ID: 1121062179

View in Genome Browser
Species Human (GRCh38)
Location 14:90922690-90922712
Sequence CTTTGGAAGGCCAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121062179_1121062185 -8 Left 1121062179 14:90922690-90922712 CCATCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 1121062185 14:90922705-90922727 TTCCAAAGTGCTGGGATTACAGG 0: 9594
1: 299194
2: 262940
3: 149017
4: 131705
1121062179_1121062188 15 Left 1121062179 14:90922690-90922712 CCATCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 1121062188 14:90922728-90922750 CCCTTAATTTTTTAAAAGAATGG 0: 1
1: 0
2: 8
3: 69
4: 723

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121062179 Original CRISPR CTTTGGAAGGCCAAGGTGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr