ID: 1121056057

View in Genome Browser
Species Human (GRCh38)
Location 14:90854017-90854039
Sequence GTGTATACACACATGTATTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 228}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121056057 Original CRISPR GTGTATACACACATGTATTG GGG (reversed) Exonic
904047672 1:27618344-27618366 GTGAATACATACGTGTATTAAGG - Intronic
906221777 1:44086135-44086157 GAGTATAGACACTTGTGTTGAGG + Intergenic
909195264 1:72612545-72612567 TTGTATACAGACTTGTATTTTGG - Intergenic
913247479 1:116882867-116882889 GTGTGCACACAAATCTATTGGGG + Intergenic
914963655 1:152231409-152231431 CTGCATACCCACATTTATTGTGG - Intergenic
915091778 1:153431042-153431064 GTGTGCACACACATGTGATGAGG - Intergenic
917887296 1:179398928-179398950 GTGTATGCACACATGCATGCTGG + Intronic
918532530 1:185539009-185539031 GTGTATACATATATGTATATCGG - Intergenic
921566016 1:216721297-216721319 GTGTATACACACACGTGATGGGG + Intronic
923400494 1:233611793-233611815 AAATATACATACATGTATTGTGG - Intergenic
1062836004 10:636073-636095 CTGGAAACACACATGTAGTGTGG - Intronic
1063728037 10:8661284-8661306 ATATATACACATATGTATTCGGG + Intergenic
1063846987 10:10141059-10141081 GTGTGTACACTCATGTCTTTGGG + Intergenic
1064025131 10:11842814-11842836 ATGTATACATACATATATTTGGG - Intronic
1065195241 10:23257914-23257936 GTGTATACATATATGTGTGGGGG - Intergenic
1066169898 10:32830168-32830190 ATGTATATACACATGTATTAGGG - Intronic
1066627376 10:37420693-37420715 GTATATACACATATATATTTAGG - Intergenic
1067074203 10:43164432-43164454 GTGTGTGCACACATGCATGGGGG - Intronic
1069268771 10:66496988-66497010 TAGGATACAGACATGTATTGAGG - Intronic
1070063379 10:73008472-73008494 GTGTGTACACATATGTATATAGG - Intronic
1074730092 10:116362231-116362253 GTGTGTACACACATGTACATAGG + Intronic
1075224611 10:120616147-120616169 GTGTATAAACATATATATTGTGG + Intergenic
1075404384 10:122184707-122184729 GTGAATATACATATGTATTTAGG + Intronic
1076206197 10:128605964-128605986 CTGTATACACACATGAAGCGAGG - Intergenic
1076405838 10:130212149-130212171 GTGTAAACACACCAGTCTTGTGG + Intergenic
1078534981 11:12165701-12165723 GTGTATACACGCACATATGGTGG - Intronic
1080188234 11:29518084-29518106 ATGTATACACACATCTACTGTGG - Intergenic
1080235964 11:30068771-30068793 AGGTATACTTACATGTATTGAGG - Intergenic
1080909873 11:36585087-36585109 GTGAATACACACATTTTTTTTGG + Intronic
1081035621 11:38141527-38141549 GATTATACACACATATATAGTGG + Intergenic
1082755945 11:57076541-57076563 GTGTATACACACATATATGTGGG + Intergenic
1084622915 11:70285806-70285828 GTGTATACATGAATGTATTCAGG + Intronic
1085749153 11:79145129-79145151 GTCTATACACACATATTTAGAGG + Intronic
1085963548 11:81493524-81493546 GTGTATACATAAAGGAATTGAGG - Intergenic
1087285851 11:96264445-96264467 GTGTATACAAATATGTTTTACGG + Intronic
1090112698 11:123932093-123932115 GTTTATACACTCACCTATTGAGG + Intergenic
1090196023 11:124817367-124817389 ATGAATCCACACATGTTTTGGGG + Intergenic
1090708731 11:129365415-129365437 GTTTATATACACATGTATATAGG - Intergenic
1091003038 11:131926697-131926719 GTGAATCCACACAGGTGTTGGGG - Intronic
1093116467 12:15217951-15217973 GTGTACAAACACATGCAGTGGGG + Intronic
