Intronic
1121316538 14:92964340-92964362 CAGAGCCAGGACAAGGAGCCAGG + Intronic
1121432973 14:93900377-93900399 CAGCAGAAGGAGATGGAGTCAGG - Intergenic
1121683195 14:95811415-95811437 AAGAAGAAGGACAAGGAGCAGGG - Intergenic
1121704719 14:95982917-95982939 CCGAAGAAGGAGAAGGAGCTAGG - Intergenic
1121709451 14:96026780-96026802 CAGCAGAAGGAGAAGGAGATGGG + Intergenic
1122162918 14:99799100-99799122 CACCTGCAGGAGAAGAAGCCAGG - Intronic
1122207718 14:100156537-100156559 CAGATGAAGGAGTTGGGGCCTGG - Intronic
1122406157 14:101502308-101502330 CAGATGATGGAGCAGCAGCAAGG + Intergenic
1122663876 14:103315830-103315852 CAGATGAAGGAGAGGGGGCCCGG - Intergenic
1122663890 14:103315892-103315914 CAGATGAAGGAGAGGGGGCCGGG - Intergenic
1123878960 15:24656715-24656737 CAGATGAGGTAGAAGCAGCTGGG + Intergenic
1123898339 15:24850701-24850723 CAGATGAGGTAGAAGGAGCCTGG + Intronic
1123899461 15:24862304-24862326 CAGATGAGGTAGAAGCAGCATGG + Intronic
1124924613 15:34059221-34059243 CAGATGAAAAAGAAGTACCCAGG + Intronic
1125341991 15:38684446-38684468 CAGATGAAAGATAATGACCCCGG + Intergenic
1125456861 15:39868809-39868831 CATACGAAGGGGCAGGAGCCAGG + Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1126297311 15:47154911-47154933 CAGAGGAAGTAGAAAGAGCTTGG + Intergenic
1126549104 15:49907786-49907808 CAGATGTAGGAGAAAGAGTATGG - Intronic
1127554501 15:60074153-60074175 CACGTGAAGGGGAAGAAGCCAGG + Intergenic
1128680857 15:69650341-69650363 CAGAGGAAGGAAATGCAGCCAGG - Intergenic
1129274193 15:74434479-74434501 GAGAGGGAGGGGAAGGAGCCAGG - Intergenic
1129614177 15:77084735-77084757 CAGATGAGGCAGTAGGACCCTGG + Intergenic
1129680752 15:77657231-77657253 CAGGGGAGGGAGGAGGAGCCAGG - Intronic
1130744575 15:86637428-86637450 CAGATGAAGGTGAATGAGGCCGG + Intronic
1132050639 15:98605116-98605138 AAAGTGAAGGAGAGGGAGCCAGG + Intergenic
1132452306 15:101975144-101975166 CAGCAGAAGGAGCAGGAGCAAGG + Intergenic
1132454592 16:15480-15502 CAGCAGAAGGAGCAGGAGCAAGG - Exonic
1133060860 16:3173721-3173743 CAGATGAGGGATGGGGAGCCTGG - Intergenic
1133202146 16:4210223-4210245 GAGATGTAGGTGAAGGAGTCAGG - Intronic
1133255636 16:4514187-4514209 GGGCTGAAGGAGAAGGAACCTGG - Intronic
1133367885 16:5225509-5225531 ATGAAGGAGGAGAAGGAGCCAGG + Intergenic
1134898608 16:17913464-17913486 AAGATGATGGAGAAGGAACATGG + Intergenic
1135033558 16:19058054-19058076 CAGGTGTAGTAGAAGGTGCCTGG - Intronic
1135153580 16:20032192-20032214 AAGATGAAGAAGATGGAGCAGGG + Exonic
1135190329 16:20349020-20349042 CAGACGCAGGAGAAGGAGCCTGG + Exonic
1135232064 16:20717865-20717887 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
1135612341 16:23879393-23879415 CATGTCAAGGAGAAGGTGCCTGG - Intronic
1135798939 16:25474642-25474664 GAGCTGAAGGAGAGGTAGCCTGG - Intergenic
1136368351 16:29820335-29820357 CAGCTGCAGCAGAAGCAGCCCGG + Exonic
1136548178 16:30966932-30966954 AAGACGAAGCTGAAGGAGCCTGG + Exonic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1138202131 16:55097142-55097164 AAGAGGAAGAAGAAGGAGTCTGG + Intergenic
1138311508 16:56027412-56027434 CAGATGTAAGAGAATGAGCCTGG - Intergenic
1138554892 16:57765310-57765332 CAGAGGAAGGAGCAGGACCCTGG + Intronic
1138649363 16:58450296-58450318 AGGATGGAGGAGAAGGAGCCTGG + Intergenic
1138749217 16:59398631-59398653 CTGAGGATTGAGAAGGAGCCAGG - Intergenic
1139237380 16:65354514-65354536 CAGAGGAAGGATAAGGAGCTGGG - Intergenic
1139776849 16:69321774-69321796 CAGAGGATGGAGATGGAGCAGGG + Intronic
1140723120 16:77788722-77788744 CAAATGATCGAGAAGGAGGCAGG + Exonic
1141031061 16:80589001-80589023 AAGAGGAAGGAGAAGAAGACTGG + Intergenic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1141393322 16:83682644-83682666 CAGAGGAAGGAGGAGGAGTGAGG - Intronic
1141421171 16:83917511-83917533 CAGAAGACAGAGAAGGGGCCTGG - Exonic
1141924611 16:87159940-87159962 AAGGAGAAGGAGAAGGAGACAGG + Intronic
1142553255 17:753479-753501 GAGATGAGGAAGAAGGAGGCTGG + Intronic
1143576029 17:7793757-7793779 CTGATTAAAGAGAAGCAGCCGGG - Intronic
1143591072 17:7885958-7885980 GAGATGAAGGGGGTGGAGCCGGG - Intronic
1143649909 17:8256960-8256982 GAGAGGAAGGAGATGGAACCTGG - Exonic
1144198565 17:12918695-12918717 CAGCTGAAGGAGGAAGAGCGTGG - Intronic
1145887299 17:28391384-28391406 CCCATGAAGGAGAAGATGCCAGG + Intronic
1145900698 17:28488860-28488882 CAGAAGAAGGAGCAGGACCTGGG - Intronic
1146184898 17:30718333-30718355 GAGACGAAGGAGAAGGTGTCGGG + Intergenic
1146414672 17:32620790-32620812 CTGATGTAGGGGGAGGAGCCAGG + Intronic
1146704716 17:34992612-34992634 CAGGAGGTGGAGAAGGAGCCGGG + Exonic
1146723931 17:35142286-35142308 CACGTGGAGGAGAAAGAGCCCGG + Exonic
1146884110 17:36459504-36459526 ATGAGGAAGGAGATGGAGCCTGG + Intergenic
