ID: 1121050155

View in Genome Browser
Species Human (GRCh38)
Location 14:90815190-90815212
Sequence CACCGTGGCCAGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 339}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121050155_1121050163 2 Left 1121050155 14:90815190-90815212 CCCTCTGCCCTCTGGCCACGGTG 0: 1
1: 0
2: 2
3: 35
4: 339
Right 1121050163 14:90815215-90815237 CTGGTGCCTGCGCTTTAGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 76
1121050155_1121050162 1 Left 1121050155 14:90815190-90815212 CCCTCTGCCCTCTGGCCACGGTG 0: 1
1: 0
2: 2
3: 35
4: 339
Right 1121050162 14:90815214-90815236 GCTGGTGCCTGCGCTTTAGGCGG 0: 1
1: 0
2: 1
3: 9
4: 139
1121050155_1121050161 -2 Left 1121050155 14:90815190-90815212 CCCTCTGCCCTCTGGCCACGGTG 0: 1
1: 0
2: 2
3: 35
4: 339
Right 1121050161 14:90815211-90815233 TGTGCTGGTGCCTGCGCTTTAGG 0: 1
1: 0
2: 0
3: 15
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121050155 Original CRISPR CACCGTGGCCAGAGGGCAGA GGG (reversed) Intronic
900760456 1:4466977-4466999 CACTGTGTCCAGGGGGCAGTGGG - Intergenic
900874448 1:5331436-5331458 TGCAGTGGCCAGAGGGCAGGTGG + Intergenic
901022094 1:6260791-6260813 CGCCCTGGCCCGAGGGCGGACGG - Intronic
903174513 1:21572945-21572967 CACTGTGGCCCCAAGGCAGAGGG - Intronic
903531375 1:24032861-24032883 GACCGTGGAAAGAGGGGAGAGGG + Intergenic
903646526 1:24899334-24899356 CACCCTGGCCACAGGACAGCCGG - Intergenic
903687194 1:25140451-25140473 CCCCATGGACAGAGGGCAGGAGG + Intergenic
903888396 1:26554500-26554522 CCCCGTGCCCAGAGGCCAGAAGG - Intronic
904054036 1:27658691-27658713 CAACGTGGGCAGAGGGAAGGAGG + Intergenic
904767995 1:32864923-32864945 AACAGGAGCCAGAGGGCAGAGGG - Intronic
905202679 1:36324441-36324463 CCCCGTGGAGACAGGGCAGAAGG - Intronic
905408817 1:37754300-37754322 CACCGTGCCCAGAGCACAGCCGG - Exonic
906065407 1:42977009-42977031 CACTGGGGCCAGATTGCAGAGGG + Intergenic
907495597 1:54842136-54842158 CATGGGGGCCAGAGAGCAGATGG + Exonic
907525272 1:55050264-55050286 CAAGGTGGGCAGAGGCCAGATGG - Intronic
911054506 1:93698567-93698589 CTCCGTGGCCAGAGGAGAGAAGG + Intronic
912304849 1:108557003-108557025 AACCAAGGCCAGAGGGTAGAGGG - Intergenic
912679892 1:111722328-111722350 CAGGGTGGCCGGAGGGCAGGAGG + Exonic
912941111 1:114045655-114045677 CACCGAGGCCAGAGGGAAAGCGG + Intergenic
913698240 1:121348337-121348359 CACCCTGGCCACAGTGCAGATGG - Intronic
914139309 1:144931715-144931737 CACCCTGGCCACAGTGCAGATGG + Intronic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
918193371 1:182198134-182198156 CTCCTTGTCCTGAGGGCAGAGGG + Intergenic
919625438 1:199905398-199905420 GACCGTGGGGAGAGGGGAGAGGG + Intergenic
919926062 1:202192469-202192491 GACCGTGGAAAGAGGGGAGAGGG + Intergenic
920485639 1:206366993-206367015 CACCCTGGCCACAGTGCAGATGG - Intronic
920855660 1:209659125-209659147 CACAGAGGACAGAGGACAGAGGG + Intergenic
921177489 1:212607558-212607580 CACCCTGGCTTGAGGGCAGAGGG + Intronic
923943580 1:238857026-238857048 CACCTTTGCTACAGGGCAGATGG + Intergenic
924606987 1:245543536-245543558 CCACGTGGCCACTGGGCAGATGG - Intronic
1063744773 10:8868392-8868414 GACCGTGGAAAGAGGGGAGAGGG - Intergenic
1065178808 10:23104731-23104753 TACCGTGTCAAGAGGGAAGATGG - Intronic
1065198759 10:23293475-23293497 CAGTGTGGGCAGATGGCAGAAGG - Intronic
1066069480 10:31792220-31792242 CACTGGGGCCTGAGGGTAGAGGG - Intergenic
1069751282 10:70746837-70746859 CCCGGTGGCAAGTGGGCAGAAGG + Intronic
1069856201 10:71442589-71442611 CATTGAGGCCAGAGGGGAGAAGG - Intronic
1069983856 10:72270783-72270805 CACCTTGGCCTGAGGGGAGGAGG + Intergenic
1070534159 10:77362565-77362587 CACAGTGCCCAGAGGACAGCAGG + Intronic
1072715646 10:97750779-97750801 CACCCAGGCTAGAGGGCAGTGGG + Intronic
1072758730 10:98038539-98038561 CAGGGAGGCCAGAGGTCAGAGGG + Intergenic
1074152312 10:110768213-110768235 GACCGTGGAAAGAGGGGAGAGGG + Intronic
1074694942 10:116041978-116042000 CACCATGGCAAGGGGGCAGTTGG - Intergenic
1074697703 10:116065414-116065436 CACCTTGCTCAAAGGGCAGACGG + Intronic
1075702489 10:124478357-124478379 TACCGGGGCTAGAGGGCAGGGGG + Intronic
1076594485 10:131617444-131617466 GAAGGTGGGCAGAGGGCAGAAGG + Intergenic
1076740068 10:132478525-132478547 CCCCGGGCCCAGAGGGCAGAGGG - Intergenic
1076801810 10:132834441-132834463 GACCGTGGGCAGTGGGCAGTGGG + Intronic
1077317949 11:1927623-1927645 CACTGAGGCCAGCGGACAGACGG + Intronic
1077445757 11:2589939-2589961 ATCCGTGGCCAGTGGGCAGGAGG - Intronic
1077900833 11:6487104-6487126 CAGTGTGGCCAGAGCACAGAGGG - Intronic
1079372177 11:19861014-19861036 GACGGTGGAAAGAGGGCAGAGGG + Intronic
1081097936 11:38963719-38963741 CACCCAGGCTGGAGGGCAGAGGG + Intergenic
1081869112 11:46375298-46375320 ACCCCTGGCCAGAGGGCAGAGGG - Intronic
1083397662 11:62402446-62402468 CGCTGTGGGCAGAGGGAAGAGGG - Intergenic
1084315624 11:68343728-68343750 CACTGAGGCCTGAGGGCAGGAGG - Intronic
1085520475 11:77136215-77136237 CACGGCGGCCAGAGGGCAGTAGG - Intronic
1085563020 11:77489436-77489458 GACCGTGGGGAGAGGGGAGAGGG - Intergenic
1085969741 11:81573477-81573499 TACTGGGGCCAGAGGGAAGATGG + Intergenic
1088116454 11:106318274-106318296 CACCGTGGGGAGAGGGGAGAGGG + Intergenic
1088536354 11:110866370-110866392 CACCTGGGCCAGTGGGCACAGGG + Intergenic
1088627669 11:111742969-111742991 AACCTTGGGCAGGGGGCAGAGGG - Intronic
1088865699 11:113845612-113845634 CACCAGGGCTAGAGGGCAGTAGG + Intronic
1089403650 11:118180217-118180239 CAGAGTTGCCAGAAGGCAGAAGG + Intergenic
1091586027 12:1817471-1817493 GACCGTGGGGAGAGGGGAGAGGG - Intronic
1092111285 12:5966594-5966616 CACAGTGGCCAGAGGGGAGGGGG - Intronic
1095710205 12:45280112-45280134 CATCCTTGCCAGAGGGCAAAAGG - Intronic
1095974340 12:47929023-47929045 CAGCGTGGCCAGTAGGGAGAGGG + Intronic
1096082224 12:48841448-48841470 GACCGTGGGGAGAGGGGAGAGGG - Intronic
1096603804 12:52750065-52750087 CACCGTTGCCAGAAGGCAGATGG - Intergenic
1097141746 12:56908334-56908356 CATCCTGGCCCGAGGGCAGCGGG - Intergenic
1098844311 12:75517174-75517196 CACGGTAACCAGAGGGTAGAGGG + Intergenic
1101820904 12:108183721-108183743 CCCCGAGGTCAGAGGTCAGAGGG + Intronic
1102573284 12:113840627-113840649 GGCCGTGGCCGGAGAGCAGACGG + Intronic
1102774697 12:115508327-115508349 CTCAGTGACGAGAGGGCAGAGGG - Intergenic
1103188733 12:118982324-118982346 CACAGAGTCCAGAGGGCAGGTGG + Intronic
1103723703 12:122987714-122987736 CACCCCGGCCAGAGGGCAGCAGG + Intronic
1104642736 12:130477880-130477902 CCCTGTGGCCAGAGTGCAGCTGG - Intronic
1104772910 12:131375446-131375468 CACTGTGCCCAGAAGGAAGATGG - Intergenic
1104939255 12:132387193-132387215 CACCGTGGACAGAAGGCATGTGG + Intergenic
1107492938 13:40899761-40899783 GACCGTGGAAAGAGGGGAGAGGG - Intergenic
1108351144 13:49592164-49592186 GACCGTGGGGAGAGGGGAGAGGG - Intergenic
1108610349 13:52079312-52079334 GACCGTGGAAAGAGGGGAGAGGG - Intronic
1112756962 13:102646691-102646713 CACCATCACCAGAAGGCAGATGG - Intronic
