ID: 1121072678

View in Genome Browser
Species Human (GRCh38)
Location 14:91038853-91038875
Sequence GAGCTGTATACCTTCTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121072678_1121072682 15 Left 1121072678 14:91038853-91038875 CCACCACAGAAGGTATACAGCTC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1121072682 14:91038891-91038913 TAAATCTTCAGCCTGATTTTTGG 0: 1
1: 0
2: 3
3: 26
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121072678 Original CRISPR GAGCTGTATACCTTCTGTGG TGG (reversed) Intronic
900479431 1:2890949-2890971 GGGCTGTCTTCCCTCTGTGGGGG + Intergenic
902899249 1:19502769-19502791 GAGCTGAATTCCTTCTGGGTGGG - Intergenic
910800821 1:91143883-91143905 CATCTGTATATCTTCTTTGGTGG + Intergenic
911891568 1:103378288-103378310 GAGCTGCATTCCTTTGGTGGAGG - Intergenic
914810553 1:151024602-151024624 GGGCTGTGTCACTTCTGTGGAGG - Exonic
918224535 1:182469371-182469393 TATCTGTATATCTTCTTTGGAGG - Intronic
918351387 1:183659154-183659176 GAGCTGTATTCCTTTGGAGGAGG - Intronic
918973287 1:191447824-191447846 GAGCTGCATACCTTTGGAGGGGG + Intergenic
924210479 1:241761040-241761062 GAGCTGTGTAACTTCTGTGAAGG - Intronic
1066596755 10:37059377-37059399 AAGATGTAAACCTGCTGTGGTGG + Intergenic
1069047895 10:63762327-63762349 CAGCTGAATACCTTCAGTGATGG - Intergenic
1073803941 10:107074832-107074854 CATCTGTATAACTTCTTTGGTGG + Intronic
1078266594 11:9759553-9759575 GACCTGTATACCTACGGTGGAGG + Intergenic
1079873857 11:25832369-25832391 GAGCTGTGTTCCTTTGGTGGGGG - Intergenic
1084554623 11:69868429-69868451 GGGCTGTTTGGCTTCTGTGGGGG + Intergenic
1085648839 11:78248372-78248394 GAGCTGTAGACAATCTGTGCTGG + Intronic
1086301084 11:85426724-85426746 GAGCTGTATTCCTTTGGAGGAGG - Intronic
1090204742 11:124878032-124878054 GAGCTGCAGACCTTCCATGGGGG + Exonic
1091029330 11:132170324-132170346 TAGCTGTATACCTATTGTAGAGG - Intronic
1091194911 11:133722398-133722420 GATCTATATACCTCATGTGGCGG + Intergenic
1091939085 12:4459859-4459881 CATCTGTATATCTTCTTTGGTGG - Intergenic
1093217598 12:16382182-16382204 GAGCTGCATTCCTTTTGAGGAGG + Intronic
1094769691 12:33639778-33639800 GGGCTGTATACTTTCTTTAGAGG - Intergenic
1096113694 12:49042976-49042998 GATCTGTACAGCTTCTCTGGTGG - Intronic
1099764987 12:86971475-86971497 GAGCTGCATTCCTTTTGGGGAGG - Intergenic
1102359947 12:112276793-112276815 CATTTGTATACCTTCTTTGGAGG - Intronic
1104217489 12:126748410-126748432 GAGAATTATAGCTTCTGTGGAGG + Intergenic
1105905016 13:24800285-24800307 GAAATGCATACCTTCTGTGGGGG + Intronic
1119231799 14:72985703-72985725 GTTCTCTATACCTTCTGTAGTGG - Intronic
1121072678 14:91038853-91038875 GAGCTGTATACCTTCTGTGGTGG - Intronic
