ID: 1121069370

View in Genome Browser
Species Human (GRCh38)
Location 14:91003576-91003598
Sequence CCTTCTGTACTCAGGGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 154}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121069360_1121069370 6 Left 1121069360 14:91003547-91003569 CCTATCCCCAGGGCTCCAGATGA 0: 1
1: 1
2: 2
3: 27
4: 256
Right 1121069370 14:91003576-91003598 CCTTCTGTACTCAGGGTTGAAGG 0: 1
1: 0
2: 1
3: 10
4: 154
1121069364_1121069370 0 Left 1121069364 14:91003553-91003575 CCCAGGGCTCCAGATGAAGGGTG 0: 1
1: 0
2: 2
3: 22
4: 210
Right 1121069370 14:91003576-91003598 CCTTCTGTACTCAGGGTTGAAGG 0: 1
1: 0
2: 1
3: 10
4: 154
1121069358_1121069370 13 Left 1121069358 14:91003540-91003562 CCAACCTCCTATCCCCAGGGCTC 0: 1
1: 0
2: 3
3: 44
4: 414
Right 1121069370 14:91003576-91003598 CCTTCTGTACTCAGGGTTGAAGG 0: 1
1: 0
2: 1
3: 10
4: 154
1121069365_1121069370 -1 Left 1121069365 14:91003554-91003576 CCAGGGCTCCAGATGAAGGGTGC 0: 1
1: 0
2: 1
3: 13
4: 152
Right 1121069370 14:91003576-91003598 CCTTCTGTACTCAGGGTTGAAGG 0: 1
1: 0
2: 1
3: 10
4: 154
1121069366_1121069370 -9 Left 1121069366 14:91003562-91003584 CCAGATGAAGGGTGCCTTCTGTA 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1121069370 14:91003576-91003598 CCTTCTGTACTCAGGGTTGAAGG 0: 1
1: 0
2: 1
3: 10
4: 154
1121069363_1121069370 1 Left 1121069363 14:91003552-91003574 CCCCAGGGCTCCAGATGAAGGGT 0: 1
1: 0
2: 1
3: 9
4: 197
Right 1121069370 14:91003576-91003598 CCTTCTGTACTCAGGGTTGAAGG 0: 1
1: 0
2: 1
3: 10
4: 154
1121069359_1121069370 9 Left 1121069359 14:91003544-91003566 CCTCCTATCCCCAGGGCTCCAGA 0: 1
1: 0
2: 2
3: 35
4: 320
Right 1121069370 14:91003576-91003598 CCTTCTGTACTCAGGGTTGAAGG 0: 1
1: 0
2: 1
3: 10
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121069370 Original CRISPR CCTTCTGTACTCAGGGTTGA AGG Intronic
901239012 1:7682153-7682175 CCTTCTGGCCTCAGGGGTGAGGG + Intronic
905471644 1:38196616-38196638 CCCTTTGTACTTAGGGCTGAAGG + Intergenic
905875370 1:41428687-41428709 CCTTCTGTTCTCATGGTGGCTGG - Intergenic
910098732 1:83554259-83554281 CCTTCTGTTCTCAGGGCTTCAGG - Intergenic
912669279 1:111609219-111609241 CCTCCTGCACCCAGGGTTCAAGG - Intronic
913074840 1:115333177-115333199 CCTTCAGTAGTCAGAGTTGGTGG - Intronic
913531708 1:119738343-119738365 CCTTCTTTCCTCAGGATGGAGGG - Intronic
913574371 1:120155804-120155826 CCTTTTCTGCTCAGGGATGATGG - Exonic
913598084 1:120396619-120396641 TCTTCTGTACTTACAGTTGAAGG + Intergenic
914049725 1:144121452-144121474 GATTCTGGACTCAGGGTTGTAGG - Intergenic
914089245 1:144482701-144482723 TCTTCTGTACTTACAGTTGAAGG - Intergenic
914129457 1:144843999-144844021 GATTCTGGACTCAGGGTTGTAGG + Intergenic