1113138147 13:107116839-107116861 CAGGGTGGGCAGAAGGCAGAGGG + Intergenic
1113479168 13:110607294-110607316 GACCGTGGGGAGAGGGGAGAGGG + Intergenic
1113495769 13:110727747-110727769 CACCGTGGCCAAGGGGTAGATGG + Intergenic
1113737610 13:112689849-112689871 CCCTGGGGGCAGAGGGCAGAGGG - Intergenic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1114507723 14:23231627-23231649 GACCGTGGGGAGAGGGGAGAGGG - Intronic
1114643382 14:24239847-24239869 CACCGTGGCCAGAAGGGGGTAGG + Exonic
1114664312 14:24369065-24369087 AACCGTGGCCAGAGGGGAGGGGG - Intronic
1115536655 14:34379539-34379561 CACTGTGGCCAGAGCTCAGGAGG + Intronic
1117329346 14:54697100-54697122 CACAGAGGCCAGTGGGCAGTTGG + Intronic
1118026253 14:61772135-61772157 CACCGTGGCTGGAGCGCAGTAGG + Intronic
1118410384 14:65471176-65471198 CACAGTTGGTAGAGGGCAGAGGG - Intronic
1118455806 14:65945068-65945090 CACCCTAGCCAGTGGGCGGAAGG - Intergenic
1120194448 14:81466929-81466951 GAGCTTGGGCAGAGGGCAGAGGG + Intergenic
1120701400 14:87703261-87703283 CACTGTGGACAGAGGACTGAAGG - Intergenic
1121005376 14:90487323-90487345 GACCCTGCCCAGTGGGCAGAGGG + Intergenic
1121050155 14:90815190-90815212 CACCGTGGCCAGAGGGCAGAGGG - Intronic
1121531422 14:94657436-94657458 GACCGTGGAAAGAGGGGAGAGGG - Intergenic
1122048803 14:99041433-99041455 CAGTCTGGCCAGAGTGCAGAGGG - Intergenic
1122238036 14:100344070-100344092 GACCGTGGGGAGAGGGAAGAGGG - Intronic
1124973043 15:34508644-34508666 CACCCAGGCCAGAGTGCAGTAGG - Intergenic
1128145589 15:65330837-65330859 GCCCTTGGCCAGAGGCCAGAGGG - Intronic
1128587341 15:68861077-68861099 GACCGTGGAAAGAGGGGAGAGGG + Intronic
1129008559 15:72395812-72395834 GACCGTGGAAAGAGGGGAGAGGG - Intergenic
1129008568 15:72395842-72395864 GACCGTGGAAAGAGGGGAGAGGG - Intergenic
1129162994 15:73757651-73757673 CTCCATGGCCACAGGGCAGCAGG - Intergenic
1133241266 16:4416002-4416024 CGCCGGGGCCAGAGGAGAGAGGG + Intronic
1134063439 16:11212381-11212403 CGCACTGCCCAGAGGGCAGAAGG + Intergenic
1134082938 16:11336686-11336708 GACCGTGGAAAGAGGGAAGAGGG + Intronic
1134414295 16:14030326-14030348 CAGTGTGGTTAGAGGGCAGAGGG - Intergenic
1134909306 16:18009657-18009679 CAACATGGCCAGAGGGCTGGAGG - Intergenic
1136547998 16:30966082-30966104 CACAGGGGCAGGAGGGCAGAGGG + Exonic
1137031770 16:35531403-35531425 GCCCGTGGGCAGAGGGCAGGAGG - Intergenic
1138549557 16:57740126-57740148 GACAGTGTCCAGAGGACAGAAGG + Intronic
1139390951 16:66605835-66605857 CACTCAGGGCAGAGGGCAGAAGG + Intronic
1139597421 16:67966585-67966607 CACCTTGGCCTGTGGGCAGGGGG - Intronic
1140196389 16:72859045-72859067 CACAGAAGCCAGAGGGCAGAGGG - Intronic
1140257035 16:73346324-73346346 CATGGTGGCGAGAGGACAGACGG - Intergenic
1141015645 16:80446749-80446771 GATAGTGGCCAGATGGCAGAGGG - Intergenic
1141592852 16:85080096-85080118 CCCAGAGGGCAGAGGGCAGAGGG + Intronic
1142120451 16:88383996-88384018 CACCCTGGGCCGAGGGCAGAGGG + Intergenic
1142638154 17:1270497-1270519 GGCAGTGGGCAGAGGGCAGAGGG + Intergenic
1142730535 17:1852525-1852547 CAGGAAGGCCAGAGGGCAGAGGG + Intronic
1142899624 17:3004044-3004066 CACCTGGGACAGAGGCCAGAGGG - Intronic
1143367033 17:6415143-6415165 CTCCCTGGCCAGAGGGCACTAGG + Intronic
1143887431 17:10075752-10075774 CACCCAGGCCAGAGTGCAGGGGG - Intronic
1144201624 17:12947356-12947378 CCCTGTGGTCAGAGGCCAGAGGG - Intronic
1148134527 17:45283805-45283827 CACCCTGCCCAGAGGGCCAAGGG + Intronic
1148159410 17:45441571-45441593 GACTGTGGTCAGAGGACAGATGG - Intronic
