ID: 1121051161

View in Genome Browser
Species Human (GRCh38)
Location 14:90819826-90819848
Sequence GAACCCTCTGGGCTTCACCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121051158_1121051161 -3 Left 1121051158 14:90819806-90819828 CCTGAAGCAGGAGAGAGAAGGAA No data
Right 1121051161 14:90819826-90819848 GAACCCTCTGGGCTTCACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121051161 Original CRISPR GAACCCTCTGGGCTTCACCG TGG Intergenic
No off target data available for this crispr