914295641 1:146320611-146320633 CCTTTTCTGCTCAGGGATGATGG - Intergenic
914309366 1:146451514-146451536 TCTTCTGTACTTACAGTTGAAGG + Intergenic
914512310 1:148345044-148345066 TCTTCTGTACTTACAGTTGAAGG - Intergenic
914556681 1:148771392-148771414 CCTTTTCTGCTCAGGGATGATGG - Intergenic
914592745 1:149121623-149121645 TCTTCTGTACTTACAGTTGAAGG - Intergenic
914616153 1:149358838-149358860 CCTTTTCTGCTCAGGGATGATGG + Intergenic
918431126 1:184461892-184461914 CCTTCTCTACCCAGTGGTGAAGG - Intronic
920057813 1:203205638-203205660 CCTTCTGTACTCTGACTTTAGGG + Intergenic
1063465658 10:6242412-6242434 GCTTCTGTACATAGGGGTGATGG - Intergenic
1069111391 10:64451805-64451827 CCTTCTGTATTCAGTGAGGAGGG - Intergenic
1069883498 10:71608884-71608906 TCTTCTGCACTCAGAGTTAAAGG - Intronic
1070796762 10:79221457-79221479 CCTTCTGTACTGAGGAGGGAGGG - Intronic
1070913927 10:80140650-80140672 ACTTCTGCTCTGAGGGTTGATGG + Intronic
1074152958 10:110774542-110774564 GCCTCTGTCCTCAGGGCTGATGG - Intronic
1075243891 10:120803040-120803062 CCTTTTGTAGTCAGGATTAAAGG + Intergenic
1075558865 10:123453719-123453741 TCCTCTGAACTCAGGGTAGAGGG - Intergenic
1075900802 10:126041482-126041504 CCAGCAGTACTCAGGTTTGAGGG - Intronic
1076797002 10:132803244-132803266 CCTTCTGTCCTGAGGGTTGTGGG + Intergenic
1080844099 11:36011267-36011289 CCTACTATACTCAAGGTTGCAGG - Intronic
1081748285 11:45488273-45488295 CCTTCAGTGCTGAGGGTTGAGGG + Intergenic
1085389449 11:76175107-76175129 CCTCCTGCACCCAGGCTTGAGGG - Intergenic
1085738695 11:79061401-79061423 CTCACTGTACTCAGGGTAGACGG - Intronic
1088590651 11:111399863-111399885 CCTTCTGCCCTCAGGGTGGCGGG + Intronic
1088793621 11:113248689-113248711 CCCACTGAACTCAGGGTAGATGG - Intronic
1089846640 11:121464006-121464028 CCTTCTGTCCTCACAGTTGAAGG + Intronic
1096101857 12:48974379-48974401 CCTTCTGTACTCAGGCCTAATGG + Intergenic
1099539464 12:83888262-83888284 CCTTCTGGACTGTGGGTTGTTGG - Intergenic
1103741330 12:123093771-123093793 GCTTCTGGTCTCAGGGTTGGAGG - Intronic
1106298175 13:28437321-28437343 ATTTCAGGACTCAGGGTTGATGG + Intronic
1106605880 13:31228300-31228322 CCTTCTGAACTCATGGGAGATGG + Intronic
1112150592 13:96757061-96757083 TCCTCTGTTTTCAGGGTTGATGG + Intronic
1114841354 14:26266263-26266285 CCTTCTGAACTCTGTGTGGAGGG + Intergenic
1116204249 14:41841733-41841755 CTTTCTGTTCACAGGGTAGATGG + Intronic
1117180545 14:53186970-53186992 ACTTCTGTTCTGAGGGTTCAAGG + Intergenic
1117620449 14:57580896-57580918 CCTTCTGTCCTCAGGAACGAAGG - Intronic
1119409305 14:74419764-74419786 ACTTCTGAACTCAGTCTTGAAGG + Intronic
1121069370 14:91003576-91003598 CCTTCTGTACTCAGGGTTGAAGG + Intronic
1121363575 14:93286176-93286198 CCTTCTCTAGTCAGGGTTAGTGG - Intronic