1148243089 17:46012781-46012803 CACCCAGGCCAGAGGGAAGAGGG + Intronic
1149568086 17:57653451-57653473 GACACTGGCCAGAGGGCAGGTGG - Intronic
1150279205 17:63919107-63919129 CACCATGGCCTGCGGCCAGAGGG - Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150390745 17:64788656-64788678 GACTGTGGTCAGAGGACAGATGG - Intergenic
1150630214 17:66875241-66875263 CAGCGTGGGCAGAGGGGAGCAGG - Intronic
1150655705 17:67038047-67038069 CACGGTGACCAGCGTGCAGAGGG - Intergenic
1151181183 17:72329792-72329814 CACAGTGGCCAGAAGGAAGATGG - Intergenic
1151659257 17:75509999-75510021 GACCCTGGCAGGAGGGCAGAGGG + Intronic
1151860408 17:76756895-76756917 CACAGAGGCCAGAGGGGAAAAGG + Intronic
1152234322 17:79130585-79130607 CACAGTGGCGTGAGGGCAGGCGG + Intronic
1152290952 17:79440042-79440064 CACCCGGGCCAGAGGGCACTTGG + Intronic
1152685057 17:81689864-81689886 AGCCCTGGCCAGAGAGCAGAGGG + Intronic
1153633888 18:7097847-7097869 GACCGTGGGGAGAGGGGAGAGGG - Intronic
1154356817 18:13627837-13627859 AGCGGTGGCCAGAGGGCAGACGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155911030 18:31504548-31504570 CACGATGGGCAGACGGCAGAGGG + Intronic
1156679995 18:39576732-39576754 CACAGTGGCCAGCTGGCACATGG - Intergenic
1157680726 18:49603363-49603385 GAGTGTGGCCAGAGGGCGGATGG - Intergenic
1157749755 18:50167845-50167867 CCGTGGGGCCAGAGGGCAGATGG - Intronic
1158459509 18:57633855-57633877 GACCGTGGAAAGAGGGGAGAGGG + Intergenic
1159002472 18:62986694-62986716 CACCCTGGGCAGAGTGCAGTGGG + Intergenic
1160178852 18:76617485-76617507 CACTGTGTCCTGAGGGCAGAGGG + Intergenic
1160537850 18:79604459-79604481 CTGCGTGCCCAGGGGGCAGAGGG - Intergenic
1160754770 19:751489-751511 CCCCATGGTCAGAGGCCAGAGGG + Intronic
1160875068 19:1293107-1293129 AACTGAGGCCAGAGGGCAGTGGG + Intronic
1161043127 19:2120630-2120652 CACAGATGCCCGAGGGCAGAGGG + Intronic
1162098231 19:8323690-8323712 CACCGAGGCTAGAGTGCAGTGGG - Intronic
1162809553 19:13155733-13155755 CCCCGTGGCCACAGGGTAGAAGG + Intergenic
1162958353 19:14112299-14112321 CTCCCTGGCCAGGGGGCAGAAGG - Intronic
1163056145 19:14719895-14719917 CACCGTGCCCAGCCGGGAGATGG - Exonic
1163530110 19:17843857-17843879 CTCCGTGGCCAGAGCAAAGAGGG + Exonic
1164896465 19:31881607-31881629 CACGGTGGAAAGAAGGCAGAGGG + Intergenic
1164907233 19:31977414-31977436 GACCAGGGCCAGAGGGCAGAGGG - Intergenic
1165460081 19:35939307-35939329 CACAGTGGGCTGAGGGCAGAAGG - Intronic
1165702459 19:37948954-37948976 CACTGTGGCAGGAGGGCAGCGGG + Intronic
1165993397 19:39828289-39828311 CAGCTTGGCCAGAGGGTAGGGGG - Exonic
1166566234 19:43767214-43767236 CCCCGAGGCCAGGGGGCAGGAGG + Intronic
1168453557 19:56485546-56485568 GAGTGTGGCCAGAGGCCAGATGG + Intergenic
925745566 2:7040661-7040683 GACTGAGGCCAGAGGCCAGACGG - Exonic
926381737 2:12297302-12297324 CACCATTACCAGAGTGCAGATGG + Intergenic
927519755 2:23691624-23691646 CACGGTGGCCGCAGGGCAGGAGG + Intronic
927944846 2:27129457-27129479 GACCGTGGCCAGAAGGTGGAGGG - Intronic
928214744 2:29351941-29351963 CACTGTGGCCAGAGCTGAGAAGG - Intronic
928331313 2:30360025-30360047 GAGTGTGGACAGAGGGCAGAGGG + Intergenic
929530872 2:42751599-42751621 AACCGTGGCCAGGGTGGAGAAGG + Intronic
929561624 2:42959949-42959971 CTCCTGGGCCAGAGGCCAGATGG - Intergenic
929761951 2:44814373-44814395 CACCCTGGCCAGATGACAGTGGG - Intergenic
929891142 2:45919423-45919445 AAGAGAGGCCAGAGGGCAGAAGG - Intronic
