ID: 1121072587

View in Genome Browser
Species Human (GRCh38)
Location 14:91037988-91038010
Sequence CTATTGTTCTGGAGGAAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 215}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121072583_1121072587 8 Left 1121072583 14:91037957-91037979 CCTGATTAGGCTATGCTGAGATT 0: 1
1: 2
2: 0
3: 6
4: 87
Right 1121072587 14:91037988-91038010 CTATTGTTCTGGAGGAAATAGGG 0: 1
1: 0
2: 1
3: 12
4: 215
1121072579_1121072587 28 Left 1121072579 14:91037937-91037959 CCCAGAATAAGAAAAACATCCCT 0: 1
1: 0
2: 1
3: 38
4: 499
Right 1121072587 14:91037988-91038010 CTATTGTTCTGGAGGAAATAGGG 0: 1
1: 0
2: 1
3: 12
4: 215
1121072582_1121072587 9 Left 1121072582 14:91037956-91037978 CCCTGATTAGGCTATGCTGAGAT 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1121072587 14:91037988-91038010 CTATTGTTCTGGAGGAAATAGGG 0: 1
1: 0
2: 1
3: 12
4: 215
1121072580_1121072587 27 Left 1121072580 14:91037938-91037960 CCAGAATAAGAAAAACATCCCTG 0: 1
1: 0
2: 1
3: 37
4: 318
Right 1121072587 14:91037988-91038010 CTATTGTTCTGGAGGAAATAGGG 0: 1
1: 0
2: 1
3: 12
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121072587 Original CRISPR CTATTGTTCTGGAGGAAATA GGG Intronic
906457751 1:46011697-46011719 GTCTTGGTCTGGAGGTAATAAGG - Intronic
909359940 1:74748210-74748232 CTACTGAGCTGGAGAAAATAAGG + Intronic
910008040 1:82424293-82424315 CCATTGTTCTGGAGGCAGGAAGG + Intergenic
910238113 1:85056975-85056997 CTGTTTTTCTAGTGGAAATAGGG + Intronic
910425908 1:87119967-87119989 CTCTTGCTCTGGAGGGACTAAGG - Intronic
911863409 1:102985286-102985308 GTATTTTACTGGATGAAATAAGG + Intronic
916521724 1:165569529-165569551 CTCTTATTGTGAAGGAAATAGGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917751620 1:178058468-178058490 CTTTTGTTCTCTGGGAAATATGG + Intergenic
918125122 1:181576682-181576704 AGATTGTTCTGGAGGGATTATGG + Intronic
918590636 1:186237216-186237238 CTGTTGCTCTGGAGGACATCTGG - Intergenic
919066739 1:192701096-192701118 AGTTTTTTCTGGAGGAAATAAGG + Intergenic
919413413 1:197275694-197275716 CTATTTGTCCCGAGGAAATATGG - Intronic
923043411 1:230336576-230336598 CTATGGCTTTGGAAGAAATAGGG - Intronic
923151659 1:231238933-231238955 CTATTGTTCTTTAGGGAAGAGGG + Exonic
1063597146 10:7445759-7445781 CTGTTGTTCTAGAAGAAAAAAGG - Intergenic
1065062212 10:21914323-21914345 CCAGTGCTCTGGAGGTAATAAGG + Intronic
1066062851 10:31739480-31739502 CTATGGGTCTGGAGGCAATGAGG - Intergenic
1068313111 10:55305067-55305089 TTTTTGTTCTGGATGGAATATGG - Intronic
1068666632 10:59683129-59683151 CTATTCTTATGGGGAAAATAAGG - Intronic
1069044962 10:63733624-63733646 TTCTTGTTCTGGAGGAAACTTGG + Intergenic
1069361311 10:67645418-67645440 CCATTGTTATAGAGCAAATAAGG + Intronic
1072989349 10:100176336-100176358 CCATTATTTTGGAGGTAATAAGG + Intronic
1073644948 10:105292228-105292250 ATTTTGTTCTGGAGGAAACACGG + Intergenic
1074679631 10:115891290-115891312 ATAGTGTTCTGGAAGAAAAAGGG + Intronic
1076002695 10:126924637-126924659 CTGTTCTTCTGGAGGCAACACGG - Intronic
1077151850 11:1076324-1076346 TCATTGTTCTGGAGACAATAGGG - Intergenic
1078643778 11:13119545-13119567 CTGTTGTTATTGAGAAAATAGGG - Intergenic
1078748292 11:14136345-14136367 CAAGTGCTCTGGAGGAAGTAAGG + Intronic
1080515949 11:33020376-33020398 CTATTGTTTTCAAGCAAATAAGG + Intronic
1082020415 11:47528240-47528262 GTATTTCTCTTGAGGAAATAAGG - Intronic
1086768236 11:90727136-90727158 ATACTTTCCTGGAGGAAATAGGG - Intergenic
1087678735 11:101193647-101193669 CTAATGTTCTTGAGAAAATGTGG + Intergenic
1088134099 11:106532592-106532614 CTAATATTTTGGAGGAAAGAGGG + Intergenic
1089268970 11:117288166-117288188 CTCTTGTGGTGGAGGACATAAGG + Exonic
1092567262 12:9680507-9680529 GCATTGTTTTGGAGGAAAAAAGG - Intronic
1093268789 12:17031995-17032017 ATGTTGTTCTGTAGGAATTAGGG - Intergenic
1093723509 12:22474742-22474764 CTTTTGTTTTGGAGGTAATGTGG - Exonic
1094270978 12:28614050-28614072 CTATTGTTCTGGAGGCTCTGGGG + Intergenic
1095358636 12:41307687-41307709 AGATTGTTCTGGAAGAAATGTGG - Intronic
1096442170 12:51652481-51652503 CTTTTATTCTGAAGGCAATAAGG - Intronic
1097040390 12:56152858-56152880 CTTTTGTTCTGGGGTAAATTAGG - Intronic
1097901393 12:64876967-64876989 CTATTGCACTGAAGGAAATGTGG - Intronic
1099164688 12:79289494-79289516 CAATTATTCTGCATGAAATAGGG - Intronic
1099703286 12:86117158-86117180 TTATTGTTCTGAAGGAAATGAGG - Intronic
1100405400 12:94268382-94268404 TTATGGTCCTGGAGGAAGTATGG - Intronic
1100715202 12:97298348-97298370 CAGCTGTTCTGGAGGGAATATGG + Intergenic
1106109965 13:26768107-26768129 CTATTGTTTGGGAGTAAAAAGGG + Intergenic
1106210691 13:27641720-27641742 CTATTGATGTGGAGCAAACAGGG + Intronic
1106351707 13:28936990-28937012 CTGGGGTTGTGGAGGAAATAGGG + Intronic
1106828973 13:33557549-33557571 TTACTGTCCTGCAGGAAATACGG - Intergenic
1107216999 13:37933759-37933781 CTATTGTTCTTGTGTAAATAAGG + Intergenic
1107451348 13:40512873-40512895 CTATTTTACTGGGGGAAAGAGGG - Intergenic
1109177243 13:59171624-59171646 CTATTATTTCAGAGGAAATACGG + Intergenic
1109795435 13:67306192-67306214 CTATTTTTGTGAAGCAAATAGGG + Intergenic
1109908358 13:68875392-68875414 CAATTGTACCAGAGGAAATATGG - Intergenic
1110948571 13:81455834-81455856 TTATGATTCTGGAGGAAAAAAGG + Intergenic
1111577618 13:90177562-90177584 CTATAGTTCTTGAGCAATTAGGG - Intergenic
1112285307 13:98098807-98098829 CTTTTGTTGTGGAAGAAATCTGG - Intergenic
1113174523 13:107546868-107546890 TTATGGTATTGGAGGAAATATGG + Intronic
1114772922 14:25449673-25449695 GAATTATTGTGGAGGAAATATGG - Intergenic
1115688511 14:35821329-35821351 TTCTTGTTCTAAAGGAAATATGG - Intergenic
1118034104 14:61848399-61848421 CTTTTGTTTTGGAGAAAGTAAGG - Intergenic
1120632510 14:86907727-86907749 CTTTTCTTCTGTAGGAATTAGGG - Intronic
1121072587 14:91037988-91038010 CTATTGTTCTGGAGGAAATAGGG + Intronic