1147202835 17:38814972-38814994 AAGATGGAGGAGAAGGAGGCAGG - Exonic
1148390104 17:47265954-47265976 CCAAGGAAGGAGAAGGAGACAGG - Intronic
1148467390 17:47873050-47873072 CAGAGGAGGGAGCAGGAGCCAGG + Intergenic
1148511004 17:48169777-48169799 TAGATAATGGAGAAGGAGCAGGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149635830 17:58168501-58168523 CAGAAGAAGATGGAGGAGCCGGG - Intergenic
1149958618 17:61081799-61081821 CAGATGAGAGACAAGGAGCTGGG - Intronic
1150286410 17:63956753-63956775 CAGATGATGGCAAAGGAGCTGGG + Intronic
1150456527 17:65310881-65310903 CTGAAGGAGGAGAAGGAGCTAGG + Intergenic
1150507542 17:65714990-65715012 CAGGTGGAGCAGAAGGAGCAAGG + Intronic
1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG + Intronic
1151576851 17:74956810-74956832 GAGAGGAAGCAGAAGGAGCCAGG - Intronic
1152456897 17:80421927-80421949 CAGCTGCGGGAGAAGGAGCCGGG + Exonic
1153108101 18:1550898-1550920 CAAATGTTGGAGAAGGGGCCTGG + Intergenic
1153788766 18:8558334-8558356 CAGATTCAGGAGAATCAGCCAGG - Intergenic
1155000507 18:21681527-21681549 GAGATGGAGGGGAAGGAGGCTGG - Intronic
1155297921 18:24402240-24402262 CAGCTGAAGGAGCAAGAGCAGGG + Intergenic
1156414346 18:36872045-36872067 AAGATAGAGGAGAAGGACCCAGG - Intronic
1156638234 18:39057279-39057301 AAGAAGAAGAAGAAGAAGCCAGG - Intergenic
1157131201 18:45008991-45009013 CAGATGAACGAACAGGAGACTGG + Intronic
1157244426 18:46040894-46040916 CAGGAGAGGGAGAAGGAGCTGGG + Intronic
1157562667 18:48659749-48659771 GAGAGGAAGGAGAAGCAGCCTGG + Intronic
1158679992 18:59558701-59558723 CAAATGGAGAGGAAGGAGCCAGG + Intronic
1159355491 18:67334161-67334183 CAGAAGAAGAAGAAGATGCCAGG + Intergenic
1160065781 18:75573098-75573120 AACAAGAAAGAGAAGGAGCCAGG - Intergenic
1160374531 18:78401452-78401474 GAGATGAAGAAGATGGAGCCTGG + Intergenic
1160444107 18:78914016-78914038 CAGCTGGAGAAGAATGAGCCTGG - Intergenic
1160881816 19:1324438-1324460 CAGAAGGGCGAGAAGGAGCCAGG + Intergenic
1160912788 19:1482543-1482565 GAGCTGAAGGGGAGGGAGCCCGG - Intronic
1160949417 19:1658365-1658387 CAGGTGCAGGTGAAGGAGCCTGG - Intergenic
1161027572 19:2043563-2043585 CAGATCATTGAGAAGCAGCCAGG - Exonic
1161086519 19:2338062-2338084 CAGAAGATGGAAAAGGGGCCAGG - Intronic
1161308992 19:3583601-3583623 CAGATGAAGGAGGAGACCCCAGG - Intergenic
1161366940 19:3885564-3885586 AAGAAGAAGGAGAAGGAGAGAGG + Intronic
1161517376 19:4703954-4703976 TTGATGAAGGAGAAGAAGGCAGG + Exonic
1161768310 19:6218620-6218642 CAGCTGCAGGAGGAGGAGGCGGG - Intronic
1161905847 19:7155944-7155966 AAGGAGGAGGAGAAGGAGCCAGG + Intronic
1161935375 19:7368625-7368647 CAGATGCAGGAGAAAGAGGGAGG + Intronic
1161957998 19:7506856-7506878 CAGAGGAAGGGGGAGGAGCTGGG - Intronic
1162309800 19:9899455-9899477 GAGCTGATTGAGAAGGAGCCAGG - Intronic
1162534341 19:11254027-11254049 CAGATGAGGGAGCAGAGGCCAGG - Intronic
1162541110 19:11296503-11296525 CAGACGGAGGAGGAGGAGCAGGG + Intronic
1162967703 19:14163862-14163884 GAGAAGAGGGAGAAGGGGCCGGG - Intronic
1163085873 19:14979568-14979590 CGGATGCAGGAGCCGGAGCCCGG + Intronic
1163193613 19:15697672-15697694 CAGCTGATGGACAAGCAGCCTGG - Intergenic
1163632457 19:18424418-18424440 CAGATGGAGGAGACGGAGCAGGG + Intronic
1164168304 19:22701531-22701553 CAAATGAAGGAGAAGGAAGTAGG - Intergenic
1164536158 19:29087842-29087864 CACATGAAGGAGAAGGAGACAGG + Intergenic
1164592650 19:29514642-29514664 CAGATGAAGAGGAAGGAGGGGGG + Intergenic
1164657935 19:29938339-29938361 GAGAGGAAGGAGGAGGTGCCAGG + Intronic
1164857364 19:31535556-31535578 CAGGTGATGGGGAAGGAGGCAGG - Intergenic
1165253603 19:34559316-34559338 CAACTGAAGGCAAAGGAGCCGGG + Intergenic
1165335950 19:35169733-35169755 CAGATGATGAAGCTGGAGCCAGG + Exonic
1165866578 19:38943038-38943060 CTGAAGGAGGAGAGGGAGCCGGG + Intronic
1165996596 19:39848331-39848353 CAGAAGCAGGAGATGGTGCCAGG - Intergenic
1166079269 19:40433816-40433838 CAGAAAATGGAGACGGAGCCAGG + Intergenic
1166100648 19:40569685-40569707 CAGCTGCAGGAGAAAGAGGCAGG + Exonic
1166416087 19:42595786-42595808 GAGATCCAGGAGAGGGAGCCTGG + Intronic
1166432831 19:42741344-42741366 GAGATGCAGGAGGGGGAGCCTGG + Intronic
1166465478 19:43027333-43027355 GAGACGCAGGAGGAGGAGCCTGG + Intronic
1166674950 19:44734663-44734685 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167353726 19:48991438-48991460 CAGACGAAGGCGAAGGTGACAGG - Exonic
1167427809 19:49438445-49438467 CAGATGGAGGCGAGGGAGACTGG + Intronic
1167595885 19:50427931-50427953 CAGATCCAGGAGATGGAGGCCGG + Intronic
1167633065 19:50637853-50637875 CAGATGAAGGAACAGGAGTTAGG + Exonic
1167702110 19:51054962-51054984 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1167837302 19:52084803-52084825 AAGAAGAAAGAAAAGGAGCCAGG - Exonic