930977405 2:57480195-57480217 GACAGTGGCCACAGGGGAGAAGG - Intergenic
931584074 2:63808329-63808351 GACCGTGGGGAGAGGGGAGAGGG - Intronic
931643450 2:64401096-64401118 CATCCTGGCAAGAGAGCAGAGGG - Intergenic
932688055 2:73890486-73890508 CACCGTGGTCAGCGTGCAGATGG - Intergenic
934790471 2:97055593-97055615 CATCGTGTCCAGGGGGCAGTGGG - Intergenic
934815998 2:97326939-97326961 CATCGTGTCCAGGGGGCAGTGGG + Intergenic
934821698 2:97381545-97381567 CATCGTGTCCAGGGGGCAGTGGG - Intergenic
937074087 2:119088435-119088457 CACAGTTGCCAAAGGGCAGGAGG - Intergenic
937264550 2:120607731-120607753 CCCCGTGGGCAGAGCTCAGAGGG + Intergenic
937325551 2:120987940-120987962 CACCGTGCCCAGTGAGCAGATGG - Intronic
938236497 2:129710389-129710411 AGACATGGCCAGAGGGCAGAGGG + Intergenic
940232629 2:151473332-151473354 CACCCAGGCCAGAGTGCAGGTGG + Intronic
940495408 2:154422005-154422027 CAGCGTGCACAGAGAGCAGAGGG + Intronic
940652585 2:156452551-156452573 GACCGTGGGGAGAGGGGAGAGGG + Intronic
942540444 2:177009775-177009797 CAACATGGCCAGAGCTCAGAGGG - Intergenic
947390578 2:229635259-229635281 GACCCTGGCCAGAGGGCTGGAGG - Intronic
948894016 2:240919905-240919927 CACCGTGGAGACAGGGCACAAGG + Intronic
949032314 2:241802911-241802933 CACCCTGGCCTGTGGGCAGCTGG + Intronic
949050164 2:241893495-241893517 CACACTGCCCAGAGGCCAGACGG - Intergenic
1168805608 20:670646-670668 CACAGTGGGCAAAGGGCAGCGGG - Intronic
1169109482 20:3022668-3022690 CACTGTAGCCAGAGAGCAGGGGG - Exonic
1169801480 20:9516136-9516158 CTCCGAGCCCAGCGGGCAGAGGG + Intronic
1171289010 20:23969493-23969515 CATTGAGGCCAGAGGGAAGATGG + Intergenic
1172094760 20:32455196-32455218 CACTGTGGCCACAGGGTACATGG - Intronic
1172170590 20:32929347-32929369 CACCGGGGCCAGTGGGAAGCAGG + Intronic
1172217455 20:33246309-33246331 TACAATGGCCAGAGGGCAGCAGG - Intergenic
1172717943 20:36977731-36977753 GACCGTGGAAAGAGGGGAGAGGG + Intergenic
1172754029 20:37270908-37270930 CACCCAGGCCACAGAGCAGAAGG + Intergenic
1172758148 20:37301958-37301980 GACTGTGGCCAGAGCACAGAGGG + Intronic
1172907071 20:38378181-38378203 GACCGTGGAAAGAGGGGAGAGGG - Intergenic
1172918748 20:38462549-38462571 GACCGTGGGGAGAGGGGAGAGGG + Intergenic
1172918757 20:38462579-38462601 GACCGTGGAAAGAGGGGAGAGGG + Intergenic
1172918768 20:38462615-38462637 GACCGTGGAAAGAGGGGAGAGGG + Intergenic
1173769767 20:45646786-45646808 GACCGTGGGGAGAGGGGAGAGGG + Intergenic
1175123918 20:56737638-56737660 CACAATGGCCAAAGGGCAGCTGG + Intergenic
1175278680 20:57788368-57788390 CAGCGTGGCTGGAGGGCAGCAGG - Intergenic
1175697694 20:61114882-61114904 CACTGTGGGCAGTGGGCAGTGGG + Intergenic
1176120687 20:63453241-63453263 CACCGTCGCCAGGGGGCACTCGG + Intronic
1176357860 21:5967278-5967300 CTGCGTGGACAGAGGGCGGAGGG + Intergenic
1178363649 21:31970308-31970330 CACCGTGCCCAGAGAGGAGGTGG + Intronic
1179765658 21:43571273-43571295 CTGCGTGGACAGAGGGCGGAGGG - Intronic
1179766972 21:43581789-43581811 CACCTTAGCCAGTGGTCAGAAGG + Intronic
1179896462 21:44366226-44366248 CACAGGGGCCACAGAGCAGAGGG + Intronic
1179899672 21:44382941-44382963 AACCCTGGCCAGAGGGCAGCTGG + Intronic
1180033515 21:45229050-45229072 CTGCTTGGCCAGAAGGCAGAAGG - Intergenic
1180703060 22:17792110-17792132 CACTGTGGCAGGAGGACAGAAGG + Intronic
1180869389 22:19137807-19137829 CACAGAGGCCAGAGTGCAGAGGG + Intronic
1180948209 22:19708359-19708381 CTCCGTGGCCAGTGGCCAGCCGG - Intergenic
1181301699 22:21884764-21884786 GACCGTGGAAAGAGGGGAGAGGG + Intergenic