1123134370 14:106013345-106013367 CCTTGTGCACTCAGAGGTGAGGG - Intergenic
1123584397 15:21743789-21743811 CCTTGTGCACTCAGAGGTGAGGG - Intergenic
1123621044 15:22186396-22186418 CCTTGTGCACTCAGAGGTGAGGG - Intergenic
1123854549 15:24394545-24394567 CATTCTCTATTCAGGGTAGAGGG - Intergenic
1125196059 15:37047355-37047377 CCTTCTGTGTTTAGGGCTGAAGG - Intronic
1128646669 15:69383453-69383475 CCCTCTGTGCTCATGGTGGAGGG + Intronic
1128646690 15:69383544-69383566 CCCTCTGTATTCATGGTGGAGGG + Intronic
1128646718 15:69383665-69383687 CCCTCTGTATTCATGGTGGAGGG + Intronic
1128646795 15:69383996-69384018 CCCTCTGTATTCATGGTGGAGGG + Intronic
1132657677 16:1048204-1048226 CCTTTGCTACTCAGGGTTCAGGG - Intergenic
1134191361 16:12123704-12123726 CCTTCTTCATTCAGGGCTGAAGG - Intronic
1137434798 16:48446511-48446533 GCTTCTGTACCCTGGGATGATGG - Intronic
1138439186 16:57024154-57024176 CCCTATGTCCTCAGTGTTGAAGG + Intronic
1141573583 16:84949918-84949940 GCTGCTGTACTCATGGTTGGTGG - Intergenic
1142785195 17:2216033-2216055 ACATCTGCACTCAGGGCTGAGGG - Intronic
1144667224 17:17110216-17110238 GCTGCTCTACTCAGGGTGGAAGG - Intronic
1149206477 17:54253786-54253808 CCATCAGTATCCAGGGTTGAGGG + Intergenic
1150120178 17:62594688-62594710 CATTCCCCACTCAGGGTTGAGGG + Intronic
1150584031 17:66501437-66501459 CCTTCTCTACTCAGCGTGTATGG - Intronic
1151823312 17:76509054-76509076 TATTCTGGACTCAGGGCTGATGG - Intergenic
1155218721 18:23665514-23665536 CCCTGTGGAATCAGGGTTGAGGG - Intergenic
1156452958 18:37276956-37276978 CCTTCTGTATTCAAGGTGGTTGG + Intronic
1158888166 18:61848667-61848689 CCTACTGACCTCAGGGTGGAGGG + Intronic
1160690663 19:459518-459540 CCTTCTCAACTCAGTGTAGAGGG + Intronic
1160690690 19:459634-459656 CCTTCTCAACTCAGTGTAGAGGG + Intronic
1161071845 19:2266404-2266426 TCTTCTGAAATCAAGGTTGAGGG - Intronic
1161968448 19:7561797-7561819 CCTTCTGTGCTCAGGATGGCTGG + Intergenic
1165645955 19:37437300-37437322 CCTTCTGTACTCAGTTTTTGAGG - Intronic
1167300395 19:48674331-48674353 CCTTCTGTGCTCTAGGTTGTTGG + Intergenic
1202689115 1_KI270712v1_random:74015-74037 GATTCTGGACTCAGGGTTGTAGG - Intergenic
926109624 2:10173615-10173637 CCTTCTCTACTGAGGCATGAGGG - Intronic
927857712 2:26537669-26537691 CCCTCTGGGCTCAGGGCTGAGGG + Intronic
928312403 2:30221781-30221803 CCTTCTGTACACAGGGAAGCGGG - Intergenic
931088500 2:58861330-58861352 CTTTCTGTGCTAAGGGTTCAAGG - Intergenic
931599347 2:63988191-63988213 CCTTCTATACCCAGTTTTGAGGG + Intronic
933957323 2:87382090-87382112 GATTCTGGACTCAGGGTTGTAGG + Intergenic
934241440 2:90273986-90274008 GATTCTGGACTCAGGGTTGTAGG + Intergenic
934271734 2:91542698-91542720 GATTCTGGACTCAGGGTTGTAGG - Intergenic
937856055 2:126672678-126672700 CCTTCTCCCCTCAGGGTGGAGGG + Intronic