1093342412 12:17994926-17994948 GTGTATACACACTTATATAATGG - Intergenic
1093355646 12:18163708-18163730 GTGGAGACATACATGTATAGAGG + Intronic
1095245751 12:39919141-39919163 GTGTATACATATATGTATGCAGG - Intronic
1095931713 12:47634650-47634672 GTGTATATACACATATATGTGGG + Intergenic
1096001260 12:48132570-48132592 GTGAATACATACATGTATGTTGG - Intronic
1097461326 12:59866211-59866233 GTGTATACATACATATACTTAGG + Intergenic
1099106398 12:78502050-78502072 ATATATACACACATATATGGAGG + Intergenic
1100813257 12:98361312-98361334 GTGTGTTCACACATGTGGTGGGG + Intergenic
1103332632 12:120164879-120164901 GCTTATGCACACATGTATTTTGG + Intronic
1104838008 12:131804407-131804429 GTGTATAAAGATGTGTATTGGGG - Intergenic
1106056670 13:26244483-26244505 GTGTATACACACACACATAGAGG + Intergenic
1108051413 13:46444428-46444450 GTGTATACACACATGCACAGGGG + Intergenic
1109364948 13:61342326-61342348 GCTTATAGACACATGTCTTGAGG + Intergenic
1109543969 13:63818051-63818073 GTGTATACACACATGCACAGGGG + Intergenic
1109626999 13:64987637-64987659 GTGTATACACACATACACTCAGG - Intergenic
1111002507 13:82204686-82204708 TTGTTCACACACATGTATTGTGG - Intergenic
1111133670 13:84010107-84010129 GTGTATACACACATGCAGAGAGG - Intergenic
1111216505 13:85149607-85149629 ATATATACACATATGTATTCTGG - Intergenic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1113697726 13:112358845-112358867 GTGTATATGCATATGTGTTGTGG + Intergenic
1114295591 14:21326336-21326358 GTGTTTCCACACAAGTAGTGAGG - Intronic
1114840389 14:26256238-26256260 CTGTATACACAAATGCCTTGAGG - Intergenic
1115047751 14:29017983-29018005 ATATATACACACATGTATATAGG - Intergenic
1115174175 14:30543492-30543514 GTGAAAACAGACATTTATTGGGG - Intergenic
1116059614 14:39905569-39905591 GTGTGTACATAAATGTGTTGGGG + Intergenic
1119196607 14:72721717-72721739 GTGTGTACAAACATTTCTTGTGG - Intronic
1120538252 14:85723261-85723283 ATGTATACACACATATGATGTGG + Intergenic
1121056057 14:90854017-90854039 GTGTATACACACATGTATTGGGG - Exonic
1121627599 14:95397788-95397810 GTGTGTACACACATGTATGCAGG + Intergenic
1121997814 14:98617491-98617513 GTGAAAACTTACATGTATTGAGG - Intergenic
1122596416 14:102896097-102896119 GTATATACACACACACATTGCGG + Intronic
1123507099 15:20953874-20953896 GTGTATAAACACATGGCTTTGGG - Intergenic
1123564326 15:21527617-21527639 GTGTATAAACACATGGCTTTGGG - Intergenic
1123600579 15:21964900-21964922 GTGTATAAACACATGGCTTTGGG - Intergenic
1126999814 15:54489474-54489496 ATATATACACACATACATTGAGG - Intronic
1127359007 15:58228655-58228677 GTAGATACACAAATGTATAGAGG + Intronic
1130602000 15:85282101-85282123 ATGTATACACACATATATATAGG - Intergenic
1202972687 15_KI270727v1_random:254725-254747 GTGTATAAACACATGGCTTTGGG - Intergenic
1135118467 16:19744010-19744032 GTGTCTGCACACATGAATTCAGG + Intronic
1138109246 16:54310444-54310466 GTGTATCCACTCATCTGTTGAGG - Intergenic
1140587781 16:76314451-76314473 GTGTATACACACATATGTATAGG + Intronic
1140937044 16:79682369-79682391 GTGTATATATATATTTATTGAGG + Intergenic
1142769690 17:2087678-2087700 GTGTATTCAAACATGTGATGAGG + Intronic
1144411915 17:15010009-15010031 GTGTATTCACAGGTGTGTTGGGG - Intergenic
1144720378 17:17465196-17465218 AAGTAAACACACATGTAATGAGG + Intergenic