1128890546 15:71328021-71328043 CTATTGTAATGGAGGAAAGAAGG - Intronic
1131319551 15:91373964-91373986 CTCTATTTCTGGAGGACATAAGG + Intergenic
1134414890 16:14034695-14034717 CTGGTGTTTTGGAGGAAATTTGG - Intergenic
1137355176 16:47755582-47755604 CTAACGTTCAAGAGGAAATAGGG - Intergenic
1139393254 16:66619639-66619661 CGAAAGTTCTGGAGGGAATAGGG - Intronic
1139417090 16:66821491-66821513 CTTTTGATCTGTAGGACATATGG - Exonic
1140189552 16:72803508-72803530 ATATTGTTCTGCAGGAAAATTGG - Intronic
1143092918 17:4459900-4459922 GTATTGTTGGGAAGGAAATAGGG + Intronic
1143223059 17:5278669-5278691 CTTATGTTCTGAAGGAAATTGGG - Intergenic
1144324204 17:14162009-14162031 CCATTGTGCTGTAAGAAATACGG - Intronic
1145107596 17:20132427-20132449 CTTTTTTTCTGGAAGAAATTAGG + Intronic
1149155663 17:53626851-53626873 GTCTGGTTGTGGAGGAAATAGGG + Intergenic
1153571353 18:6476400-6476422 CTCTTGTGCTGCAGGAGATAAGG + Intergenic
1153767184 18:8385712-8385734 CTTTTGCTTTGAAGGAAATAAGG + Intronic
1155548316 18:26938693-26938715 TTAATGTTCTGCAGGCAATATGG + Intronic
1156071264 18:33213332-33213354 CTCTTCTTCTACAGGAAATAAGG + Intronic
1156631413 18:38973917-38973939 CTATTGTGCTGGAGCAAGTGGGG + Intergenic
1158195523 18:54881132-54881154 CTAGTGTTCTGGAGCAAAAGGGG + Intronic
1159103767 18:63982809-63982831 CTAATATTCTGGGGGAAATGTGG - Intronic
1159635871 18:70804398-70804420 ATTTTGCTCTGGAGAAAATACGG - Intergenic
1167005644 19:46774983-46775005 CTGTTATTGTGGAGGGAATAGGG + Exonic
1167761691 19:51453931-51453953 CTATTCTTGGGGAGGAAAAATGG + Intronic
1168081382 19:54012729-54012751 GTATGTTTCTGGAGGGAATATGG - Intergenic
925699875 2:6625667-6625689 CAATAGTTTTGGAAGAAATAAGG - Intergenic
926447199 2:12957438-12957460 CTTTTGTTCTGTAGGGAAGATGG + Intergenic
926959254 2:18336309-18336331 CGTTTATTTTGGAGGAAATAGGG + Intronic
928868820 2:35950498-35950520 CTATTGTTCTAGAAGATCTAAGG + Intergenic
930544973 2:52755876-52755898 CTATAGTTCTGGAAGAAATTTGG + Intergenic
932778731 2:74546358-74546380 CTTTTGTTCTGTGGGAGATAAGG - Intronic
933032087 2:77341491-77341513 ACATTGTTTTAGAGGAAATATGG - Intronic
935317097 2:101845843-101845865 CCATTTTTCTGGGGGAAAAAAGG - Intronic
938561395 2:132475364-132475386 CTATTGGTCTGGAGGTCATGAGG + Intronic
939437822 2:142201302-142201324 TTATTGTGTTGTAGGAAATAGGG - Intergenic
939538632 2:143464220-143464242 CTATTTTTCTATAAGAAATAAGG + Intronic
940388277 2:153100493-153100515 AAATTGTTTTGGAAGAAATAAGG + Intergenic
940646360 2:156396698-156396720 CTATTGATATGGGGGAAATGGGG + Intergenic
941179291 2:162238615-162238637 CTATTCTTATGGAGAAAATATGG - Intronic
941571945 2:167181628-167181650 TATTTGTTCTGGAGGAAAAAAGG - Intronic
942207910 2:173640710-173640732 CTGTTGTTCTGCATGACATATGG - Intergenic
942426634 2:175867218-175867240 CTATTTTTCTGAAGGAAGGAGGG + Intergenic
942897583 2:181076118-181076140 CTGTTGGCCTGGAGGAAACATGG - Intronic