1123715262 15:23024172-23024194 GAGCTGTTTACGATCTGTGCTGG - Exonic
1125847182 15:42867540-42867562 CATCTGTATATCTTCTTTGGTGG - Intronic
1125972896 15:43926520-43926542 GAGGTGTAAACCTTTTGTGAAGG - Intronic
1130140559 15:81222552-81222574 GAGTTCTGTACCTTCTGTGTTGG + Intronic
1130213777 15:81949778-81949800 GGGCTGTGTTCCTTCTCTGGGGG + Intergenic
1131269193 15:90936009-90936031 GAGCTGTAGGGCTTCTGTGGTGG + Intronic
1131851259 15:96545852-96545874 TAGCTGTATAACTTCTGGAGGGG + Intergenic
1132916542 16:2349592-2349614 GAGCTGTATGTCTTCTGTAAAGG + Intergenic
1134911801 16:18034010-18034032 CAATTGTATACCTTCTTTGGAGG + Intergenic
1135506833 16:23045335-23045357 CATGTGTATACCTTCTTTGGGGG + Intergenic
1138710230 16:58962702-58962724 GAGCTGTATATCATATGTGTTGG - Intergenic
1142854762 17:2723588-2723610 GAGCTGTCTTCCTTCTCAGGAGG - Intergenic
1143291922 17:5837930-5837952 AAGCTGGACACGTTCTGTGGGGG + Intronic
1144955164 17:19015421-19015443 GAGCTGGATTCCTTCTGCAGGGG + Intronic
1146448711 17:32954564-32954586 GAGATGTATCTCTTCTGTAGGGG - Intergenic
1147422230 17:40327599-40327621 GAGCTGTGTTCATTGTGTGGTGG + Intronic
1147434830 17:40404380-40404402 GAGATCTATCCCTTCTATGGTGG - Exonic
1150458740 17:65329385-65329407 GGGCTCTCTACCTTCTCTGGAGG + Intergenic
1152166033 17:78707150-78707172 GAGCTGGCTGCCTTCTGTGGAGG + Intronic
1152533448 17:80936062-80936084 CACCTGTATATCTTCTTTGGTGG - Intronic
1155427029 18:25717232-25717254 GAGCTGTATTCCTTTGGAGGAGG - Intergenic
1156134834 18:34025274-34025296 GAGCTATAAACCTTATCTGGGGG + Intronic
925787974 2:7451630-7451652 GAGCTGAATAGTTGCTGTGGAGG - Intergenic
927364498 2:22278193-22278215 GAACTATATAACTGCTGTGGAGG - Intergenic
928732028 2:34242544-34242566 GAGCTGTAAACCTTTTATGAGGG + Intergenic
929821896 2:45280891-45280913 GAGCTGTAAGCCTCGTGTGGAGG - Intergenic
929880375 2:45831574-45831596 GTGATGTATAACTTTTGTGGAGG + Intronic
929949768 2:46398454-46398476 CATCTGTATATCTTCTTTGGAGG - Intergenic
931191094 2:60001070-60001092 GGGTTGTAGGCCTTCTGTGGAGG + Intergenic
933938633 2:87227274-87227296 GAGCTGTTTATATTCTGGGGAGG - Intergenic
936354502 2:111738499-111738521 GAGCTGTTTATGTTCTGGGGAGG + Intergenic
936654092 2:114464379-114464401 TACCTGTATATCTTCTTTGGTGG + Intronic
936870816 2:117132653-117132675 AAGCTGTGTCCCTTCTGTGGAGG + Intergenic
943125392 2:183789706-183789728 GAGCTGCATTCCTTCAGAGGGGG - Intergenic
944914375 2:204343081-204343103 CATCTGTATATCTTCTGTAGTGG - Intergenic
946614710 2:221497100-221497122 TAGCTGTCAACCTGCTGTGGAGG + Intronic
946810525 2:223519715-223519737 CATTTGTATATCTTCTGTGGAGG + Intergenic
1170698108 20:18678653-18678675 GAGCTGTTTACCCTCTGGGAAGG + Intronic