1145759428 17:27417805-27417827 GTGTGTGCACACATGTATGTAGG - Intergenic
1146292336 17:31617921-31617943 GTGTATACAAACATGGCATGTGG - Intergenic
1146472573 17:33136131-33136153 GTGTTTGCATACATGTACTGGGG + Intronic
1148763723 17:50025338-50025360 GTGTATACATACATGTATACAGG - Intergenic
1150841572 17:68612258-68612280 GTGGAGAGAGACATGTATTGTGG - Intergenic
1152746573 17:82043068-82043090 GTGTATACACGCATGTCTGTGGG - Intergenic
1154019194 18:10647805-10647827 GTGTATGCACACATGCATGTGGG - Intergenic
1154185022 18:12175419-12175441 GTGTATGCACACATGCATGTGGG + Intergenic
1156084449 18:33382240-33382262 ATGTATACATATATCTATTGGGG - Intronic
1156957585 18:42987188-42987210 GTATACACACACATGTATCATGG + Intronic
1158061064 18:53342957-53342979 ATGTATATATAGATGTATTGTGG + Intronic
1159519578 18:69500899-69500921 ATTTATAAACACATGTATTTTGG + Intronic
1160343111 18:78106933-78106955 GTGTATGCACATATGTATGCAGG - Intergenic
1163224160 19:15943938-15943960 CTGTAAACACAATTGTATTGAGG + Intergenic
1164499525 19:28804560-28804582 GTATGTACACACATGTATATAGG - Intergenic
1166313025 19:41973838-41973860 GTGTATGCATAGATGTCTTGGGG + Intronic
925461094 2:4063317-4063339 GTGTGTATACATATGTATTAGGG - Intergenic
926415798 2:12648769-12648791 GTGCATACACGCATATACTGTGG - Intergenic
927135046 2:20090885-20090907 GTGTATAGACCCGTGTAATGAGG - Intergenic
928788383 2:34918947-34918969 GGGTGTACACACATGTATCCTGG - Intergenic
929733285 2:44519264-44519286 GTTTATAAACACATGTATAGAGG - Intronic
930862058 2:56084778-56084800 GTGTATAGACATATGGTTTGTGG - Intergenic
931010482 2:57906801-57906823 GTGCAGGCAAACATGTATTGAGG + Intergenic
931164403 2:59731173-59731195 ATATATACACACATATGTTGTGG + Intergenic
931783141 2:65597183-65597205 GCATATATACACATGTATAGTGG - Intergenic
932193776 2:69765057-69765079 GTGTATACACATATATACAGTGG - Intronic
933231659 2:79814590-79814612 GTGTATACACACATATATAATGG - Intronic
934954249 2:98603768-98603790 TTGTATACAAACATATAATGTGG - Intronic
935105280 2:100037366-100037388 TTTTATACATACATGTATGGGGG + Intronic
935742608 2:106163552-106163574 GCGTATACAGACATTTATTTAGG + Intronic
937072060 2:119072017-119072039 ATTTATAAATACATGTATTGGGG - Intergenic
938155969 2:128940324-128940346 TTGTATACACATATGTTTTGGGG - Intergenic
938628591 2:133139347-133139369 GTGTGTATACACATATTTTGGGG + Intronic
939721331 2:145656185-145656207 GTGTATACATATATGTATAAAGG - Intergenic
939736129 2:145848803-145848825 TTTTATACATACATATATTGTGG + Intergenic
940051451 2:149469407-149469429 ATGTATAGACACACGTATAGAGG - Intronic
940114091 2:150188752-150188774 GGGTATACACAGATTTATTTGGG + Intergenic
940199362 2:151133026-151133048 GTGTATACACACATGCAAGGTGG - Intergenic
941092737 2:161197023-161197045 ACGTATACACACATGTATACAGG + Intronic
941316382 2:163998235-163998257 GTGTATACATACATATATTCAGG - Intergenic
943282292 2:185951242-185951264 GTGTACACATATACGTATTGTGG - Intergenic
943937071 2:193933402-193933424 GTGTATATACATATGTATCATGG + Intergenic
945234380 2:207621220-207621242 TGGTATACACACATTAATTGAGG - Intronic
1170128163 20:12988669-12988691 GTGTATCCACACAGGTTTGGAGG + Intergenic
1170402867 20:16006493-16006515 CTGAATAGCCACATGTATTGTGG + Intronic
