ID: 1121055523

View in Genome Browser
Species Human (GRCh38)
Location 14:90848942-90848964
Sequence ATCCTCTGCCTGGCTTAATG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121055523_1121055527 23 Left 1121055523 14:90848942-90848964 CCTCATTAAGCCAGGCAGAGGAT 0: 1
1: 0
2: 0
3: 7
4: 147
Right 1121055527 14:90848988-90849010 AGTCCACCGCACTCCAGCCTGGG 0: 1
1: 84
2: 4441
3: 91457
4: 277132
1121055523_1121055526 22 Left 1121055523 14:90848942-90848964 CCTCATTAAGCCAGGCAGAGGAT 0: 1
1: 0
2: 0
3: 7
4: 147
Right 1121055526 14:90848987-90849009 GAGTCCACCGCACTCCAGCCTGG 0: 1
1: 6
2: 270
3: 7263
4: 117559

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121055523 Original CRISPR ATCCTCTGCCTGGCTTAATG AGG (reversed) Exonic
900105576 1:979472-979494 GTCCTGAGCCTGGCTTATTGGGG + Exonic
900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG + Intronic
906365697 1:45207356-45207378 ATCCTCTGCCTGGCACATAGTGG + Intronic
906521752 1:46470843-46470865 AGCCTCTGTGTGGCTCAATGTGG + Intergenic
915677839 1:157548104-157548126 ATGTCCTGCCTGGCTAAATGGGG + Intronic
915686985 1:157643659-157643681 ATGTCCTGCCTGGCTAAATGGGG + Intergenic
918890358 1:190258282-190258304 ATCCCGTGCCTGGCTCAGTGAGG - Intronic
919717514 1:200794685-200794707 CTCCTGTGCCTGCCTTAATCTGG + Intronic
921217435 1:212950139-212950161 ATCCTCTACCTGGGATGATGAGG - Intergenic
921445626 1:215243612-215243634 AGCCTCAGCCTGGCCTCATGGGG - Intergenic
922704586 1:227782431-227782453 AGCCTCTTCCAGGCTTGATGGGG - Intergenic
924570035 1:245229381-245229403 ATTCTCTGCCTGGAGTGATGAGG + Intronic
1063258415 10:4355009-4355031 ATCAGCTGCCTGGCATACTGTGG - Intergenic
1068160467 10:53256144-53256166 ATCATATTCCTGTCTTAATGGGG + Intergenic
1068551061 10:58408525-58408547 AGCCATTGCCTGGCTTAGTGAGG - Intergenic
1068702937 10:60039142-60039164 GCCATCTGCCTGGCTTAAAGTGG - Intronic
1070025579 10:72628276-72628298 AGCCTCTGCCTGGCCGAATATGG - Intergenic
1071708051 10:88020795-88020817 TTCCACTGCCTGCCTAAATGTGG - Intergenic
1075484502 10:122811160-122811182 ACCCTCTGCCTGGCATGAGGTGG + Intergenic
1077993106 11:7429693-7429715 CTCTTCTGCCTGGCTCACTGCGG + Intronic
1082666152 11:55978601-55978623 ATCCTCTTCCTGAGTTCATGTGG - Intergenic
1083255590 11:61493676-61493698 TTCCTCTATCTGGCTCAATGTGG + Intergenic
1084961887 11:72721206-72721228 ATCCTGTGCTTGGCTTATTGGGG - Intronic
1086747631 11:90450043-90450065 TGCCTCTTCCTGGCTTCATGAGG - Intergenic
1090806953 11:130208789-130208811 TCCCTCTGCCTGGCAGAATGAGG + Intronic
1091601987 12:1923236-1923258 AGCCTTTGCCTGGCTACATGGGG - Intergenic
1092527103 12:9315963-9315985 AGACTCAGCCTGACTTAATGGGG - Intergenic
1092540167 12:9415810-9415832 AGACTCAGCCTGACTTAATGGGG + Intergenic
1092954186 12:13534449-13534471 ATGCTCTCCCAGGCTTCATGAGG + Intergenic
1093242281 12:16691930-16691952 AGCCACTGCCTGACTTCATGTGG - Intergenic
1094512873 12:31106646-31106668 AGACTCAGCCTGACTTAATGGGG - Intergenic