1171140390 20:22735738-22735760 GAGCTGTATTCCTTTTGAAGGGG - Intergenic
1176271382 20:64236701-64236723 GAGCTGTGCACCTTTTGTGCTGG + Intronic
1177597315 21:23261916-23261938 CAGTTGTATACCTTCTTTGAAGG - Intergenic
1178175563 21:30093953-30093975 GAACTGTTTTCCTTCTGTGAAGG - Intergenic
1179767135 21:43582351-43582373 GAGATGAAGACCTGCTGTGGGGG + Intronic
1179767338 21:43583281-43583303 GAGATGAAGACCTGCTGTGGGGG + Intronic
1179799170 21:43802905-43802927 GAGCTGCCTACCTGCAGTGGAGG + Intronic
1180414737 22:12698334-12698356 GAGCTGTATTCCTTTGGAGGAGG - Intergenic
1182571076 22:31238506-31238528 GAGGTGTAGACATTCTGTGATGG - Intronic
1183101681 22:35588031-35588053 GAGCTGGATGCCTTCTGAGAGGG + Intergenic
1183649655 22:39146486-39146508 CAGCTGTAAACCTTCAGAGGTGG + Intronic
949425361 3:3909886-3909908 GAGCTGCATTCCTTCGGAGGAGG - Intronic
950523438 3:13509615-13509637 GAGCTGCATTCTTTCTCTGGAGG - Intergenic
950906029 3:16539034-16539056 GAGCAGGATACCATCAGTGGTGG + Intergenic
952609059 3:35185223-35185245 GATGTATATACATTCTGTGGGGG - Intergenic
955211590 3:56946225-56946247 GAGCTGTATTCCTTTGGAGGAGG - Intronic
955969192 3:64420112-64420134 GAGTGGTACACCTCCTGTGGAGG + Intronic
957061804 3:75488509-75488531 GAGCTGTATTCCTTTGGAGGAGG + Intergenic
960612473 3:119568215-119568237 GAGCTGCATACCTTTGGAGGGGG + Intergenic
961599468 3:128048766-128048788 GAGCTATATACCCGCTGTGGTGG - Intergenic
962111340 3:132452453-132452475 GAGCTGTTGACATTCTGAGGAGG + Intronic
965262631 3:166504162-166504184 AAGCTGTGTCCCATCTGTGGGGG - Intergenic
973872800 4:55183295-55183317 GAGCAGTCTATCTTCTGTGTAGG + Intergenic
974475061 4:62368069-62368091 CATCTGTATATCTTCTTTGGTGG - Intergenic
975806418 4:78117874-78117896 GAGCTGCATTCCTTTGGTGGAGG + Intronic
977387635 4:96363488-96363510 CATTTGTATACCTTCTTTGGAGG - Intergenic
977749952 4:100597507-100597529 CATCTGTATATCTTCTTTGGTGG + Intronic
978061554 4:104345546-104345568 GAGCTCTCTTCCTTCTGTAGGGG + Intergenic
983181121 4:164650141-164650163 GAGCTGTGTTCCTTCGGAGGAGG - Intergenic
984975006 4:185222377-185222399 GCGCTGTATACCTACCGTGAGGG - Intronic
985283131 4:188306637-188306659 GAGCTGTATATTTTCTTTTGTGG + Intergenic
987197075 5:15537292-15537314 CATCTGTATATCTTCTTTGGAGG + Intronic
990188029 5:53229178-53229200 GAGCTGTGTTCCTTTTGAGGAGG + Intergenic
990537824 5:56740794-56740816 GATATGTATATCTTCTTTGGAGG - Intergenic
990891985 5:60659896-60659918 GAGCTGTATACCTAAATTGGAGG - Intronic
991029150 5:62064874-62064896 GAGGTGCATAACATCTGTGGTGG - Intergenic
993893378 5:93502353-93502375 AAGCTATATACCTTTTTTGGGGG - Intergenic