944963246 2:204900951-204900973 CAATTGTTTGGGAGAAAATAAGG - Intronic
946043453 2:216802336-216802358 CCTTTGTTCTGAAGGATATAGGG + Intergenic
947326370 2:228982928-228982950 CTATGTATCTGGAGGAAATGAGG + Intronic
1169461191 20:5797141-5797163 CTACTCTTCTTGATGAAATAAGG + Intronic
1170173423 20:13440820-13440842 CTATAGTTGAGTAGGAAATATGG + Intronic
1170367297 20:15611712-15611734 CATTTGTTCTTGTGGAAATATGG + Intronic
1173126199 20:40338385-40338407 CTACAGATCTGGAGGAAATTAGG + Intergenic
1173817163 20:45997177-45997199 CATTTATTCTGGAGGCAATAAGG + Intergenic
1175474357 20:59260121-59260143 CTATTGTCTTGGAGAAAAAATGG - Intergenic
1175474550 20:59262155-59262177 CTATTGTCTTGGAGAAAAAATGG - Intergenic
1175973968 20:62701154-62701176 CTGATGTTTTGGAGGAAACAGGG - Intergenic
1177091416 21:16773751-16773773 TTATTTTTCTCTAGGAAATATGG + Intergenic
1178491912 21:33057866-33057888 CTCTTGTTCTGGAAGCCATATGG - Intergenic
1181994904 22:26869686-26869708 CTATTGTTCTGGAGAGGATGTGG + Intergenic
1182001456 22:26923263-26923285 CGATTGCTCTGGGGGAAAAAGGG + Intergenic
949742364 3:7251112-7251134 CTATTATTCTGTAGGCAATTGGG + Intronic
949843301 3:8343546-8343568 CTGGTGTTCTGGAAGAAAAATGG + Intergenic
952377612 3:32780669-32780691 CAATTGTCCTGGAGGATTTAGGG + Intergenic
955336628 3:58091975-58091997 CTAGTGTTCTGTTGGACATATGG - Intronic
957955361 3:87179239-87179261 CTATTGTCCCAGAGGAACTAGGG + Intergenic
959459841 3:106612173-106612195 TTATTGTTTTGGAGGAAAGAAGG - Intergenic
959947107 3:112136892-112136914 CTTTTTTTCTGAAGGTAATAGGG - Intergenic
960260450 3:115562103-115562125 CGATTGTACTGAATGAAATAGGG - Intergenic
960406904 3:117272335-117272357 CTTATTTTCTGGAAGAAATAAGG + Intergenic
961089950 3:124102413-124102435 ATATTTTTCTGGAGGACATCAGG - Intronic
963949716 3:151185554-151185576 CTTTTGCTCTTGAGGAAAAAAGG + Intronic
964131510 3:153293203-153293225 CTATTTTTCTGTATGAAATGGGG - Intergenic
964301663 3:155293815-155293837 CTATTATTATGGAGGAAACGAGG + Intergenic
965264561 3:166524663-166524685 TTATATTTCTGTAGGAAATATGG + Intergenic
965350285 3:167603257-167603279 CTATAGTGCTGGAAAAAATAAGG - Intronic
965960183 3:174419891-174419913 CTATTTTTCTGGTAGTAATATGG - Intergenic
970782543 4:19755762-19755784 CTTTTTTTCTGGAGGATCTAGGG - Intergenic
971670849 4:29555273-29555295 CTACTGTTCAAGAGGAAAAATGG + Intergenic
974155152 4:58062002-58062024 CTATTTTTCTGGAAGAAAATGGG - Intergenic
974625065 4:64415777-64415799 CTATTGTATTGTAAGAAATACGG + Intergenic
975786730 4:77897932-77897954 CAATTGTTGTAGATGAAATATGG + Intronic
975788221 4:77917675-77917697 GTATTTTTCTTGAGGAAAAAAGG - Intronic
977723860 4:100271362-100271384 CTCTTGTGGTGGAGGAAAGAGGG + Intergenic
978326636 4:107564739-107564761 CTATTTTGCAGGAGGAAATCTGG - Intergenic
979087836 4:116436331-116436353 CTTTTGTTCTGAAGGAGAAATGG + Intergenic
980305519 4:131055666-131055688 ATATTCTTCTGGAGTAAAAATGG - Intergenic
980834323 4:138172727-138172749 CAATGGTTCTGAAGGAAAAAAGG - Intronic
983008169 4:162511227-162511249 CTACTGTTCTGGGGGTAATCTGG + Intergenic
983783802 4:171706668-171706690 CTATAGTTCTGTAAGAAAAATGG - Intergenic
987569517 5:19638383-19638405 CTAATGTTATGCAGTAAATATGG + Intronic
988407656 5:30844658-30844680 CTATATTTTTGGAGGTAATATGG - Intergenic
990144482 5:52743615-52743637 CTATAAATGTGGAGGAAATAGGG + Intergenic
990196683 5:53324795-53324817 CTATTGATCTGGATGACATGAGG + Intergenic
991948460 5:71924949-71924971 TTATTCTTCTGGAAAAAATATGG + Intergenic
992406250 5:76460421-76460443 AACTTGTTCTGTAGGAAATAGGG + Intronic
993838190 5:92841542-92841564 CTATTGTTTTGGAAGATAAAGGG - Intergenic
994491851 5:100457875-100457897 CTACTGTCTTGGAAGAAATAAGG + Intergenic
995390182 5:111632200-111632222 CTTTTTTTCTGTAGGTAATATGG - Intergenic
995791129 5:115888644-115888666 ATATTGTTCTGGATTAAATGTGG + Intronic
996602685 5:125284283-125284305 CTATTTTTCAGGAAGAAAAATGG + Intergenic
998547070 5:143038489-143038511 GAATTGGTCTTGAGGAAATAAGG + Intronic
1003894733 6:10596553-10596575 CCGTTTTTCTGGAGGAAAAATGG + Intronic
1004169050 6:13281656-13281678 CTGTTTATCTGGAGTAAATATGG + Intronic
1004405230 6:15326986-15327008 TTGTTGTTCTTGAGGAAATGAGG + Intronic
1005279295 6:24254929-24254951 CAAGTGTTTTGGAGGAAATTGGG + Intronic
1008865207 6:56202270-56202292 TTGTTTTTCTGGAGGAAAAAGGG + Intronic
1009362687 6:62834983-62835005 CTAATATTCAGGAGGAAAGAGGG + Intergenic
1010898480 6:81396126-81396148 CTGTTGTTTTGGAGGGAATAAGG - Intergenic
1011256977 6:85432417-85432439 CTAGTTTTCTGGTGGAAAAAGGG + Intergenic
1013318646 6:108965462-108965484 CTATTGTAATTGAGAAAATACGG + Intronic
1013393627 6:109712779-109712801 CAGTTGTTTTGGAGGAAAAAAGG + Intronic
1014830526 6:126098005-126098027 TTAGTGTTCTGGAAGAAATTTGG - Intergenic
1015511875 6:134045856-134045878 CAATTGTTATGCTGGAAATAAGG - Intronic
1017220496 6:151960647-151960669 CTTTTATTCTGAAGGAAATGAGG + Intronic
1017953143 6:159154996-159155018 CTATTGTTCAGCAGGGAAAATGG - Intergenic
1019574866 7:1732564-1732586 CTATTTTTCTGGTGTAAAGAAGG - Intronic
1021568119 7:22034623-22034645 GTATTGTGCTGATGGAAATAGGG - Intergenic
1023652912 7:42389747-42389769 CTACTGTACTAGAGGAAAGATGG - Intergenic
1027648511 7:80835694-80835716 CTATTATTTTTGAGCAAATATGG - Intronic
1028069922 7:86438948-86438970 CTAGAGTACTGGAGGAAAAATGG - Intergenic
1028249277 7:88521844-88521866 GTATAGTACTGAAGGAAATATGG + Intergenic
1028855298 7:95585541-95585563 CGTTTGTTTTGGAGGAAACAAGG + Exonic
1029098826 7:98110749-98110771 CTATTGTTCTGCAGCATATTAGG + Intronic
1031140234 7:117934553-117934575 CTATTTTTCTGGAGGAAATTTGG - Intergenic
1032493023 7:132338898-132338920 CTAAAGTTATGGAGGAAGTATGG + Intronic
1033026442 7:137777962-137777984 GTATTCTTGTTGAGGAAATAAGG - Intronic
1033374762 7:140747655-140747677 ATATTTTTCTGGAGGAATTATGG - Intronic
