ID: 1121074934

View in Genome Browser
Species Human (GRCh38)
Location 14:91060252-91060274
Sequence GCGGGTGCCCGCGCGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 275}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121074934_1121074944 4 Left 1121074934 14:91060252-91060274 CCCAGCCCCGCGCGGGCACCCGC 0: 1
1: 0
2: 3
3: 30
4: 275
Right 1121074944 14:91060279-91060301 CCTCAGGCGCGCCCCCGCGCCGG 0: 1
1: 0
2: 0
3: 12
4: 165
1121074934_1121074947 14 Left 1121074934 14:91060252-91060274 CCCAGCCCCGCGCGGGCACCCGC 0: 1
1: 0
2: 3
3: 30
4: 275
Right 1121074947 14:91060289-91060311 GCCCCCGCGCCGGGCCCGGCCGG 0: 1
1: 1
2: 11
3: 116
4: 868
1121074934_1121074953 21 Left 1121074934 14:91060252-91060274 CCCAGCCCCGCGCGGGCACCCGC 0: 1
1: 0
2: 3
3: 30
4: 275
Right 1121074953 14:91060296-91060318 CGCCGGGCCCGGCCGGCAGAGGG 0: 1
1: 1
2: 0
3: 22
4: 290
1121074934_1121074946 10 Left 1121074934 14:91060252-91060274 CCCAGCCCCGCGCGGGCACCCGC 0: 1
1: 0
2: 3
3: 30
4: 275
Right 1121074946 14:91060285-91060307 GCGCGCCCCCGCGCCGGGCCCGG 0: 1
1: 3
2: 7
3: 129
4: 2536
1121074934_1121074952 20 Left 1121074934 14:91060252-91060274 CCCAGCCCCGCGCGGGCACCCGC 0: 1
1: 0
2: 3
3: 30
4: 275
Right 1121074952 14:91060295-91060317 GCGCCGGGCCCGGCCGGCAGAGG 0: 1
1: 2
2: 1
3: 59
4: 478
1121074934_1121074945 5 Left 1121074934 14:91060252-91060274 CCCAGCCCCGCGCGGGCACCCGC 0: 1
1: 0
2: 3
3: 30
4: 275
Right 1121074945 14:91060280-91060302 CTCAGGCGCGCCCCCGCGCCGGG 0: 1
1: 0
2: 1
3: 31
4: 264
1121074934_1121074956 25 Left 1121074934 14:91060252-91060274 CCCAGCCCCGCGCGGGCACCCGC 0: 1
1: 0
2: 3
3: 30
4: 275
Right 1121074956 14:91060300-91060322 GGGCCCGGCCGGCAGAGGGCGGG 0: 1
1: 0
2: 7
3: 59
4: 601
1121074934_1121074957 26 Left 1121074934 14:91060252-91060274 CCCAGCCCCGCGCGGGCACCCGC 0: 1
1: 0
2: 3
3: 30
4: 275
Right 1121074957 14:91060301-91060323 GGCCCGGCCGGCAGAGGGCGGGG 0: 1
1: 0
2: 2
3: 54
4: 506
1121074934_1121074955 24 Left 1121074934 14:91060252-91060274 CCCAGCCCCGCGCGGGCACCCGC 0: 1
1: 0
2: 3
3: 30
4: 275
Right 1121074955 14:91060299-91060321 CGGGCCCGGCCGGCAGAGGGCGG 0: 1
1: 0
2: 3
3: 39
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121074934 Original CRISPR GCGGGTGCCCGCGCGGGGCT GGG (reversed) Intronic
900157592 1:1209413-1209435 GCGGGTGCAGCTGCGGGGCTGGG + Intergenic
900372099 1:2336694-2336716 GTGGGTGCCCACGGGGGGCGGGG - Intronic
901242866 1:7704954-7704976 GCGGGGGCGCGCGCGGGGCGGGG + Intronic
901303667 1:8217329-8217351 GCGGCCGCCCGCGCACGGCTGGG + Intergenic
901361324 1:8703282-8703304 GCGGGGCCCCGCCCGCGGCTAGG + Intronic