994574004 5:101553521-101553543 GAGCTGCATTCCTTTTGAGGAGG + Intergenic
998311049 5:141132499-141132521 CACCTGTATACCTTCTTTGGTGG - Intronic
998891122 5:146746974-146746996 GTGCTGCATATCATCTGTGGAGG + Intronic
1003274952 6:4642210-4642232 AAACTGAAAACCTTCTGTGGAGG - Intergenic
1004870204 6:19896623-19896645 GAGATGTTTCCTTTCTGTGGTGG + Intergenic
1005505474 6:26465574-26465596 GAGCTGTGTCCTTTCTATGGTGG - Intronic
1008329504 6:50228351-50228373 GAGCTGCATTCCTTTTGAGGAGG + Intergenic
1010553608 6:77252603-77252625 GAGCTGCATTCCTTCAGAGGGGG - Intergenic
1012089440 6:94873327-94873349 GAGCTGTGTTCCTTCGGAGGAGG + Intergenic
1012504608 6:99930884-99930906 GAGCTGTGTTCCTTTGGTGGAGG + Intronic
1014345755 6:120267766-120267788 GAGCTGCATTCCTTTGGTGGAGG + Intergenic
1015743366 6:136483039-136483061 GAGATGTATTCCTTTTGTTGTGG + Intronic
1016504202 6:144759795-144759817 GGGCTGAATTCCTTCTCTGGAGG - Intronic
1019258621 7:67350-67372 GAGCTGTCTCCCTTCCGTGCGGG + Intergenic
1021695657 7:23273410-23273432 GAGCCATATATCTTCTGTGACGG + Intronic
1021965014 7:25908946-25908968 GAGCTGTGTACTTTTTTTGGGGG - Intergenic
1024424209 7:49207082-49207104 GAGCTGTTTCCATTCTGTGGAGG + Intergenic
1033893382 7:146042763-146042785 GAGCTGTGTTCCTTTTGAGGAGG + Intergenic
1035613615 8:986259-986281 GAGCTGCATGGCTTCTGTGCCGG + Intergenic
1040695365 8:49991146-49991168 GATTTGCATACCTCCTGTGGAGG - Intronic
1043177711 8:77042939-77042961 GAGCTGCATTCCTTTGGTGGAGG - Intergenic
1045419631 8:102000973-102000995 GAGCTGTATTCCTTTGGAGGAGG - Intronic
1047769890 8:128022162-128022184 GAGCTGCAGGCCTTGTGTGGAGG + Intergenic
1053155140 9:35772843-35772865 GAGCTGCATACTAACTGTGGTGG + Intergenic
1053196359 9:36122094-36122116 GAGCTGTGTGCCCACTGTGGAGG + Intronic
1054785613 9:69207353-69207375 GAGATGCATCCCTTTTGTGGTGG + Intronic
1056224042 9:84477952-84477974 GAGCTGTCTGCCTTGGGTGGGGG + Intergenic
1058943681 9:109836476-109836498 GAGCTGCATTCCTTTGGTGGAGG - Intronic
1059365379 9:113782763-113782785 GTGCTGTGTACTTCCTGTGGAGG + Intergenic
1187962412 X:24579342-24579364 TGGCTGTATACCCTCTCTGGAGG + Exonic
1189584866 X:42448750-42448772 CATCTGTATACCTTCTTTGGTGG - Intergenic
1191048156 X:56161814-56161836 GAGCTGCATTCCTTTGGTGGAGG + Intergenic
1192071345 X:67943618-67943640 GAGCTGCATTCCTTTTGAGGTGG - Intergenic
1195553468 X:106194585-106194607 GAGCTGTGTTCCTTCGGAGGAGG + Intronic
1198474399 X:136982167-136982189 GAGCTGTATTCCTTTGGAGGAGG + Intergenic
1198553420 X:137768360-137768382 GAGCTGTATTCCTTTGGAGGAGG + Intergenic
1200318712 X:155162463-155162485 GAGCTGCATTCCTTTTGAGGAGG + Intergenic
1201245756 Y:12002491-12002513 GAGCTGTGTCCCTTTTGAGGAGG + Intergenic