1167888593 19:52522152-52522174 AAGAGGAAAGAAAAGGAGCCAGG + Intergenic
1168000566 19:53442623-53442645 CAGAGGAAGGAGCAGCAGCAGGG - Intronic
1168005061 19:53480107-53480129 CAGAGGAAGGAGCAGCAGCAGGG - Intronic
1168058474 19:53877020-53877042 GGGATGGAGGAGAAGGAGGCTGG - Intergenic
1168308515 19:55449697-55449719 CAGCTGAGGGGGAAGGGGCCCGG + Intergenic
1168445479 19:56408570-56408592 CAGATGAAGAAAAAGAGGCCAGG + Intronic
1168531131 19:57130186-57130208 CAGATGAATGATAAGGACCCTGG - Exonic
925065784 2:928128-928150 CAGATGAAGGAGGAGGCCCGTGG + Intergenic
925065828 2:928329-928351 CAGATGAAGGAGGAGGCCCGTGG + Intergenic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925198456 2:1947015-1947037 CTGATGAAGGAGAAGGAAGCTGG - Intronic
925423289 2:3728851-3728873 CAGATGCTGGAGAGAGAGCCCGG + Intronic
925703712 2:6664221-6664243 GAGATGAAGGAGAAGGAGGAAGG + Intergenic
925819690 2:7787837-7787859 CAGATGACTGAGAAGCAGCCAGG + Intergenic
925999717 2:9320793-9320815 CAGATGAATCTGAAGGAGACAGG - Intronic
926251375 2:11157034-11157056 CCCATGAAGGAAAAGAAGCCAGG + Intronic
926377017 2:12240703-12240725 CAGAGGAAAGAGAAGGAACATGG - Intergenic
927558718 2:24053860-24053882 CAGATGAAGGAGTAGGATATTGG - Intronic
927560825 2:24071725-24071747 CTGAAGAATGAGGAGGAGCCAGG + Intronic
928124349 2:28605535-28605557 CAGATGAAGGAGTGGGATCCTGG - Intronic
928314060 2:30232394-30232416 GTGCTGAAGGGGAAGGAGCCCGG + Intronic
929227748 2:39527741-39527763 CACCTGAAGGAGAAGTACCCAGG - Intergenic
929771552 2:44896594-44896616 CAGATGAAAGAGAAGCCCCCAGG + Intergenic
930989717 2:57638315-57638337 AAGATGAAGGAAAAGGAGGTAGG + Intergenic
932221132 2:69999877-69999899 GGGAGGAAGGAGGAGGAGCCCGG - Intergenic
932465181 2:71917120-71917142 CATGAGAAGAAGAAGGAGCCTGG - Intergenic
932692039 2:73921429-73921451 CTGGTGAAGGACAGGGAGCCAGG + Intergenic
933943139 2:87261961-87261983 CTGAGGAAGGAGAACGTGCCGGG - Intergenic
935079486 2:99778199-99778221 CAGAGGAAGGAGGAGGAGAAGGG - Intronic
935104350 2:100025843-100025865 CAGATGTAGGAGAATGAAACTGG + Intronic
935723042 2:105996698-105996720 CAGATGAAGGGCAAGGAGCAGGG - Intergenic
935794743 2:106630262-106630284 CAACTGAAAGAGAAGGAACCTGG - Intergenic
936117242 2:109711986-109712008 CCGATGACAGGGAAGGAGCCAGG - Intergenic
936154638 2:110040071-110040093 CAGATGCAGCAGGAGAAGCCTGG - Intergenic
936190045 2:110331343-110331365 CAGATGCAGCAGGAGAAGCCTGG + Intergenic
936337073 2:111599602-111599624 CTGAGGAAGGAGAACGTGCCGGG + Intergenic
936589081 2:113785724-113785746 CAGAAGAAGGAAAAGGAGTGAGG - Intergenic
937440134 2:121908319-121908341 CAGATGCAGGTGCAGGAGGCTGG + Intergenic
938719818 2:134056669-134056691 CAGAGGAAGGAGAAAAAGACAGG + Intergenic
938899432 2:135787405-135787427 CAGACGAAGGAGAATCTGCCTGG + Intergenic
938902051 2:135806873-135806895 CAGATGGAGCAGGGGGAGCCTGG - Intronic
939130741 2:138233323-138233345 GTGATGAAAGATAAGGAGCCAGG + Intergenic
941274990 2:163479879-163479901 CAGATGGAGGTGATGGAGCTAGG + Intergenic
942103332 2:172607762-172607784 CAGGGGAAGGAAAAGGAGCAGGG + Intronic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942250940 2:174047312-174047334 CAGAAGAGGAAGAAGAAGCCTGG + Intergenic
942625302 2:177894095-177894117 CACATTCAGGAGAAGAAGCCAGG - Intronic
942676217 2:178429140-178429162 CAGAAGAATGAGAATGGGCCAGG - Intergenic
942802646 2:179893172-179893194 CAGAAGAAGCAGAAGCTGCCAGG + Intergenic
943909689 2:193547300-193547322 CACATGAAGGAGAATGAATCTGG + Intergenic
943985627 2:194614496-194614518 CAGATGAAGTAGAAATAGCAAGG - Intergenic
944565597 2:200987307-200987329 CAGTTGCTGGAGAAGGATCCTGG - Intronic
944656467 2:201880962-201880984 CAGAAGAGAGAGAAGCAGCCAGG + Intronic
945155438 2:206832850-206832872 TAAATGAAGGAGAAGGAGGAAGG - Intergenic
945686718 2:212979966-212979988 AAGATGAAAGATAAGCAGCCAGG + Intergenic
946321362 2:218956264-218956286 CAGATTAGGGAGAAGCAGACAGG + Intergenic
946669672 2:222089362-222089384 CAGAGGATGGAGAGAGAGCCCGG - Intergenic
947663947 2:231891246-231891268 CAGATGGACAAGAGGGAGCCAGG + Intergenic
948539007 2:238672382-238672404 GAGAAGAAGGAGAAGGAGAAGGG - Intergenic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
948807099 2:240457724-240457746 GAGAGGCAGGAGAGGGAGCCAGG - Intronic
948841152 2:240649693-240649715 CACATGGAGGAGAAGCAGCTGGG - Intergenic
948880631 2:240855588-240855610 CAGATGATGAAGAAGATGCCCGG - Intergenic
949032247 2:241802637-241802659 CAGAGGGAGGAGGAGGGGCCGGG + Intronic
949034493 2:241810321-241810343 CAGATGAGTCAGAAGGAGCTGGG + Intronic
1169855180 20:10094236-10094258 CCGATGATGGAGATGGATCCTGG + Intergenic
1170173749 20:13444048-13444070 CAGATGAAGGAAAAAAAGCACGG - Intronic