1033859127 7:145603367-145603389 CTATTTTCCTAGAGGACATAGGG + Intergenic
1036688168 8:10925234-10925256 CTGTTGTTCTGGAGGAGGAAAGG + Intronic
1041707270 8:60859825-60859847 ATTTTGTCCTGGAGGTAATAGGG + Intronic
1043047162 8:75341013-75341035 GCATTGTTCTGGAGTAAAAAGGG + Intergenic
1045058603 8:98392338-98392360 GTATTGTTTAGGATGAAATATGG - Intergenic
1045499889 8:102737161-102737183 TTACTGTTCTGGAGGACAAAAGG + Intergenic
1045605132 8:103764754-103764776 AAATTCTTCTGGGGGAAATATGG - Intronic
1045623279 8:104008554-104008576 CTAATTTTCTTGAGGAAATTGGG + Intronic
1046312557 8:112457454-112457476 ATATCATTCTGCAGGAAATATGG - Intronic
1046895272 8:119464615-119464637 TTGTTGTTTTGGAGGAAAGAAGG - Intergenic
1047348845 8:124054194-124054216 CTAGTGTTCTGGAAGGAATGTGG - Intronic
1048010768 8:130453957-130453979 ATATTGCCCTGGAGGAAACAGGG - Intergenic
1051095679 9:13463037-13463059 CTACTTTACTGGAGGAGATAAGG - Intergenic
1051957235 9:22711239-22711261 ATTCTGTTCTGGAGGAAACAAGG - Intergenic
1052472178 9:28913669-28913691 CTTTAATTTTGGAGGAAATATGG - Intergenic
1052546483 9:29887450-29887472 CTATTGTGCTGGAGTTAGTATGG + Intergenic
1053380401 9:37644632-37644654 CTATTGTTGGGGAGGAAAGATGG - Intronic
1054254169 9:62748066-62748088 CTATTGGTATGGAGGACAGAAGG - Intergenic
1054568234 9:66782236-66782258 CTATTGGTATGGAGGACAGAAGG - Intergenic
1056201207 9:84278540-84278562 TGCTTGTTATGGAGGAAATAGGG - Intronic
1058292544 9:103259980-103260002 CTATGGTTCAGGAGGATATTTGG + Intergenic
1059034348 9:110737811-110737833 ATATGTTTGTGGAGGAAATAGGG + Intronic
1059046406 9:110873317-110873339 ATATTTTTCTGGAGGCTATATGG - Exonic
1060293345 9:122324740-122324762 CTCCTGTGCTGGAGGTAATAAGG + Intergenic
1061839528 9:133349744-133349766 CTCATGTTCTGGATGAAATAAGG - Intronic
1062059664 9:134488309-134488331 CCTCTGTCCTGGAGGAAATAAGG - Intergenic
1186639440 X:11439834-11439856 ATATTGTTCTAGAAGAAATGGGG - Intronic
1190777838 X:53568261-53568283 CTATTGTGTTGGGGGAAATTTGG - Intronic
1193125215 X:77863649-77863671 CTATTGTGCTGCAGTAAACATGG - Intronic
1193601615 X:83513194-83513216 CGATTGTTGTGTATGAAATACGG + Intergenic
1194013114 X:88585533-88585555 CTATTGTTCTGGAGGGGCCAAGG - Intergenic
1195491661 X:105477731-105477753 CTATTGTTCTGAGGGAATTGAGG - Intronic
1197140724 X:123114809-123114831 CTCCTGTGCTGGAGGTAATAAGG - Intergenic
1197176514 X:123492060-123492082 CTATTGTTTTGGAGGATCCAGGG - Intergenic
1197230275 X:123996543-123996565 CTATGGTTGGGGAGGAAAGAAGG - Intronic
1197357278 X:125450840-125450862 TCATTGTTGTGCAGGAAATATGG + Intergenic
1197379256 X:125719246-125719268 TTATTGTTTTTGAGGAATTAGGG - Intergenic
1197859608 X:130956427-130956449 CAATTGTTCTGAATGAAATAGGG - Intergenic
1198314016 X:135448985-135449007 TTGTTGTTTTGGAGGAAAAAAGG - Intergenic
1198495506 X:137188195-137188217 CCAGTGTTCTTGAGGAAATGAGG - Intergenic
1201452812 Y:14134791-14134813 CTATTGTTACAAAGGAAATATGG - Intergenic