942541713 2:177021986-177022008 CCTTCCGTACTCAGACTTGCTGG + Intergenic
945739842 2:213645891-213645913 CCATCTGTGCTGAGGTTTGAAGG + Intronic
945797006 2:214377708-214377730 CCTTCAATACTCAGGGGTTAGGG - Intronic
947504395 2:230695946-230695968 CCTAATGTAATTAGGGTTGATGG - Intergenic
947996853 2:234535074-234535096 GCTTCTGTGCTCAGGGTTGAGGG - Intergenic
948167034 2:235870850-235870872 CCTGCTGTACTTAAAGTTGAGGG + Intronic
948313314 2:237006450-237006472 CCTTCTTTATTCAGGGATTATGG - Intergenic
948484618 2:238272442-238272464 CCCTCTGGGCTCAGGGTTGGGGG + Intronic
1169418107 20:5434602-5434624 CCTTCTGTACCCAATGCTGAGGG + Intergenic
1170381013 20:15759655-15759677 CCTTCTGCCCTTAGGTTTGATGG + Intronic
1171773556 20:29345840-29345862 CCTTCTGAACTCAGGGAACAAGG + Intergenic
1171815586 20:29783389-29783411 CCTTCTGAACTCAGGGACCATGG + Intergenic
1173324264 20:42018399-42018421 CCTTCTGTGGGCTGGGTTGATGG + Intergenic
1176424879 21:6542230-6542252 CCTCCTTTACTCAAGGTGGACGG - Intergenic
1179631465 21:42681151-42681173 CATTCTGTAAATAGGGTTGATGG - Intronic
1179700368 21:43150539-43150561 CCTCCTTTACTCAAGGTGGACGG - Intergenic
1180336181 22:11578616-11578638 CCTTCTGAACTCAGGGACCATGG - Intergenic
1180618061 22:17141393-17141415 CCTTGTGCACCCAGGGTGGATGG - Intronic
1180832357 22:18912598-18912620 CCTTGTGGAGTCAGGGTTGGGGG + Intronic
1181067486 22:20313744-20313766 CCTTGTGGAGTCAGGGTTGGGGG - Intergenic
1181888386 22:26039798-26039820 CTTTGGGGACTCAGGGTTGAGGG - Intergenic
1184549150 22:45195254-45195276 CCCTCTGTTCTCAGAGGTGAGGG - Intronic
1184855990 22:47147080-47147102 CCTTCTGGACTCAGGCTGGGCGG - Intronic
1203282443 22_KI270734v1_random:137903-137925 CCTTGTGGAGTCAGGGTTGGGGG + Intergenic
949242636 3:1890266-1890288 CCTTCTCGACTCAGGTATGATGG - Intergenic
949711479 3:6875927-6875949 CTTTCTCTACTCAGTCTTGATGG + Intronic
952726160 3:36587383-36587405 CCTTCTATACTCAGGTTTTGAGG - Intergenic
952786605 3:37161616-37161638 CCTTCTGGAATTAGGGCTGATGG + Intronic
955112436 3:55961997-55962019 CCTACTGTCCTCAGGGTGGTAGG + Intronic
958592858 3:96181746-96181768 CCTTCTCCATTCATGGTTGATGG - Intergenic
961386473 3:126525838-126525860 CCTACTCTACCCAGGTTTGAGGG + Intronic
962926236 3:139995728-139995750 CCATCTGTGCTCAGGGGTAAAGG + Intronic
968974736 4:3816117-3816139 CCCTCTCTCCTCAGGGTTGAAGG + Intergenic
976017033 4:80568796-80568818 CCTTTTAGACTGAGGGTTGAGGG + Intronic
977667437 4:99657011-99657033 CATTATGTACTCAGGGATTAAGG + Intergenic
980255773 4:130379378-130379400 CTTGCTATACTCAGAGTTGAGGG - Intergenic
985677930 5:1242030-1242052 CCTTCTGTCCTCAGGGCTTAAGG - Intronic
988338763 5:29941483-29941505 ACTTATGGACTCAGGCTTGAAGG + Intergenic