1170584696 20:17725556-17725578 CAGGTGAAGAAACAGGAGCCTGG + Intronic
1170714100 20:18817287-18817309 GAGATGGAGGGGCAGGAGCCTGG + Intronic
1170790966 20:19509170-19509192 CAGATGAAGGAAATGAGGCCCGG + Intronic
1171175444 20:23048576-23048598 CACATGCACGAGTAGGAGCCCGG + Exonic
1171250652 20:23643895-23643917 AAGATGAAAGAGGAGGAGCAGGG - Intergenic
1172283367 20:33723624-33723646 CAGCTGAAGGAGAAGGAAAGAGG + Intergenic
1172811659 20:37652346-37652368 AAGAAGAAGAAGAAAGAGCCAGG - Intergenic
1172849113 20:37947811-37947833 CAAAAGAAGAAGAAGGTGCCTGG + Intergenic
1172977614 20:38918625-38918647 GAGATGGAGGAGAAGGTGCATGG + Exonic
1173597501 20:44268659-44268681 CTGAAGGATGAGAAGGAGCCTGG + Intronic
1173637494 20:44573418-44573440 TAGATTAAGGATCAGGAGCCTGG + Intronic
1173649288 20:44652673-44652695 CAGGTGAAAGGGAAGGAGCCGGG + Intergenic
1174061935 20:47839159-47839181 CTGAGGAAAGAGGAGGAGCCAGG + Intergenic
1174069573 20:47890072-47890094 CTGAGGAAAGAGGAGGAGCCAGG - Intergenic
1174488348 20:50875029-50875051 CAGAAGAAGGAGAGGGCTCCCGG - Intronic
1174505903 20:51017428-51017450 CAGAGGAAGGGGAAGAAGCGCGG + Intronic
1174657234 20:52181751-52181773 CAGATTCAGGAGGTGGAGCCCGG + Intronic
1175070901 20:56332945-56332967 GAGAGAAAGGAGGAGGAGCCAGG - Intergenic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175187320 20:57187481-57187503 TAAATGAAGGAGAAGTATCCTGG + Intronic
1175294348 20:57898019-57898041 CAGGTAAGGGAGATGGAGCCTGG - Intergenic
1175661420 20:60816262-60816284 AAGAAGAAGGAGGAGGAGCAAGG - Intergenic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1176049494 20:63110194-63110216 AAGATGAAGGAGGAGCAGGCAGG + Intergenic
1176281938 20:64318252-64318274 CAGAGAAAGGAAAAGGAACCGGG + Intergenic
1177112181 21:17041962-17041984 CAGAGGACGTAGAAGGAGACAGG + Intergenic
1177748506 21:25251241-25251263 CAGAGGAAAGAGAAAGAGACAGG - Intergenic
1178457855 21:32772203-32772225 CAGATGAGGGAGGAGGAGGAGGG + Intergenic
1179510952 21:41873169-41873191 CACATGCAGGAGAAGGAACCAGG - Intronic
1179969514 21:44826424-44826446 TAGATGGAGGAGAAGGAGACAGG + Intergenic
1181431095 22:22882387-22882409 CAGTAGAGGGAGGAGGAGCCTGG - Intronic
1181462894 22:23095715-23095737 CAGAGGAAAAAGAAGCAGCCCGG + Exonic
1182148058 22:28009547-28009569 CAGAAGCAGGAGAATGATCCAGG + Intronic
1183093825 22:35540739-35540761 GAGGTGAAGGAGGAGGAGCCGGG + Intergenic
1183253736 22:36747431-36747453 GACATGAAGGAGCAGGAGTCAGG - Intergenic
1184305577 22:43599033-43599055 CAAATGTAGGAGCAGGTGCCTGG - Intronic
1184533518 22:45071504-45071526 CAGAACAAGGAGAGGGAGCAGGG + Intergenic
1184615107 22:45632770-45632792 CAGAGGAAGGCGCAGGAGCCGGG + Intergenic
1184651313 22:45920603-45920625 CTGTTGAAGCAGGAGGAGCCTGG + Exonic
1184702919 22:46188985-46189007 CAGATGACGAGGAAGCAGCCTGG - Intronic
1185108922 22:48890017-48890039 CACATGGAGGGGACGGAGCCTGG + Intergenic
1185273796 22:49941259-49941281 CAGAAGAAGGAGAGGGTGCTGGG + Intergenic
1185336163 22:50271734-50271756 CAGCTAAAGGAGGAGGAGGCCGG + Intergenic
949929110 3:9064388-9064410 AAGATGAAGGAGAAGGTGAGTGG - Exonic
950897500 3:16466974-16466996 CAGATGTGGGAGAAAGAGACTGG + Intronic
951052334 3:18108256-18108278 CAGGTGAAGGGGAAGGATCATGG - Intronic
951455398 3:22886536-22886558 CTGATGAAGCACAGGGAGCCTGG + Intergenic
951700147 3:25488194-25488216 CAGGTGTAGGAAAAAGAGCCGGG - Intronic
951713324 3:25609567-25609589 AAGAGGGAGAAGAAGGAGCCTGG - Exonic
952288260 3:31989104-31989126 AAGAGGAAAGAAAAGGAGCCAGG + Exonic
954333692 3:49904005-49904027 CAGGTGAAGGTACAGGAGCCAGG - Exonic
954994564 3:54869905-54869927 CAGATGAAGGGGAAGGAAAGTGG - Intronic
955252517 3:57298438-57298460 CAGATGAAGTGCAAGAAGCCAGG + Intronic
955465107 3:59229426-59229448 CAGAAGATGAAGAAGGAGCAAGG + Intergenic
955500950 3:59582314-59582336 CAGATGGAGGAGAAGGGGTGAGG - Intergenic
955763706 3:62317969-62317991 CAGGTGGAGGATAGGGAGCCAGG + Intergenic
956007675 3:64798140-64798162 CAGACCAAGTAGAAGGACCCAGG - Intergenic
956159941 3:66340050-66340072 CAGATGGAAAAGAATGAGCCTGG - Intronic
956414455 3:69012724-69012746 GAGCTGAAGGAAAAGTAGCCTGG - Exonic
956893796 3:73639262-73639284 AAAATGAGGGAGAAGCAGCCAGG + Intergenic
959095316 3:101949385-101949407 CAAATGGAGGCAAAGGAGCCTGG - Intergenic
959628458 3:108480886-108480908 CAGATGGAGAAGAAGGAACGGGG - Intronic
959963891 3:112332608-112332630 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
960130468 3:114050643-114050665 CTGATGGAGGGGAAGGAGACTGG + Intronic
960286395 3:115834507-115834529 AAGATGATGGAGAATGACCCAGG + Intronic
960463169 3:117961877-117961899 CAGATGAAGGTGATGGTGGCAGG - Intergenic
960720693 3:120622376-120622398 CAGGGGAAGGGGAAGGAGACTGG - Intergenic
960826183 3:121787116-121787138 CTGAAGAAGGAGTAGGAGACAGG + Intronic
962227876 3:133631561-133631583 CCAATGATGGAGGAGGAGCCTGG + Intronic
962265838 3:133943779-133943801 CAGAGGAAGGACAAGGAACTTGG - Intronic
962509264 3:136082605-136082627 CAGATGTAGGAGAAGGAGTTTGG + Intronic
963136084 3:141905660-141905682 GAGATGAAGGAAAAGTAGCATGG - Intronic
963559906 3:146851307-146851329 AAGATGAAGGAAAAGGAGAAAGG + Intergenic
963707003 3:148699478-148699500 GAGAGGAAGGAGAAGGTACCAGG - Intronic
964878403 3:161395789-161395811 GAAAACAAGGAGAAGGAGCCAGG + Intergenic
965761166 3:172078497-172078519 CAGAAGAAGGTAGAGGAGCCAGG + Intronic
966246594 3:177815227-177815249 CAGAAGAAGAAGATGGAACCAGG - Intergenic
966680295 3:182634818-182634840 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
966921858 3:184617282-184617304 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
966954738 3:184864120-184864142 AAGAGGAAGGAGAAGGAGAAGGG + Intronic
967079667 3:186037825-186037847 CTGATGAAAGAGAAGGAGGTGGG - Intergenic
967121328 3:186385252-186385274 GAGATGAAGGAGGAGGTGCAAGG + Intergenic
967389665 3:188943223-188943245 CAGATCCAGGTGCAGGAGCCAGG - Intergenic
967468635 3:189837177-189837199 CAGAGGAAGTAGCAGGAGACAGG - Intronic
968076318 3:195817564-195817586 CTGCTTAAGGAGAAGGAGGCCGG - Intergenic
968359923 3:198139670-198139692 GAGGTGAAGGAGGAGGAGTCGGG + Intergenic
969313191 4:6366303-6366325 AAAGTGCAGGAGAAGGAGCCCGG - Intronic
969375920 4:6763092-6763114 CTCATCCAGGAGAAGGAGCCAGG - Intergenic
969939903 4:10721732-10721754 CAGGAGAGGGAGAAGGAGCACGG + Intergenic
970193206 4:13534012-13534034 TAGATGAAGCTGAAGGATCCTGG + Intergenic
970209541 4:13694533-13694555 CAGATGATGTAGAATGTGCCAGG - Intergenic
970275202 4:14392171-14392193 CTGAAGAAGGAGCAGGGGCCAGG - Intergenic
970433874 4:16014339-16014361 CAGATGAATGTCAAGGAGTCAGG - Intronic
970661572 4:18291566-18291588 GAGAAGAAGGAAAAGCAGCCAGG + Intergenic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971001951 4:22333150-22333172 AAGGTGAAGGAGAAGCAGGCAGG - Intergenic
971364879 4:25969654-25969676 CATATGAAGGAATAGGAGACAGG - Intergenic
971863194 4:32136224-32136246 CTGAAGGATGAGAAGGAGCCAGG + Intergenic
974273342 4:59681068-59681090 GAGCTGAAGGAGAAGGAACTGGG + Intergenic
974611571 4:64224811-64224833 CACATGTCGGGGAAGGAGCCTGG - Intergenic
976163125 4:82225054-82225076 CAGATGAAGGAGCAGTGGTCTGG - Intergenic
976532965 4:86176968-86176990 CAGATGTAGAAGAAAGAGTCAGG + Intronic
977252626 4:94705604-94705626 TGGCTGAAGGAGAAGGTGCCAGG + Intergenic
979832532 4:125318500-125318522 CACATTAAGGAGAATGAGCCTGG + Exonic
980238240 4:130136461-130136483 CAGATGTAGGAGAATGAAACTGG + Intergenic
980613303 4:135185401-135185423 CATAGGCAGGGGAAGGAGCCTGG - Intergenic
983523389 4:168734761-168734783 GAGAAGGAGGAGGAGGAGCCAGG + Intronic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
985054006 4:186020320-186020342 TGGCTGAAGGAGAATGAGCCAGG + Intergenic
985559045 5:572815-572837 CAGCTGAAGGAGAACGACCTTGG + Intergenic
985622393 5:962453-962475 CAGATGCCAGGGAAGGAGCCTGG + Intergenic
985648509 5:1096620-1096642 AAGATGAAGGACCAGGAGCCTGG + Intronic
985690137 5:1304322-1304344 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
985788375 5:1911724-1911746 TAGATGGAGGAGGATGAGCCTGG + Intergenic
986014361 5:3744963-3744985 CAGATGATGGAGAACCAGCTCGG - Intergenic
986417902 5:7546834-7546856 CCAAGGAAGAAGAAGGAGCCAGG - Intronic
987109559 5:14672512-14672534 CACAGGAAGGAGGAGGTGCCAGG - Intronic
987546385 5:19315366-19315388 GAAATAAAGAAGAAGGAGCCAGG + Intergenic
987862995 5:23508873-23508895 CAGATGGAGAAGACAGAGCCTGG + Intronic
988134753 5:27156856-27156878 CACATGATGGAGAAGCAGCCTGG + Intergenic
988424053 5:31041941-31041963 CACATGTAGGAGAATGAACCTGG + Intergenic
988632077 5:32942324-32942346 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
989075342 5:37559424-37559446 GAGATGAAGGAGGAGGAGAATGG - Intronic
989552967 5:42757223-42757245 AGGATGACGGAGAGGGAGCCAGG + Intronic
990047050 5:51445367-51445389 GAGAGGAAGGGGAAGGAGCTGGG + Intergenic
990056144 5:51581176-51581198 CAAATGTAGGAGAATGAACCAGG + Intergenic
990252253 5:53927919-53927941 CAGATGAGGAAGATGAAGCCCGG - Intronic
993015814 5:82533291-82533313 CACATGAAGGAGCATGAGCATGG + Intergenic
995857012 5:116603954-116603976 CAGATGAAGTCCAAGGAGACTGG - Intergenic
996613304 5:125410353-125410375 AAAATGAAACAGAAGGAGCCAGG + Intergenic
997409593 5:133680968-133680990 CACATGATGGAGAAGGACTCTGG - Intergenic
997492969 5:134294648-134294670 AAGATGAAGGAGAAGAAGAAAGG + Intronic
998017263 5:138742302-138742324 CTCAGGAATGAGAAGGAGCCAGG + Intronic
998165804 5:139842881-139842903 CAGAGGAAGGAGGAGGAGAAAGG - Exonic