1174856885 20:54054374-54054396 GTGTATACATATATGTATAGAGG - Intronic
1175601098 20:60273819-60273841 GTGTATGCACACAAGTACTCAGG - Intergenic
1176658136 21:9606759-9606781 GCGTATACACACATTTGTTTAGG - Intergenic
1177465579 21:21474770-21474792 GTGTATACACACACATATATGGG - Intronic
1178018924 21:28386632-28386654 GTATAGACACAAATGTATTGGGG + Intergenic
1179333243 21:40426052-40426074 CTGTGAACACACATGGATTGGGG + Intronic
1180738398 22:18035725-18035747 GTGTATACACATATGTTTGCTGG + Intergenic
1181933776 22:26425341-26425363 GTGTATACCCACATGTGTACAGG + Intergenic
1184833351 22:47005359-47005381 GTGTGTACAGACATGTGTGGAGG - Intronic
949255000 3:2035543-2035565 GTGTGTGCACACATGTGCTGAGG - Intergenic
949607431 3:5669532-5669554 GTGTATTCATAGATGTATGGAGG - Intergenic
950307573 3:11928289-11928311 GTGAATGCACACATATTTTGAGG - Intergenic
951713972 3:25618947-25618969 GTGTTCACACACATGCATTATGG - Intronic
952565051 3:34646252-34646274 GTTTAAACACTCATCTATTGAGG - Intergenic
956484248 3:69704663-69704685 TTTTATACACACATATATTTAGG + Intergenic
957128624 3:76195647-76195669 GTAGATACACACATGAAATGTGG + Intronic
957563190 3:81851723-81851745 GTATATACACACATATATGTAGG + Intergenic
957615577 3:82522168-82522190 GTGGATACACACACATATTCAGG + Intergenic
959074336 3:101734382-101734404 GTACATACACACATGCATTATGG + Intronic
960554449 3:119011967-119011989 GTGTATACACACATATATATAGG + Intronic
962018724 3:131473343-131473365 TTGAATACCCACATGTAATGAGG + Intronic
962669765 3:137693150-137693172 GTGTGTACACACCTGTGGTGGGG + Intergenic
964098496 3:152962096-152962118 GTGTATACATACATGTACATAGG + Intergenic
965565719 3:170115454-170115476 ATGTGTATACATATGTATTGTGG - Intronic
967233816 3:187366085-187366107 GTGTATAGACACAGGTATCCAGG + Intergenic
967449622 3:189609441-189609463 GTATATAAACACATGTCATGGGG + Intergenic
967737828 3:192972256-192972278 GTGTGTACACACATGTGCTATGG + Intergenic
968397196 4:251357-251379 ATGTATACACACATTTGTCGTGG + Intergenic
970334161 4:15016229-15016251 GTGTATACACATATGTAACTGGG + Intronic
970830163 4:20328857-20328879 GTACATACACACATTTATTTTGG - Intronic
972523512 4:39884897-39884919 GTGTATGGACATATGTATAGGGG + Intronic
972715093 4:41637790-41637812 GTGTGTACACTCATGCATTCTGG + Intronic
973027687 4:45293307-45293329 GTGCATGCACACATGTATTCTGG + Intergenic
973127328 4:46603756-46603778 GTATATACATATATGTATTTGGG + Intergenic
974430361 4:61789295-61789317 GTGTACACACACATATATGTTGG + Intronic
975339142 4:73218053-73218075 GTGTATACACACGCGTATGCTGG + Intronic
976177818 4:82372954-82372976 GTTTATAAGCACATGTTTTGGGG - Intronic
977158749 4:93608150-93608172 ATATATACACATATGTATTCTGG + Intronic
978708538 4:111747846-111747868 GTGTGCATACACATGTATTGGGG + Intergenic
979494785 4:121371072-121371094 GTGAAAACAAACATGGATTGTGG - Intronic
980278201 4:130683307-130683329 ATGCATACACCTATGTATTGAGG - Intergenic
981436858 4:144734142-144734164 TAGTATACACACATATATTATGG + Intronic
981437539 4:144743613-144743635 ATATATACACACATGTATTTTGG - Exonic
981468480 4:145101031-145101053 GTATATGCACACATCTATCGTGG - Intronic
981899276 4:149843246-149843268 GTACATATACACATGTTTTGAGG - Intergenic