1094765499 12:33589769-33589791 CTCCTCTCCCTGACTTTATGAGG - Intergenic
1095477650 12:42602314-42602336 GTCCTCTGCATTTCTTAATGGGG - Intergenic
1096593012 12:52674893-52674915 CTACTCTGGCTGGCTTAAGGAGG + Exonic
1098787501 12:74778664-74778686 ATCCTATGCCAGGATTATTGAGG + Intergenic
1099086996 12:78257932-78257954 ATCCTGTGCCTGGCTCAGAGGGG - Intergenic
1101361808 12:104034488-104034510 ATCCTGTGCATGGCTTGGTGGGG + Intronic
1103916686 12:124379377-124379399 AGCCTCTGCCTGGCTCAGCGTGG - Intronic
1108273540 13:48785998-48786020 TTCCTCTGTCTGGCTTTTTGTGG + Intergenic
1109117198 13:58403274-58403296 ATCCTTTACCTGTTTTAATGGGG + Intergenic
1112994568 13:105557307-105557329 ATGATGTGGCTGGCTTAATGAGG + Intergenic
1114402463 14:22422534-22422556 ATCCTCTGCATGGCTCACTCAGG - Intergenic
1114922344 14:27348566-27348588 TTCCTTTGCCTGTTTTAATGGGG + Intergenic
1116543360 14:46129722-46129744 AGCCTCTGACTGGCCAAATGGGG - Intergenic
1120218523 14:81706320-81706342 ATAGTCTGGCTGGCTTTATGTGG + Intergenic
1121055523 14:90848942-90848964 ATCCTCTGCCTGGCTTAATGAGG - Exonic
1202830780 14_GL000009v2_random:27000-27022 GCCCTCTGCCTCGCTTAATCTGG + Intergenic
1124134537 15:27022627-27022649 ATGCTTTGCCTTGCTTATTGTGG - Intronic
1126446683 15:48754253-48754275 ATCATCTGTGTGACTTAATGAGG - Intronic
1127447614 15:59081226-59081248 ATCCTCTGCATCACTTCATGAGG - Exonic
1127980927 15:64034393-64034415 ACCCTCAGCCTGCCTGAATGTGG - Intronic
1129797957 15:78392277-78392299 ATCCTTTGGCTGGTTGAATGAGG + Intergenic
1131036668 15:89226995-89227017 GCCCTCTGCCTGGCTGAAGGCGG + Intergenic
1135801093 16:25496820-25496842 ATCATCTGCCTTGCTTCAAGAGG + Intergenic
1135956968 16:26963945-26963967 AGCTTCAGCCTGGCTGAATGTGG + Intergenic
1138345193 16:56316275-56316297 TTCCTCTGCCAGGCTCTATGGGG + Intronic
1138580191 16:57935907-57935929 CTCCTCTCCCTGGCTTGAGGTGG - Intronic
1138702026 16:58873957-58873979 ATCCTTTGCCCGCTTTAATGGGG + Intergenic
1141320993 16:83008689-83008711 ATCTTCTGCCTGGGTTACGGTGG - Intronic
1141491744 16:84378451-84378473 CTCCTCTCCCTGGCTTTTTGTGG + Intronic
1144173764 17:12684885-12684907 ACCCTGTGCTTGGTTTAATGAGG - Intronic
1145955907 17:28854569-28854591 ATCCTCTCCCAGCCTTAATTTGG - Intronic
1148163265 17:45463979-45464001 TTCCTTTGCCTGGCATAATGAGG - Intronic
1148906281 17:50914597-50914619 ATTCTATGCCTGGCTGGATGCGG - Intergenic
1150394497 17:64810631-64810653 TTCCTTTGCCTGGCATAATGAGG - Intergenic
1150505521 17:65694216-65694238 CTCCTCTGCCTGTCTGAGTGTGG - Intronic
1151495840 17:74457658-74457680 ACCCAGTGCCTGGCTCAATGGGG + Intergenic
1157024713 18:43828948-43828970 ATTCTCAGACTGGCTTAATCAGG + Intergenic
1160369300 18:78358337-78358359 ATGCTCTGCCTGGTTCCATGTGG - Intergenic
1163605899 19:18275093-18275115 AGCCTCTGCCTGGCTTCCTTGGG + Intergenic
1167266946 19:48487939-48487961 CTCCTCTGCCCTGCTCAATGTGG - Intronic
925946572 2:8869653-8869675 CTCCTCTGTCAGGTTTAATGAGG + Intronic