998791186 5:145767428-145767450 TGGATGCAGGACAAGGAGCCGGG + Intronic
999089170 5:148920563-148920585 CAGATGGAAGAGAGGGAGCCAGG + Intergenic
1000097375 5:157983900-157983922 GAGAGGAAGGAGAAGGAACAGGG + Intergenic
1000278745 5:159763872-159763894 CAGGTGAAGTAGCAGGGGCCAGG - Intergenic
1000334020 5:160228673-160228695 CACCTGGAGGAGAAGGTGCCAGG - Intronic
1000528562 5:162389204-162389226 CAGATGGAGGCAAAGGATCCAGG - Intergenic
1000556481 5:162732558-162732580 CAGATAAAGGAGAGGGCCCCTGG - Intergenic
1001125314 5:169013738-169013760 GACCTGAAGGAGTAGGAGCCAGG - Intronic
1001758120 5:174186301-174186323 CAGAGGGAGCAGGAGGAGCCGGG - Intronic
1001890973 5:175338239-175338261 AAGAAGAAGAAGAAGGAGACAGG - Intergenic
1002167249 5:177355853-177355875 CAGCTGAAGGAGAAAGAGGGAGG + Intergenic
1002971102 6:2021041-2021063 CAAATGCAGGAGAAGCAGCTGGG - Intronic
1003231056 6:4254167-4254189 CAGATGTGGCTGAAGGAGCCTGG + Intergenic
1003269659 6:4596449-4596471 CACATGTAGGAGAAGGAAACTGG - Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003567914 6:7236163-7236185 CAGGTGGAGGAGAGGGTGCCAGG + Intronic
1003990270 6:11479976-11479998 CAGATTAAGAAGCAGTAGCCAGG + Intergenic
1004171608 6:13299692-13299714 CAGGTGGAGGGGAAGGAGCTGGG + Intronic
1004389480 6:15198059-15198081 CAGAAGAAGGAGAAGGGGCATGG + Intergenic
1005211641 6:23472245-23472267 CAGGTGAAGTAGAAGGAGTATGG + Intergenic
1005862234 6:29910731-29910753 GAGATGAGGGAGGAGGAGCAGGG - Intergenic
1006084550 6:31586861-31586883 ATGATGGAGGGGAAGGAGCCTGG - Intronic
1006153865 6:32003677-32003699 CTGAAGACTGAGAAGGAGCCAGG + Intergenic
1006160173 6:32036414-32036436 CTGAAGACTGAGAAGGAGCCAGG + Intergenic
1006189823 6:32201044-32201066 CAGAGGGAGGAAAGGGAGCCAGG - Intronic
1006191662 6:32213195-32213217 CAGAGGCAGGAGAAGGTGCCAGG + Exonic
1006192745 6:32219714-32219736 CAGAGGCAGTTGAAGGAGCCAGG + Exonic
1007577115 6:42932390-42932412 CAGAGGAAGGAGAACCTGCCCGG + Intronic
1007659808 6:43477197-43477219 CTGATGAAGGTGGAAGAGCCTGG + Intergenic
1007880634 6:45162232-45162254 AAGAAGAAGAAGAAAGAGCCAGG + Intronic
1008023556 6:46607987-46608009 CACATGAAGGAGAATGAACTTGG + Intronic
1008707822 6:54184492-54184514 TAGATGATGGATAAGGAGCTTGG + Intronic
1010011487 6:71052245-71052267 CTAATAAAGGAAAAGGAGCCAGG + Intergenic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1011110009 6:83827440-83827462 CATAGGAAGGAGAAGCTGCCAGG + Intergenic
1011666436 6:89638975-89638997 CAAATGAAAGTGAAGGAGGCCGG + Intergenic
1011967722 6:93180214-93180236 CAGCTGAAAGAGAAGGAGAAAGG - Intergenic
1012437918 6:99234776-99234798 CAGCTGAAGGAGCAGGAGAAGGG - Intergenic
1012599698 6:101079867-101079889 CAGATGAGGGTGAAGGAGAGTGG - Intergenic
1012986675 6:105883550-105883572 CAGATGCAGCTGAAGGTGCCGGG + Intergenic
1013437570 6:110126831-110126853 CAGATTAGGGAGAAGGAGACAGG - Intronic
1013803324 6:113970932-113970954 CAGCAGCAGGAGGAGGAGCCCGG - Exonic
1013932931 6:115556627-115556649 GAGATGAAGGAGCATGTGCCAGG - Intergenic
1014320853 6:119926334-119926356 CAGTTCAAGGACAGGGAGCCTGG - Intergenic
1014544895 6:122723072-122723094 AAGCTGAAGGAGGAGCAGCCAGG - Intronic
1014677137 6:124380486-124380508 CAGTTGAAGGAGACAGATCCTGG - Intronic
1015054491 6:128883259-128883281 CAGCAGAAGGAGGAGGACCCCGG - Exonic
1015939167 6:138431542-138431564 CAGGAGGAGGAGGAGGAGCCGGG + Exonic
1016794118 6:148099645-148099667 AAGAAGAAGAAGAAGAAGCCTGG - Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017056678 6:150443096-150443118 TAGATGAAGGGGAAGGAGTACGG - Intergenic
1017339571 6:153305207-153305229 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017339585 6:153305255-153305277 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017339626 6:153305405-153305427 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017988542 6:159466182-159466204 AAGAAGAAGAAGAAGAAGCCGGG - Intergenic
1018010060 6:159661377-159661399 CACATGAAGGAGAATGAAACTGG + Intergenic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1018468839 6:164079227-164079249 AGGATGAAGGGGAAGCAGCCAGG + Intergenic
1018648966 6:165975050-165975072 TGGAGGCAGGAGAAGGAGCCCGG + Intronic
1018903146 6:168061110-168061132 CTGATGCAGGAGGAAGAGCCCGG + Intronic
1018964577 6:168474444-168474466 CAGACGCAGGAGCTGGAGCCTGG - Intronic
1019133033 6:169891154-169891176 AAGATGAAGGACAAGGAGGGTGG + Intergenic
1019260060 7:76952-76974 GAGGTGAAGGAGGAGGAGTCGGG - Intergenic
1019603513 7:1897140-1897162 CAGAAGGAGGAGGAAGAGCCGGG + Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020094453 7:5360883-5360905 CTGAGGAAGCAGAAGGAGCGTGG - Intronic
1021962984 7:25891179-25891201 CAAATGAAGGACAAGGAGAATGG - Intergenic