1181472993 22:23152283-23152305 CACAGTCCCCAGAGGGGAGACGG - Intronic
1181491313 22:23262489-23262511 CCCCATGGCCAGAGAGCAGGAGG + Intronic
1181538949 22:23562908-23562930 CACCATGCCCAGAGACCAGATGG + Intergenic
1181658185 22:24318504-24318526 GACCGTGGAAAGAGGGGAGAGGG + Intronic
1182063313 22:27413213-27413235 CACCTTCCTCAGAGGGCAGATGG - Intergenic
1182560429 22:31154917-31154939 GACCCTCTCCAGAGGGCAGAGGG - Intergenic
1183398281 22:37585749-37585771 CAGTGTGGCCAGGGGGCAGGTGG - Intergenic
1183740795 22:39667387-39667409 CACAGTGGCAGGAGCGCAGAGGG + Intronic
1183832112 22:40423775-40423797 CACCATTGTCAGAGGGCAAATGG + Intronic
1183933003 22:41246799-41246821 CACGGTGTGCAGAAGGCAGAGGG - Intronic
1184650423 22:45917071-45917093 CACAGTGCCCAGTGGGCAGGTGG - Intergenic
1184769558 22:46589417-46589439 TCACGTGGCCCGAGGGCAGATGG + Intronic
1184837153 22:47030862-47030884 CACCGTGCCCAGACGGGAGGAGG + Intronic
949946402 3:9193323-9193345 CACTGTGGGCAGAGGGCTAAGGG - Intronic
949992498 3:9591310-9591332 GACCGTGGAAAGAGGGGAGAGGG - Intergenic
950421993 3:12904746-12904768 AACCAGGGCCAGAGGGGAGATGG + Intronic
951391204 3:22106356-22106378 AACAGTGACCAAAGGGCAGATGG - Intronic
952945332 3:38475084-38475106 CACCCTGCCCAGAGGCCACAGGG - Intronic
953187605 3:40653141-40653163 CACACTGGGCTGAGGGCAGATGG + Intergenic
953262601 3:41354238-41354260 CACTGTGGACTGAGGGGAGAAGG - Intronic
954107350 3:48416417-48416439 CACCGGGGCCAGTGGGGAGGAGG - Exonic
954610918 3:51944069-51944091 CACCTGGGCCAGAGGGGAGGTGG - Exonic
954838964 3:53494744-53494766 CACCGCGGCGGGCGGGCAGACGG + Intronic
954889081 3:53906631-53906653 CACGGAGGCCAGAAGGCAGTGGG + Intergenic
957128860 3:76198146-76198168 CACCATGTCCTGAGGGAAGAGGG - Intronic
958673978 3:97242283-97242305 CACTGTGGCTAGACTGCAGAGGG - Intronic
960619506 3:119625080-119625102 GAGACTGGCCAGAGGGCAGAAGG - Intronic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
960920821 3:122746640-122746662 GACCGTGGGGAGAGGGGAGAGGG - Intronic
960969366 3:123128545-123128567 CACCCAGGCCAGAGTGCAGAGGG + Intronic
961164064 3:124751331-124751353 GACCGTGGAAAGAGGGGAGAGGG + Intergenic
961424982 3:126838006-126838028 CACCATGTCCACAGTGCAGATGG + Intronic
961828786 3:129612679-129612701 CCCCGTGGCAGGAGGGCTGAGGG + Intergenic
962342939 3:134600612-134600634 CCCCCAGGCCACAGGGCAGAAGG - Intronic
962418718 3:135208118-135208140 CCCTGTGGCAAGAGGGAAGATGG + Intronic
962744282 3:138385996-138386018 CACCCTAGCGAGAGGGCAGGTGG + Intronic
964414627 3:156434245-156434267 CACCATGGTCACAGTGCAGATGG + Intronic
966253620 3:177892562-177892584 GACCGTGGAAAGAGGGGAGAGGG + Intergenic
966375536 3:179291699-179291721 GACCGTGGGGAGAGGGGAGAGGG + Intergenic
967337911 3:188364759-188364781 AATGGTGGCCAGAGGGCAGCAGG - Intronic
968423660 4:506338-506360 CATCGTGCCCTGAGGGCAGGTGG + Intronic
968425584 4:520830-520852 CTGCATCGCCAGAGGGCAGATGG + Intronic
968472188 4:787220-787242 CTCCGTGGGCAGCCGGCAGAGGG + Intronic
968650439 4:1758238-1758260 CAGCAAGGCGAGAGGGCAGAAGG + Intergenic
968986809 4:3880125-3880147 CAGCCTGGGCAGAGGCCAGAGGG - Intergenic
972288113 4:37668228-37668250 GACCGTGGAAAGAGGGGAGAGGG - Intronic
973227252 4:47800788-47800810 CACAGATGCCAGAGGTCAGAGGG - Intronic
974082010 4:57223788-57223810 GACCGTGGGGAGAGGGGAGAGGG - Intergenic
974474828 4:62365343-62365365 AACCTTGGCCAGAAGGAAGATGG + Intergenic
977693844 4:99946436-99946458 CACCGCGGGCCGAGGGCAGTGGG + Exonic