902349983 1:15847452-15847474 TCGGGTTCCCGCGCCGGGCAAGG - Intergenic
902520234 1:17011682-17011704 GCCGGGGACCGCGCCGGGCTCGG + Intronic
902680735 1:18042186-18042208 GCAGGGGCCCCCGCGGGGGTGGG + Intergenic
903258778 1:22120020-22120042 GTGGTTGCCGGCGCAGGGCTAGG + Exonic
903867632 1:26410697-26410719 GGGGCTGCCCGCGGGGGGTTGGG + Intergenic
904541935 1:31239367-31239389 GCGTGTGCCCGGGCGGGGGGTGG - Intronic
905107742 1:35574201-35574223 GCGGGCGGCTGCGCGGGGCGCGG - Exonic
905366058 1:37452186-37452208 GCGGGTGCCCGGAAGGTGCTGGG + Intergenic
905449376 1:38046913-38046935 GCGGGCGGGCGCGCGGGGCGGGG - Intergenic
906044537 1:42817440-42817462 GCCGGTGCCGGGGCGGGGCAGGG + Intronic
908534854 1:65067501-65067523 GCGTGCGGCCGCGCGAGGCTCGG - Intergenic
914393469 1:147242667-147242689 GCGCTTGGCCGCGCGGGGCGGGG + Exonic
920528341 1:206684910-206684932 GCGGCCGCCGGCCCGGGGCTGGG + Intergenic
920528693 1:206686023-206686045 CCGGCTGCCCTCGCGAGGCTCGG - Intronic
920556643 1:206909390-206909412 TCGGGTCCCCGCCCAGGGCTGGG + Intronic
922800501 1:228362680-228362702 GCGGGTGCCCCCCTGGGGCAGGG - Exonic
1062791266 10:307928-307950 GGGGGTGCCTGGGCGGGGCCCGG + Intronic
1062791327 10:308102-308124 GGGGGTGCCTGGGCGGGGCCCGG + Intronic
1065099849 10:22321739-22321761 GGCGGGGGCCGCGCGGGGCTCGG + Intronic
1070768227 10:79068451-79068473 GGGCGTGCCAGCGCGGGGCAGGG + Intergenic
1070800721 10:79243159-79243181 GCGTGTGCCCGCGTGGGGCTGGG - Intronic
1071527287 10:86366088-86366110 GCGGGGCCCCGCGCGGAGATCGG + Intronic
1072491177 10:95907565-95907587 GCGGTCGCCCGCGCAGGGCGTGG - Intronic
1075106456 10:119542878-119542900 CGGGGTGCCCGGGCGGGGCAGGG + Intergenic
1075573119 10:123559392-123559414 GTAGATGCCCGCTCGGGGCTGGG + Intergenic
1075697398 10:124447300-124447322 GCGGGTGCGCGCGGCGGGCAGGG + Exonic
1076683420 10:132186592-132186614 GCGGGGGCGCGGGCGGGGCCTGG + Intergenic
1076900772 10:133336372-133336394 GCCGCTGCCCGCACGGGGGTTGG - Intronic
1076991993 11:280244-280266 GCCGGGGCGCGCGCGGCGCTCGG + Exonic
1077048354 11:555808-555830 GCGGGTGTCGGCGCCGGGCCCGG + Exonic
1077080309 11:722048-722070 GCAGGTGCCGGGGCGGGGCGGGG - Intronic
1077154914 11:1086995-1087017 GCGGGTGCAGGTGCGGGTCTGGG - Intergenic
1077332879 11:1991033-1991055 GCGGGGAGCGGCGCGGGGCTGGG - Intergenic
1081502588 11:43680954-43680976 GCGGGGGTCGGCCCGGGGCTCGG + Exonic
1083033567 11:59615771-59615793 GCGGCTGGCCGGGCGGGGCGGGG - Exonic
1083227515 11:61294425-61294447 GCGTGTGCGCGCGTGGGGGTGGG - Intronic
1083554384 11:63614245-63614267 GCAGGTGCCAGCGGGCGGCTCGG + Exonic