1022483155 7:30757388-30757410 CAGATGGACAGGAAGGAGCCAGG + Exonic
1022800969 7:33776941-33776963 CAGATGAAGCAGATGGTGCCAGG + Intergenic
1023039551 7:36160405-36160427 CTGATGGATGAGAAGAAGCCAGG + Intronic
1023544387 7:41302408-41302430 CACATGTAGGAGAATGAGACTGG + Intergenic
1023632587 7:42178929-42178951 AAGAGGAAGAAGAAAGAGCCAGG + Intronic
1023658201 7:42447397-42447419 CAGAAGGAGGAGAAAGATCCTGG - Intergenic
1024195577 7:47055395-47055417 AAGATGAAGGAGTAGGAGAAGGG - Intergenic
1024222106 7:47297183-47297205 ATGTTGAAGGACAAGGAGCCGGG - Exonic
1024919304 7:54541706-54541728 AAGATGAAGGAAAAGAAGGCAGG + Intergenic
1025232524 7:57212005-57212027 CTGAGGAAAGAGGAGGAGCCAGG - Intergenic
1025665454 7:63580766-63580788 CCGAGAAAGGAGAAGCAGCCGGG + Intergenic
1026530910 7:71196433-71196455 CAGAAGCAGAAGAAGGGGCCAGG - Intronic
1027201889 7:76069201-76069223 CAGATGATGATGAAGGGGCCTGG + Intergenic
1027851009 7:83451970-83451992 CAGAAGAAGGAGAACGAGTGTGG - Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028261366 7:88670328-88670350 AGGAAGAAGGAAAAGGAGCCTGG - Intergenic
1028923237 7:96329471-96329493 AAGAAGAAGGAGCAGCAGCCAGG + Intergenic
1030766462 7:113416214-113416236 CAAATGAAGAAGAAAGAGCAGGG + Intergenic
1031209044 7:118798578-118798600 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1031270361 7:119641695-119641717 CAGAAGAAGCAGCAGGAGCAGGG - Intergenic
1031412867 7:121460972-121460994 CAGAAGAAAAAGAAGGAGCAGGG - Intergenic
1032019640 7:128400216-128400238 CAGGTGAGAGAGAAGGAGCCAGG + Intronic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032825372 7:135563125-135563147 GATATGAAGGAGAGGTAGCCAGG - Intronic
1033815783 7:145070874-145070896 CACATGTTGAAGAAGGAGCCCGG + Intergenic
1033890439 7:146006416-146006438 CAGGGGGAGGAGAAGGAGCAGGG - Intergenic
1034113642 7:148562980-148563002 CAGATGTTGGAGGAGGGGCCTGG - Intergenic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1034865079 7:154634672-154634694 GAGACGAAGGAGAAGGAGAAGGG - Intronic
1035529741 8:341747-341769 CAGACCAAGGAGAAGAATCCAGG + Intergenic
1035670373 8:1412342-1412364 GAGATGGAGGAGAAAGAGCCCGG - Intergenic
1036180365 8:6579293-6579315 CAAATGGAGGAGAAGGGGACCGG - Intronic
1036419960 8:8586295-8586317 CAGCTGGAGGCGCAGGAGCCAGG - Intergenic
1036620441 8:10421710-10421732 CAGATGCACGAAAAGCAGCCGGG - Intronic
1037077444 8:14738320-14738342 ATGATGAAGGAGAGGGAACCAGG - Intronic
1037737902 8:21581649-21581671 CAGGTGGAGGAGACGGAGGCTGG + Intergenic
1037809812 8:22080723-22080745 CTGGTGAAGAAGAAGAAGCCGGG + Intronic
1037944966 8:22983356-22983378 AAGAAGAAGAAGAAGGAGCAAGG + Intronic
1039220971 8:35330367-35330389 CAGATGAAGAAAATGGAGTCTGG - Intronic
1039805491 8:40994224-40994246 AAGAAGAAGAAGAAGGAACCGGG - Intergenic
1040711343 8:50192846-50192868 CACATGTAGGAGAAGGAAACTGG - Intronic
1041051627 8:53940096-53940118 GCGATGAAGTAGAGGGAGCCTGG + Intronic
1041112350 8:54495746-54495768 CACATGAAGGAGAATGAAACTGG - Intergenic
1041277706 8:56179991-56180013 CAGAGGCAGAATAAGGAGCCAGG + Intronic
1041380190 8:57246674-57246696 CAGTTGAAGGTGAAGGAGGTGGG + Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042391541 8:68241330-68241352 CAGATTAGGGAGAAGGAGACAGG + Intergenic
1044161380 8:88920577-88920599 CATATGTTGGAGAAGGGGCCTGG + Intergenic
1044973003 8:97638188-97638210 CAGTGGAAGGAGAAGGAACTAGG + Intergenic
1045015596 8:97998997-97999019 GAGATGGAGGAGGAGGAGCTGGG - Intronic
1045488734 8:102654488-102654510 CAGATGCGGGAGGAGGAGCCAGG + Intronic
1045698086 8:104833986-104834008 CAGCAGAAGGAGAAGGAACATGG - Intronic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046058545 8:109108259-109108281 CAAATGATGGAGAAGGAGAGAGG - Intronic
1046481776 8:114829245-114829267 CAAATGAGGGAGAAGGAGTAGGG + Intergenic
1047222276 8:122928130-122928152 GAGATGGAGGAGATGGAGCCTGG - Intronic
1048175532 8:132149190-132149212 CAGATGAGGGGGAAGGTCCCAGG + Intronic
1048410643 8:134168841-134168863 CAGTTGAAGGATAAGGAGGGTGG + Intergenic
1048609594 8:136007767-136007789 GAGATGAAGCTGATGGAGCCAGG - Intergenic
1048928268 8:139290315-139290337 CAGGTGAGAGGGAAGGAGCCTGG + Intergenic
1049334198 8:142073937-142073959 CCGATGTTGGAGAAGGGGCCTGG - Intergenic
1049343827 8:142128037-142128059 CACAGGAAGGAGGAGCAGCCTGG - Intergenic
1049439259 8:142601770-142601792 CAGACGAACTAGCAGGAGCCCGG + Intergenic
1049884010 9:15908-15930 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
1050856350 9:10361850-10361872 GAGATTAAGGAGAAAGAGCATGG + Intronic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1052681721 9:31701461-31701483 TAGCTGATGGAGAACGAGCCAGG - Intergenic
1053158975 9:35800481-35800503 CAGGTGATGGAGGAGGAGGCAGG + Exonic