981677302 4:147357263-147357285 GACCGTGGAAAGAGGGGAGAGGG - Intergenic
983646173 4:169993671-169993693 CCCCCTGGCCAGTGGGCAGGAGG - Intronic
984852406 4:184165439-184165461 CACCGTGGCTGGAGGGGAGCAGG - Intronic
985736266 5:1585422-1585444 GACCGTGGAAAGAGGGGAGAGGG - Intergenic
986150905 5:5129743-5129765 CAGCAAGGGCAGAGGGCAGATGG - Intergenic
989634685 5:43521494-43521516 GACCGTGGGGAGAGGGGAGAGGG - Intergenic
993605637 5:89987557-89987579 CACCTTGGGCAGAGGGCAGAGGG + Intergenic
995123777 5:108560113-108560135 GACCGTGGAAAGAGGGGAGAAGG + Intergenic
995934296 5:117489329-117489351 AAACGTGGTGAGAGGGCAGAGGG + Intergenic
996566143 5:124881256-124881278 CACAGAGGCCAGAGTACAGAGGG - Intergenic
1002313382 5:178328138-178328160 ACCCTTGGCCAAAGGGCAGAGGG - Intronic
1002440624 5:179262563-179262585 CAGCGTGACCAAGGGGCAGAAGG - Intronic
1002621857 5:180493974-180493996 CACCCAGGCCAGAGTGCAGTGGG - Intergenic
1002643118 5:180640040-180640062 CCCCGTGGCCCGAGGACGGAGGG - Intronic
1005835951 6:29709794-29709816 CACAGTTGCCAGAGGGTAAAAGG - Intergenic
1006457492 6:34140298-34140320 CAACGTGACCAGGGGGCAGTGGG + Intronic
1006546454 6:34785723-34785745 GACCGTGGAAAGAGGGGAGAGGG - Intergenic
1006546472 6:34785784-34785806 GACCGTGGAAAGAGGGGAGAGGG - Intergenic
1006546481 6:34785814-34785836 GACCGTGGAAAGAGGGGAGAGGG - Intergenic
1007423480 6:41733574-41733596 CCCCGCGGCCAGGAGGCAGACGG + Intronic
1008564057 6:52749995-52750017 CAAGGTGGCCTGAGAGCAGAGGG + Intergenic
1008572822 6:52831269-52831291 CAGGGTGGCCTGAGAGCAGAGGG + Intergenic
1008579769 6:52896235-52896257 CAGGGTGGCCTGAGAGCAGAGGG + Intronic
1008841783 6:55910995-55911017 GACCGTGGGGAGAGGGGAGAGGG + Intergenic
1010252887 6:73726891-73726913 CTCCTTGACCAGAGGGCACAGGG - Intronic
1010512977 6:76743652-76743674 GACCGTGGGGAGAGGGGAGAGGG - Intergenic
1011004091 6:82624464-82624486 CACAGATGCCTGAGGGCAGAAGG - Intergenic
1011476285 6:87752092-87752114 GACCGTGGAAAGAGGGGAGAGGG + Intergenic
1012287168 6:97404812-97404834 CAGCATGGCCACAGTGCAGAAGG + Intergenic
1013389265 6:109666776-109666798 CAGCCTGGCCAGAGGTCAGATGG - Intronic
1015924716 6:138297049-138297071 CACTGTGGCCATTGGGCAGTGGG + Intronic
1018893226 6:167996861-167996883 CGGCCTGGCCGGAGGGCAGAGGG + Intronic
1019445570 7:1069372-1069394 GACCGTGGGGAGAGGGGAGAGGG - Intronic
1020052203 7:5089101-5089123 CTCCCAGGCCTGAGGGCAGAAGG - Intergenic
1020812656 7:12864867-12864889 CACAGGGGCCACAGGGCACAGGG + Intergenic
1021851615 7:24814212-24814234 CAGTGTGGCCAGAGGACAGTGGG + Intronic
1021920835 7:25483385-25483407 CACAGGGACCAGAGAGCAGATGG + Intergenic
1024392514 7:48831710-48831732 CATGGTGGCCAGTGGGGAGATGG - Intergenic
1025150314 7:56542068-56542090 CACCATGATCAGAGGACAGATGG - Intergenic
1025272873 7:57541684-57541706 CACAGTGGCCTCATGGCAGAGGG + Intergenic
1026633383 7:72058662-72058684 CACCCTGGGCAGAGGGCCAAGGG + Intronic
1028227624 7:88267377-88267399 GACCGTGGAAAGAGGGGAGAGGG + Intergenic
1032194280 7:129780483-129780505 CACCCTAGCCCGAGGGCAGGAGG - Intergenic
1032293529 7:130613114-130613136 TCCCATGGACAGAGGGCAGAGGG + Intronic
1032549747 7:132773080-132773102 CACCGTGCCCAGATGGCAACAGG + Intergenic
1033131086 7:138745901-138745923 CACCCAGGCCGGAGGGCAGTGGG - Intronic
1033219912 7:139521031-139521053 GACCGTGGAAAGAGGGGAGAGGG + Intergenic
1034322339 7:150197867-150197889 GACCGTGGGGAGAGGGGAGAGGG - Intergenic