926381672 2:12296590-12296612 CTTCTCTGCCTGCCTTGATGAGG - Intergenic
934718007 2:96554372-96554394 ATCCCCTGCCTGGATAAAAGGGG + Intergenic
936559083 2:113520811-113520833 CTCCTCTGCCTGGATGTATGAGG + Intergenic
945120570 2:206453052-206453074 ATCCTCTCCCTGGCTCCAAGAGG - Intronic
945770106 2:214032178-214032200 TGTCTCTGCCTGGCTTGATGTGG - Intronic
948729445 2:239953724-239953746 AGCCTCTGCCTGGCTGCCTGTGG - Intronic
1168798517 20:628608-628630 CTACTCTGCCTGCCTTCATGGGG - Intergenic
1170396671 20:15933144-15933166 TCTCTCTGCCTGGCTTTATGGGG + Intronic
1172207369 20:33173453-33173475 ATCCACTGCCTGGGGTTATGTGG - Intronic
1172823462 20:37759377-37759399 ATCCTTTGCCTGTCTGAATAGGG + Intronic
1176609967 21:8871838-8871860 GCCCTCTGCCTCGCTTAATCTGG + Intergenic
1177532099 21:22373845-22373867 AACCTCTGCCTGGCTTTAAGAGG - Intergenic
1177781560 21:25627359-25627381 ATCATCCACCTGGCTTAAAGGGG + Intergenic
1178454829 21:32739403-32739425 ATCCTCAGAATGGCTCAATGAGG - Intronic
1180360031 22:11881089-11881111 GCCCTCTGCCTCGCTTAATCTGG + Intergenic
1182001034 22:26920028-26920050 GTCCTCTGGCTGCTTTAATGTGG + Intergenic
1183097067 22:35558782-35558804 ATGCTCTGCCTCTCTTACTGAGG - Intergenic
1183126051 22:35783257-35783279 GTGCTCCGACTGGCTTAATGGGG - Intronic
953463851 3:43102964-43102986 ACCCTCTGCCTGGCTGGGTGGGG - Intronic
954364153 3:50137495-50137517 AACCTCAGCCTGGCTGAATGCGG - Intergenic
957456842 3:80462210-80462232 TTTCTCTGCCTGGCTAGATGTGG + Intergenic
960810898 3:121626629-121626651 ACCCTCTGGCTGGCTTTATTTGG - Intronic
962403760 3:135083021-135083043 TTCCTCTGCCTGGCTGCCTGAGG - Intronic
962605036 3:137025909-137025931 ATCCTCTCCCTATCCTAATGTGG - Intergenic
964939419 3:162137056-162137078 ACTTTCTGCCTGGCTGAATGAGG + Intergenic
1202736651 3_GL000221v1_random:6628-6650 GCCCTCTGCCTCGCTTAATCTGG + Intergenic
968663798 4:1810049-1810071 ATGCTCTGCCTGCCTTGGTGTGG - Intergenic
969321946 4:6417734-6417756 CCCCTCTGCCTGGCTCAGTGCGG - Intronic
979951336 4:126897293-126897315 ATCCTCTGCCTGGATTTCAGAGG - Intergenic
981626878 4:146767238-146767260 ATCTTCTGCCTGGTTCACTGGGG + Intronic
981784545 4:148462464-148462486 AACCTCTGCAAGGGTTAATGTGG + Intergenic
984082425 4:175264192-175264214 ATCCCCTTCCTGTCTTAATATGG - Intergenic
1202769282 4_GL000008v2_random:186641-186663 GCCCTCTGCCTCGCTTAATCTGG - Intergenic
987360981 5:17106255-17106277 ATACTCTGCTTGGCACAATGTGG + Intronic
988085273 5:26468111-26468133 CTCCTCTGCCTGGCTGCTTGAGG + Intergenic
988309744 5:29541971-29541993 CTCCTGTGCCTGGCTCAGTGGGG - Intergenic
989616420 5:43341107-43341129 ATCCTGTGCCTGGCTCAGAGGGG + Intergenic
991246796 5:64517119-64517141 ATCCTCAACCTCGCTTTATGAGG + Intronic
992648863 5:78837588-78837610 CTCCTCTTCCTTTCTTAATGTGG - Intronic
995835539 5:116396402-116396424 CTCCTCTGCTTGGCTTGAGGAGG - Intronic
997933367 5:138089950-138089972 AACCTCTTCCTGGCTGGATGTGG - Intronic
999084430 5:148874514-148874536 AAACTGTTCCTGGCTTAATGTGG + Intergenic
