ID: 1121054684

View in Genome Browser
Species Human (GRCh38)
Location 14:90842943-90842965
Sequence ATGCTGACGCTTCCTGTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121054681_1121054684 2 Left 1121054681 14:90842918-90842940 CCACCATGCCTGACGTCTGCAGC No data
Right 1121054684 14:90842943-90842965 ATGCTGACGCTTCCTGTTCTAGG No data
1121054682_1121054684 -1 Left 1121054682 14:90842921-90842943 CCATGCCTGACGTCTGCAGCACA No data
Right 1121054684 14:90842943-90842965 ATGCTGACGCTTCCTGTTCTAGG No data
1121054679_1121054684 20 Left 1121054679 14:90842900-90842922 CCCACATCTCATGCAGGGCCACC No data
Right 1121054684 14:90842943-90842965 ATGCTGACGCTTCCTGTTCTAGG No data
1121054676_1121054684 26 Left 1121054676 14:90842894-90842916 CCTCTGCCCACATCTCATGCAGG No data
Right 1121054684 14:90842943-90842965 ATGCTGACGCTTCCTGTTCTAGG No data
1121054680_1121054684 19 Left 1121054680 14:90842901-90842923 CCACATCTCATGCAGGGCCACCA No data
Right 1121054684 14:90842943-90842965 ATGCTGACGCTTCCTGTTCTAGG No data
1121054674_1121054684 28 Left 1121054674 14:90842892-90842914 CCCCTCTGCCCACATCTCATGCA No data
Right 1121054684 14:90842943-90842965 ATGCTGACGCTTCCTGTTCTAGG No data
1121054683_1121054684 -6 Left 1121054683 14:90842926-90842948 CCTGACGTCTGCAGCACATGCTG No data
Right 1121054684 14:90842943-90842965 ATGCTGACGCTTCCTGTTCTAGG No data
1121054675_1121054684 27 Left 1121054675 14:90842893-90842915 CCCTCTGCCCACATCTCATGCAG No data
Right 1121054684 14:90842943-90842965 ATGCTGACGCTTCCTGTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121054684 Original CRISPR ATGCTGACGCTTCCTGTTCT AGG Intergenic