1034907441 7:154963122-154963144 CACCGTGCACAGAGAGCAGCTGG + Intronic
1034947037 7:155268967-155268989 CACCTCGGCCAGAGGGGAAAAGG + Intergenic
1035374103 7:158395939-158395961 CTCTGTGACCAGGGGGCAGAGGG - Intronic
1035391600 7:158508148-158508170 CACGGTGGGCAGAAGGCAGGTGG + Intronic
1036095828 8:5724731-5724753 GACCGTGGAAAGAGGGGAGAGGG - Intergenic
1036778524 8:11629951-11629973 CTCCATGGCCAGAGGAGAGAGGG + Intergenic
1037934729 8:22907855-22907877 GACCCTGGCCAGAGTGCTGATGG + Intronic
1039216550 8:35278235-35278257 GAGTGTGGCCAGAGGGCAGCCGG - Intronic
1040384256 8:46902984-46903006 CACTGGGGACAGAGGGAAGAGGG + Intergenic
1041513748 8:58677232-58677254 GACCGTGGAAAGAGGGGAGAGGG + Intergenic
1042813721 8:72854793-72854815 CACCGTGGCAGGAGGGGACATGG + Intronic
1043939564 8:86181593-86181615 CACCATGGCCAGTGGGTAGGAGG - Intergenic
1045980519 8:108181713-108181735 CACCCTGGCCAGAGTGCAGTGGG + Intergenic
1048325508 8:133436134-133436156 CAAGGTGGGCAGAGGACAGAAGG + Intergenic
1048352365 8:133626492-133626514 CCACGTGGCCAGAGGGGAGTAGG + Intergenic
1048613373 8:136048378-136048400 GACCTTGGAGAGAGGGCAGAGGG - Intergenic
1049220904 8:141428375-141428397 CCCCCTGGGCAGTGGGCAGATGG - Intronic
1049363546 8:142225555-142225577 CCCTGTGGTCAGAAGGCAGAGGG - Intronic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049635928 8:143689420-143689442 CACTGTGGCAGGAGGGCAGTGGG + Intronic
1049707012 8:144047683-144047705 CACAGTGCACTGAGGGCAGATGG + Intergenic
1051816512 9:21113371-21113393 CACAGAGGCCAGAGGGTAGTGGG + Intergenic
1056409414 9:86311590-86311612 GACCGTGGGGAGAGGGGAGAGGG - Intronic
1056646034 9:88412721-88412743 CACCCAGGCTAGAGTGCAGATGG + Intronic
1056812895 9:89777934-89777956 CAGCTTTGCCAGAGAGCAGAAGG + Intergenic
1057185272 9:93053958-93053980 CAAGGCGCCCAGAGGGCAGAAGG - Intergenic
1057259094 9:93574366-93574388 CTCCCTGGTGAGAGGGCAGAGGG - Intergenic
1058390574 9:104490562-104490584 GACCGTGGAGAGAGGGGAGACGG + Intergenic
1058944897 9:109847003-109847025 CAATGTGGCCAGTGGGGAGATGG + Intronic
1059476278 9:114550525-114550547 CACTGTGGCCAGGGGGCAACTGG + Intergenic
1060794680 9:126505816-126505838 CACAGTGGCCAGAGGGCTCGTGG - Exonic
1061196447 9:129109721-129109743 CTACGGGGCCAGAGGGCGGAGGG - Intronic
1061379354 9:130244772-130244794 CCCAGTGGCCACAGGGCAGCAGG + Intergenic
1061427308 9:130507339-130507361 GACCGTGGAAAGAGGGGAGAGGG + Intergenic
1061626656 9:131844382-131844404 CTCGGTGGCCAGAGGGCGGAGGG + Intergenic
1061716332 9:132520778-132520800 CTCCTGGGCCAGGGGGCAGAAGG - Intronic
1061799027 9:133104182-133104204 CACCGTGGCTAGAGAGGAAAGGG + Intronic
1061873653 9:133533560-133533582 CAAGCTGGACAGAGGGCAGACGG + Intronic
1061927633 9:133813749-133813771 CAAAGTTGGCAGAGGGCAGATGG + Intronic
1062231537 9:135484718-135484740 CAGAGGGGCCACAGGGCAGAGGG + Exonic
1203773144 EBV:59444-59466 CACCGCGGCCCGAGCCCAGAAGG - Intergenic
1186485115 X:9928237-9928259 CACAGTTCCCAGAGGGGAGAGGG - Intronic
1186786705 X:12962584-12962606 GACCGTGGAAAGAGGGGAGAGGG - Intergenic
1189251016 X:39600747-39600769 CACCATGGAGAGAGGGCAGCAGG + Intergenic
1189325509 X:40108816-40108838 CACCGTGGGCTGAGGGAAGAGGG - Intronic
1190769443 X:53503395-53503417 GACCGTGGGGAGAGGGGAGAGGG - Intergenic
1193362031 X:80590401-80590423 GACCGTGGAAAGAGGGGAGAGGG - Intergenic
1193372185 X:80712161-80712183 TACCGTGGGGAGAGGGGAGAGGG - Intronic
1195394616 X:104397595-104397617 CACCCTGACCATAGGGCAGAAGG - Intergenic