991712369 5:69420145-69420167 CCTTTTGTACTCGTGGTTGCTGG + Exonic
997071254 5:130625103-130625125 CCTTCTGTATTCAAGGTTCAAGG - Intergenic
998136965 5:139678998-139679020 CCTGCTCTACTCAGGTTTCAAGG - Intronic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
1000257372 5:159552825-159552847 CCTTTTCTAGTCAGGCTTGAGGG - Intergenic
1002866311 6:1125278-1125300 CCTTCTGGACTGAGGGTAGGTGG - Intergenic
1006003732 6:30986804-30986826 CGTTCTGGACTCAGAGTTGGTGG - Exonic
1007484770 6:42173480-42173502 CCTTCTTTGCTCAGGCCTGAAGG + Exonic
1008013554 6:46492051-46492073 CCTTCTGTCCTCAGGTCTGATGG - Intergenic
1008717409 6:54305854-54305876 CCTTCTCTACTGAGGGCTGCTGG - Intergenic
1011125988 6:84008394-84008416 CCTTCTGTTTTCAGGGAAGATGG + Intergenic
1015885744 6:137916238-137916260 CCTTCTGTCCTCATGCTTGTTGG - Intergenic
1019578209 7:1747692-1747714 CCTGCTGGACTCAGGGTGGGTGG + Exonic
1020924318 7:14305646-14305668 GCTACTGGCCTCAGGGTTGACGG + Intronic
1022044253 7:26610725-26610747 CCTTCTGTTCTCAGGGAAGAGGG - Intergenic
1032721485 7:134553862-134553884 CCTTCTGTACTCCCTGTTCAAGG - Intronic
1034012711 7:147547398-147547420 GCTTCTGTGCTCAGTGTTAATGG - Intronic
1037628421 8:20629285-20629307 CCTTGTGTAGACAGGGTTCAGGG + Intergenic
1039572996 8:38602081-38602103 CCTCCTGTTCTCCGGGTTGCTGG - Intergenic
1039837722 8:41270011-41270033 TCTTCGGCACTTAGGGTTGAGGG - Intronic
1039919198 8:41881475-41881497 CCTTCTGTACTCAGGGGGTTTGG + Intronic
1040108640 8:43555321-43555343 CCTTCTGTACTCCTTGTTCAAGG + Intergenic
1044768940 8:95608884-95608906 CTTTGTGTACTCAGGACTGATGG + Intergenic
1045566721 8:103324370-103324392 CCTTATGTATTCATGATTGATGG - Intronic
1049033086 8:140051390-140051412 GCTTCTGAATCCAGGGTTGAGGG - Intronic
1051081070 9:13294118-13294140 CCTTCTGTATTCTGAGTTTAAGG - Intergenic
1053299382 9:36937813-36937835 CCTGCTGTCCTCTGAGTTGACGG - Intronic
1053826274 9:42028021-42028043 CCTTCTGTACTAAAGGAAGATGG + Intronic
1054604286 9:67159376-67159398 CCTTCTGTACTAAAGGAAGATGG - Intergenic
1056908091 9:90671934-90671956 ATTTCTGTACTCACGGTGGAAGG - Intergenic
1060442493 9:123654926-123654948 GCTTCTGAACTGAGGCTTGATGG - Intronic
1060807429 9:126586465-126586487 CCTTCTGGTGTCAGGGATGAGGG - Intergenic
1189464646 X:41269173-41269195 CCCTCTGTTCTCAGGGTGGCAGG + Intergenic
1190145646 X:47889510-47889532 CCATCTGTTTTCAGGGCTGAGGG + Intronic
1196174967 X:112630390-112630412 CCATCTGTGCTCAAGGTCGATGG - Intergenic
1197103216 X:122680960-122680982 CCATCTGCAGTCAGTGTTGAAGG - Intergenic
1197921206 X:131596426-131596448 CTTTCTTTACTTAGGGGTGACGG + Intergenic
1198250449 X:134874753-134874775 CTTTCTGTTCTCAAGTTTGATGG - Intergenic
1200314730 X:155119896-155119918 CTTTCTGTGCTCATGGTTGGGGG + Intronic