1053310987 9:37019568-37019590 CAGATGAAAGGGAAGGAGCCAGG + Intronic
1053316453 9:37055983-37056005 GACTTGAAGGAGAAGGAGCTGGG - Intergenic
1053432577 9:38052800-38052822 TAGATGATGGAGGAGAAGCCAGG - Intronic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056575955 9:87856321-87856343 CAGAGGTAGGAGGAGGAGCTGGG + Intergenic
1056779585 9:89539175-89539197 CAGAGCAAGGAGAGGCAGCCAGG - Intergenic
1057132787 9:92666344-92666366 AAGCTGAAGGCGAAGGAGGCAGG + Intronic
1057414331 9:94847800-94847822 CAGATGAAGGAGGAGAGTCCAGG + Intronic
1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG + Intergenic
1058976237 9:110127673-110127695 GACAGGAAGGAGAAGGAGCTGGG - Intronic
1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG + Intronic
1059421743 9:114196533-114196555 CAGAAGCAGGAGTAGGACCCAGG - Intronic
1060200404 9:121649044-121649066 AGGAAGAAGGAAAAGGAGCCTGG + Intronic
1060600057 9:124871231-124871253 CAGATGGAGTAGAAGGAACCCGG + Intronic
1060625852 9:125110651-125110673 AAGGTGAAGGAGAAGCAGGCAGG - Intronic
1060799916 9:126537277-126537299 CAGATGACGGCCGAGGAGCCCGG - Intergenic
1061412139 9:130427553-130427575 CAGGTGCAGGAGAAGCGGCCGGG - Exonic
1061702999 9:132430073-132430095 GAGATGAAGGCCACGGAGCCAGG - Intronic
1061937932 9:133868482-133868504 TAGGTGAATGAGACGGAGCCTGG + Intronic
1062406923 9:136401006-136401028 CAGATGGAGGGGATGGAACCAGG + Intergenic
1062457661 9:136647038-136647060 CAGATGCCGGAGGAGCAGCCAGG - Intergenic
1062512471 9:136914351-136914373 AAGCTGAAGGAGAAGAGGCCAGG - Intronic
1062744627 9:138203490-138203512 GAGGTGAAGGAGGAGGAGTCGGG + Intergenic
1185449551 X:275204-275226 GAGAGGATGGAGAAGGAGCAGGG + Intergenic
1185748317 X:2589785-2589807 CAGATCCAGGAGACAGAGCCAGG - Intergenic
1186646893 X:11516846-11516868 GAGATGACAGAGAAGGAGGCTGG - Intronic
1186731969 X:12419843-12419865 GAGATAAAGGAGGAGGAGCCAGG - Intronic
1187072872 X:15905660-15905682 CAGATAAAGGAGAAAAAGGCTGG - Intergenic
1187303398 X:18073470-18073492 CACATGAAGGAGAGGGAGAGAGG - Intergenic
1187696680 X:21929520-21929542 CAGGGGAAGGAGTAGGAGCCAGG + Intergenic
1188128778 X:26404189-26404211 ATGATAAAGGAGAAGGAGCAAGG + Intergenic
1188179312 X:27034536-27034558 CTTATGCAGGAGATGGAGCCTGG - Intergenic
1188841702 X:35025030-35025052 GAGCAGAAGGAGAAGCAGCCAGG + Intergenic
1188988440 X:36788996-36789018 GAGCAGAAGGAGAAGCAGCCAGG - Intergenic
1189248366 X:39580876-39580898 CAGCTGAAGGGAAAGGAGTCTGG - Intergenic
1189578490 X:42381143-42381165 GAAATGAAGGAGAAGGAAGCAGG + Intergenic
1189657078 X:43255739-43255761 CCAATGAAAGAGAAGGGGCCAGG - Intergenic
1189684395 X:43548808-43548830 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1190049047 X:47135765-47135787 CAGTTGAAGGCGCAGGACCCAGG - Intergenic
1190224941 X:48538107-48538129 CAGTTGAAAGAGAAGTGGCCAGG - Intergenic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1190877260 X:54468787-54468809 CTGATCCAGGAGATGGAGCCTGG + Exonic
1191709982 X:64139444-64139466 CTGAAGGAGGAGAAAGAGCCAGG - Intergenic
1191742153 X:64447640-64447662 CAGATGAAGTAGAAGCGGCAGGG - Intergenic
1192591569 X:72364259-72364281 CAGATGAAAGAAGAGGATCCAGG - Intronic
1193439717 X:81524584-81524606 CAAATGTTGGAGGAGGAGCCTGG - Intergenic
1194091401 X:89584312-89584334 CAGCCTAAGGAGATGGAGCCCGG + Intergenic
1195247956 X:103013513-103013535 CAGATGTAGAAGAGGGAGTCAGG - Intergenic
1195325095 X:103752012-103752034 CAGATGTAGAGAAAGGAGCCAGG - Intergenic
1195614655 X:106902891-106902913 AAGCTGAAGGTGAAGCAGCCAGG - Intronic
1195696878 X:107674007-107674029 CAGAGGAAGGGGAAGGGGCGGGG + Intergenic
1195815421 X:108879486-108879508 CACATGTTGGAGGAGGAGCCTGG - Intergenic
1196171938 X:112598268-112598290 CATATGTAGGAGAAGGAAACTGG + Intergenic
1196882230 X:120208776-120208798 CAGATGGACAAGAGGGAGCCAGG + Intergenic
1197645152 X:129009495-129009517 CAGATTTAGGAGAAGGGGACTGG - Intergenic
1197656545 X:129122804-129122826 CAGTTGAAGGAAAAAGTGCCAGG - Intergenic
1198281764 X:135149629-135149651 CAGATGAAGGAGGAAGTGCTTGG - Intergenic
1198289195 X:135222893-135222915 CAGATGAAGGAGGAAGTGCTTGG + Intergenic
1198452036 X:136776485-136776507 CACATGTAGGAGAATGAACCTGG + Intronic
1199065595 X:143413687-143413709 CACATGTAGGAGAAGGAAACTGG - Intergenic
1199235607 X:145488803-145488825 CAGGTGAGGGAGAATGAGCAAGG + Intergenic
1199286480 X:146060007-146060029 CAAGTGAATGAAAAGGAGCCTGG - Intergenic
1200085103 X:153600169-153600191 CTGAGGAAGGAGAATGAGGCCGG - Intergenic
1200243837 X:154512276-154512298 AAGAAGAAGAAGAAGAAGCCGGG + Intronic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200686456 Y:6263948-6263970 CAGATCAAGGAGAAAGAGGATGG + Intergenic