1000289638 5:159858554-159858576 ATCCTCTCCCTGGGTCTATGGGG + Intergenic
1003309911 6:4961608-4961630 CTCCTCTGGCTGGCTTACTATGG + Intergenic
1003911811 6:10750059-10750081 CACCCCTGCCTGGCCTAATGAGG - Intronic
1007747763 6:44053584-44053606 ATCATCAGCCTGGCTTAAAACGG + Intergenic
1008446201 6:51594977-51594999 ATCCTCTACCTGACTTAGTGTGG - Intergenic
1019861480 7:3662490-3662512 CTTCTCTGCCTTGCTAAATGGGG - Intronic
1024616943 7:51123837-51123859 AGCCTCTGCCTGGGGTGATGTGG - Intronic
1030332492 7:108286062-108286084 ATCCTATGGCTGCCTTCATGTGG - Intronic
1034298389 7:149993924-149993946 ATCCTGTGGATGGCTTAAAGTGG + Intergenic
1034807624 7:154102858-154102880 ATCCTGTGGATGGCTTAAAGTGG - Intronic
1036766835 8:11554805-11554827 ATCCGCTGCCTGGATGAAGGGGG + Exonic
1036966140 8:13300530-13300552 GTCCTCTTCGTGGCTGAATGAGG + Intronic
1037426285 8:18758353-18758375 ATCTTCTCCCTGGCTGAAAGGGG + Intronic
1039149419 8:34487002-34487024 TGCCTCTGCCAGTCTTAATGAGG + Intergenic
1043605146 8:81990901-81990923 ATCCCATGCCTGGCTCAGTGGGG - Intergenic
1043913791 8:85896510-85896532 ACCCGCTGCCTGGGTTAATCTGG - Intergenic
1044216045 8:89611861-89611883 TTTCTCTTCCTGGCTTCATGTGG + Intergenic
1044948054 8:97409457-97409479 ACTCTCCCCCTGGCTTAATGTGG - Intergenic
1049893769 9:95370-95392 CTCCTCTGCCTGGATGTATGAGG - Intergenic
1052357283 9:27518068-27518090 ATCCTCTGCCAGGCTAAGTAAGG + Intronic
1052761469 9:32596619-32596641 ATCATGTGCCTGCCTGAATGTGG + Intergenic
1053734994 9:41095454-41095476 CTCCTCTGCCTGGATGTATGAGG - Intergenic
1054360431 9:64108998-64109020 GCCCTCTGCCTCGCTTAATCTGG + Intergenic
1054693388 9:68335943-68335965 CTCCTCTGCCTGGATGTATGAGG + Intronic
1054831312 9:69628094-69628116 ATCTTCTTGCTGGCTTGATGAGG + Intronic
1057056324 9:91964041-91964063 GTCAGCTGCCTGGCTGAATGTGG - Intergenic
1057441635 9:95087883-95087905 CTCCTCTGCCTGGCTCCAGGGGG + Intergenic
1057646799 9:96884146-96884168 ATCCTCTGCCTGGCAGAAGTGGG + Intergenic
1058351733 9:104033118-104033140 ATGCTCTGTCTGGGTTGATGTGG + Intergenic
1058915921 9:109565588-109565610 CTCCTCTGGCTGGTTTAAAGAGG + Intergenic
1059676830 9:116548142-116548164 AGGCACTGCCTGGCTTAATGGGG + Intronic
1060260657 9:122071117-122071139 ATCCAGTGCCTGGCTTAGAGTGG + Intronic
1060946710 9:127573985-127574007 ATCCTCTGCCTGCTTTTCTGTGG + Intronic
1062702191 9:137913120-137913142 GTCCTCTTCCAGGCTCAATGTGG + Intronic
1203694170 Un_GL000214v1:80357-80379 GCCCTCTGCCTCGCTTAATCTGG - Intergenic
1203705383 Un_KI270742v1:37068-37090 GCCCTCTGCCTCGCTTAATCTGG + Intergenic
1203558625 Un_KI270744v1:28737-28759 GCCCTCTGCCTCGCTTAATCTGG - Intergenic
1203642103 Un_KI270751v1:23706-23728 GCCCTCTGCCTCGCTTAATCTGG + Intergenic
1186053318 X:5623690-5623712 ATCCTCTGCCTAGATTCAAGAGG + Intergenic
1187544860 X:20239765-20239787 ATCATCTTCCAGGCTTAAAGAGG + Intronic
1193374763 X:80745947-80745969 ATATTCTGCTTGGCTTACTGTGG + Intronic