1083664821 11:64268675-64268697 GCGGGCTCCAGGGCGGGGCTGGG + Exonic
1083684521 11:64368503-64368525 GCGGGAGCCTGCGCTGGGCCAGG + Exonic
1083997216 11:66278409-66278431 GGGGGCGCCAGCGCGGGGCCCGG - Exonic
1084129177 11:67119741-67119763 GCCGGGGCCGGCCCGGGGCTCGG + Exonic
1085173497 11:74467601-74467623 GCTGGGGCCCGGGCGGGGCAGGG - Exonic
1085477245 11:76796280-76796302 CCGGGTGCCTTCGCGGGGCTGGG + Exonic
1089169277 11:116500853-116500875 GCGGGTGCACGCGGGGGCCGGGG - Intergenic
1089359563 11:117876759-117876781 GGGGGGGCTCGCTCGGGGCTGGG + Exonic
1090238452 11:125165727-125165749 GTAGGGGCCCGCGCGAGGCTTGG + Intronic
1090768292 11:129895706-129895728 GAGGGTGCCTGCGCGCGGCTGGG + Intergenic
1202815862 11_KI270721v1_random:46209-46231 GCGGGGAGCGGCGCGGGGCTGGG - Intergenic
1096116816 12:49059967-49059989 CCGGCCGCCCGCGCCGGGCTCGG + Intergenic
1096482395 12:51951536-51951558 GCGGGCGCCCGCGCGCGCCCCGG + Intergenic
1096647588 12:53047181-53047203 GCGGGCGCGGGCGCGGGGCGCGG + Intronic
1097281251 12:57846478-57846500 GCGGGCGCGCGGGCTGGGCTGGG + Exonic
1097284272 12:57865473-57865495 GCTGGGGCCCTCGCGGGGCGCGG + Intergenic
1097848669 12:64390624-64390646 GCGGGTTCCAGCGCGGGGGCGGG - Exonic
1101504057 12:105330647-105330669 GCGGGTCCCCGGGCGGGGCGGGG + Exonic
1104977759 12:132559932-132559954 GCGGGAGCGCGGGCGGGGCGGGG - Intronic
1105472084 13:20703769-20703791 GCGCGGGCCGGCGCCGGGCTGGG + Intronic
1108340705 13:49496115-49496137 GCGGGCGGGCGGGCGGGGCTGGG + Intronic
1108689295 13:52847423-52847445 GCAGGTGGCAGCGCGGGGCCCGG + Exonic
1113737641 13:112689913-112689935 GCGGGTGCGAGCGCGGGTGTGGG + Intergenic
1113737871 13:112690674-112690696 GCAGGTGGCCGCCCGGGGCTGGG - Intronic
1115545545 14:34462348-34462370 GCCGGGGCGCGCGCGGGTCTGGG - Exonic
1116887034 14:50231633-50231655 GCGGGAGTCGGGGCGGGGCTGGG - Intergenic
1118019345 14:61695395-61695417 GCGGGAGCGCGCGCCGGCCTGGG + Intergenic
1119230394 14:72974836-72974858 GCCAGTGCCTGAGCGGGGCTGGG - Exonic
1119330067 14:73787047-73787069 CCGGGCGCCGGCGTGGGGCTCGG - Intronic
1119410202 14:74425818-74425840 ACGGGAGCCCTCTCGGGGCTAGG - Intronic
1119759507 14:77141044-77141066 GCGGGTTCCCGGGGGGCGCTGGG - Intronic
1121074934 14:91060252-91060274 GCGGGTGCCCGCGCGGGGCTGGG - Intronic
1121422519 14:93825231-93825253 GGGGGCGCCCGCGGGGGGCGAGG + Intergenic
1121453899 14:94026609-94026631 GCGGGTGCACCCGCGGGACGGGG + Intronic
1123034562 14:105466632-105466654 GCGGGTGCCCGGGCGGGGACGGG - Intronic
1125035807 15:35122147-35122169 GCGGGGGCCGGGCCGGGGCTCGG + Intergenic
1125503360 15:40252863-40252885 GCGGGCGCCCGCCCGGCGCGGGG + Exonic