982897181 4:160946662-160946684 GTGTGTACACATATATATTTGGG - Intergenic
983143349 4:164181180-164181202 GTGTTCACACAAATGTTTTGTGG - Intronic
983674441 4:170276133-170276155 GTGCACACAGACATGTGTTGGGG - Intergenic
985417276 4:189749314-189749336 GGGTATACACACATTTGTTTAGG + Intergenic
985632289 5:1020325-1020347 GTGTATACATACATGTATAGAGG + Intronic
986109152 5:4693757-4693779 GTGCATACACACATACATTATGG + Intergenic
986931617 5:12831120-12831142 GTGTGTACACATATGCATTTAGG - Intergenic
986965479 5:13265891-13265913 GTATATATACACATGTATATAGG - Intergenic
987331905 5:16864449-16864471 GTGTATTCACACACCTATTCAGG - Intronic
988121583 5:26970450-26970472 GTGTATACATAGATGCAGTGAGG - Intronic
989779653 5:45248587-45248609 GTACACACACATATGTATTGTGG + Intergenic
990496405 5:56352624-56352646 GTCTCTACATACATGTATTGAGG - Intergenic
991442253 5:66663202-66663224 ATGTATACACACATGCACTGAGG - Intronic
991621873 5:68553037-68553059 ATATATATACACAGGTATTGTGG + Intergenic
993095787 5:83476020-83476042 GTGTATAGATACAGGTATTCTGG - Intronic
993100207 5:83529030-83529052 ATGTATACACACATATATACAGG + Intronic
995630877 5:114130788-114130810 ATGTATACATACATGCTTTGAGG - Intergenic
996596687 5:125211206-125211228 ATGTATTCACATATGTGTTGGGG + Intergenic
1000880287 5:166689593-166689615 ATCTATACACAAATTTATTGAGG - Intergenic
1001798467 5:174522577-174522599 GTGTATATACACATCTATGTAGG + Intergenic
1001832382 5:174800100-174800122 GTGTATACATACATATGTGGTGG - Intergenic
1002837494 6:877366-877388 GTTTATACACACATAAATTCAGG + Intergenic
1004848717 6:19674261-19674283 ATGCATACACACATATATTTTGG + Intergenic
1005402745 6:25451181-25451203 TTGGATACACACATGCACTGTGG - Intronic
1005534368 6:26740423-26740445 ATGTATATATACATGTATTATGG - Intergenic
1005953118 6:30645964-30645986 GTGAATACTTACCTGTATTGGGG - Exonic
1006972738 6:38063489-38063511 GTGTATGCAAACATGTATCAGGG - Intronic
1008424456 6:51340724-51340746 ATATATACACACATGTATAAAGG + Intergenic
1010258449 6:73787849-73787871 GTGGATAAACACTTGTATTCTGG + Intronic
1010451320 6:76006456-76006478 GTGTATATACATATGTATATAGG + Intronic
1011522591 6:88225746-88225768 ATGTATATACACATGATTTGGGG - Intergenic
1012024285 6:93968337-93968359 GTGTAAACACACATTTTCTGTGG + Intergenic
1012738828 6:102987463-102987485 ATGTATATACAAATGTATTTTGG + Intergenic
1013899910 6:115142623-115142645 GTATGTACACACTTGTGTTGAGG + Intergenic
1015655921 6:135519039-135519061 TTGTATATATAAATGTATTGTGG - Intergenic
1016188381 6:141226954-141226976 GTGTATTTACACAGGTATTATGG - Intergenic
1017859986 6:158387673-158387695 GTGCACACACACATACATTGTGG + Intronic
1023935708 7:44738310-44738332 CTGTATAAACACATGCAGTGGGG + Intergenic
1025168862 7:56737724-56737746 GTGTACACACACATATATTTTGG + Intergenic
1025703528 7:63842174-63842196 GTGTATACACACATATATTTTGG - Intergenic
1028239519 7:88402599-88402621 GTATATACATACATGTATGTAGG + Intergenic
1028935353 7:96457806-96457828 GTGTATACATATATATATTTGGG - Intergenic
1029151982 7:98486924-98486946 GTGTGTGCACACATGTATCTGGG + Intergenic
1030942902 7:115677679-115677701 ATGTATACATATATGTAATGGGG + Intergenic
1031036690 7:116794955-116794977 GTGTGGACTCAGATGTATTGGGG + Intronic
1033023234 7:137748325-137748347 GTATATAAACACATCTATTGTGG + Intronic
1033038963 7:137901090-137901112 GTGTGTACATATGTGTATTGTGG + Intronic
1033887027 7:145961560-145961582 GTCTATCCACTCATGTATTGAGG + Intergenic
1036208894 8:6826337-6826359 GTGTGTGCACGCATGTAGTGTGG + Intronic
1037692779 8:21196753-21196775 GTGTATACACACACGTGTATAGG - Intergenic
1038946467 8:32366614-32366636 GTGTATATATACATATATTATGG - Intronic
1039131827 8:34273594-34273616 CTGTGTACATACATGTACTGTGG + Intergenic
1039146737 8:34455694-34455716 ATGGACACACACATGTACTGAGG + Intergenic
1039684347 8:39781236-39781258 ACATATATACACATGTATTGGGG + Intronic
1039763190 8:40600143-40600165 GTGTGTGTATACATGTATTGGGG + Intronic
1040752038 8:50722174-50722196 GTGTGTACATATATATATTGAGG + Intronic
1041372756 8:57180573-57180595 GTGTGTACACATGTGTGTTGGGG + Intergenic
1042484454 8:69335149-69335171 CTGTAAACACACGTGTTTTGTGG + Intergenic
1042493032 8:69423210-69423232 ATATATACACACATGTAGAGGGG - Intergenic
1044656863 8:94557594-94557616 GTGGACACACACATGAAGTGAGG + Intergenic
1045350042 8:101330088-101330110 GTGTATACGCACATGTGTGAGGG - Intergenic
1045499425 8:102733577-102733599 CTGTATGCACACAGGTATGGAGG + Intergenic
1046455758 8:114458726-114458748 GTGTGTACATACATGTGTTACGG - Intergenic
1048063076 8:130940461-130940483 GTATATACAACCATGTATTTGGG - Intronic
1048468705 8:134688333-134688355 GTGTATGTACACACGTTTTGCGG - Intronic
1048893406 8:138967456-138967478 TTATATACACACATATATTGTGG - Intergenic
1050766072 9:9135395-9135417 GTGTATACACACATCGATTTGGG - Intronic
1052161852 9:25272199-25272221 TTGGATACACACATGTATAGAGG + Intergenic
1053006737 9:34609839-34609861 GTGTATACAGACAGGTCTGGAGG + Intergenic
1053244414 9:36522877-36522899 GTGTATACACACATGGAAAATGG + Intergenic
1054841043 9:69740179-69740201 GTGTATACATATATGTATATAGG + Intronic
1054841056 9:69740388-69740410 GTGTATACACATATGTATACAGG + Intronic
1055107712 9:72529516-72529538 GTGTATATACATATGTGTTTAGG + Intronic
1055743034 9:79410929-79410951 GTGTACACACACATACATAGTGG - Intergenic
1056004935 9:82258901-82258923 TTGTATAAACACTTGTATTTGGG + Intergenic
1056918827 9:90768318-90768340 GTGTGTATAGACAGGTATTGTGG - Intergenic
1058570399 9:106336021-106336043 ATGGATACATACATTTATTGTGG - Intergenic
1058868368 9:109181851-109181873 GTTTATCCACTCATTTATTGGGG - Intronic
1061563761 9:131423616-131423638 GTGTATACACACCTGCTTTACGG - Intronic
1203635864 Un_KI270750v1:110334-110356 GCGTATACACACATTTGTTTAGG - Intergenic
1186322658 X:8446589-8446611 GTGGACAAACACATTTATTGAGG - Intergenic
1187451058 X:19396718-19396740 GTGTAAACACCCATGTATCTGGG - Intronic
1188015665 X:25105150-25105172 GTTAATACAAACATGTATTGAGG + Intergenic
1189218721 X:39351334-39351356 GTTTATACACTCATTGATTGAGG + Intergenic
1190394214 X:49963423-49963445 ATGTACACACATATGGATTGGGG - Intronic
1191079746 X:56496827-56496849 GTGTATGCACACACATATTAGGG - Intergenic
1191796142 X:65023799-65023821 GTGCATACATACATTTATTGTGG + Intronic
1194382720 X:93215500-93215522 GTGAATACACAGATGCACTGTGG + Intergenic
1195550556 X:106164734-106164756 CTGTATACCCACATATTTTGTGG + Intergenic
1199818645 X:151422995-151423017 GTGCATGCACACATGTATTGGGG + Intergenic