1125541132 15:40470893-40470915 GCGGGCGCCCCTGCGGGGCGCGG - Intergenic
1125575765 15:40754740-40754762 GGTGGTGCCCGTGCCGGGCTGGG - Exonic
1125675701 15:41501580-41501602 GCGGGTGCCCGCGACGGGAAGGG + Intronic
1127103298 15:55588436-55588458 GCCCGTCCCCGCGCGGGGCTGGG - Intronic
1129675861 15:77632268-77632290 GGGGCTGCCCGCTCGGGGCTCGG + Intronic
1129692269 15:77720704-77720726 GCGGGTGCCCGAGAGGGGAAGGG - Intronic
1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG + Intronic
1130115592 15:81002079-81002101 GCGGGAGCCCGGGCGGCGCGGGG - Exonic
1131269012 15:90935350-90935372 GGGGGTGGCCGGCCGGGGCTCGG - Exonic
1131367483 15:91853203-91853225 GGAGGCGCCCCCGCGGGGCTGGG - Intergenic
1131828840 15:96341682-96341704 GCGCGGGCCCGAGCGGAGCTGGG + Intergenic
1132585995 16:705958-705980 GCGGGGGCCGGGGCGGGGCGGGG - Intronic
1132586025 16:706041-706063 GCGGGTGCCCGCGGCGAGCGGGG - Intronic
1132663811 16:1072844-1072866 GGGGGTGCCCGCGCGGGAGGGGG - Intergenic
1132703823 16:1232662-1232684 CCGGGAGTGCGCGCGGGGCTGGG + Intergenic
1132707695 16:1253733-1253755 CCGGGAGTGCGCGCGGGGCTGGG - Intergenic
1133006024 16:2882439-2882461 GGGGGCGACCCCGCGGGGCTGGG + Intergenic
1133049000 16:3106274-3106296 CCGGGCGCCCGGGCGGGGGTTGG + Intergenic
1134656079 16:15949515-15949537 GCGGGCGCCGGGGCGGGGCGGGG + Intergenic
1135407288 16:22207201-22207223 GCCGGTGGCCGCGCGGGGGTGGG + Intronic
1136004426 16:27318911-27318933 TCGAGTGCCAGCCCGGGGCTAGG + Intronic
1136365198 16:29806446-29806468 GCGGGAGGCCCCGCGGGGCCGGG - Intronic
1137707764 16:50547729-50547751 GTGGGTGCCCGCCCGGGTCGGGG - Intergenic
1138178893 16:54929435-54929457 GCGGGTGCCGGTGCGGCGCTGGG + Intergenic
1138383131 16:56617426-56617448 GCGGGTGCAAGCGCGGGGCGGGG + Intergenic
1138384295 16:56625702-56625724 CCGGGTGCAGGCGCGGAGCTGGG + Exonic
1138385363 16:56632579-56632601 GCGGGTGCAAGCGCGGGGCAGGG + Exonic
1138385938 16:56635665-56635687 GCGGGTGCAAGCGCGGGGCAAGG + Intergenic
1139470238 16:67174461-67174483 CCGGGTGAGCGCGCGGGGCGGGG + Exonic
1139476222 16:67203794-67203816 GGGGGTGGCCGCTCGGGGATGGG - Exonic
1141116615 16:81315024-81315046 GCGGGCGCGCGCGCAGGACTCGG + Exonic
1141452886 16:84117288-84117310 GCAGGTGCCCGGCCGGGGGTGGG - Intergenic
1141538520 16:84700147-84700169 GCGTCCGCCCGCCCGGGGCTCGG - Intronic
1141830982 16:86509972-86509994 GCGGGGGCCCGAGGGGGGCAGGG + Intergenic
1142290416 16:89191658-89191680 GCCGGTGGCGGTGCGGGGCTGGG - Exonic
1142429591 16:90019132-90019154 CGCGGTCCCCGCGCGGGGCTGGG - Intronic
1142474504 17:181160-181182 GCTGGCGGCCGCGCGGGGCTGGG + Exonic
1142757434 17:2024491-2024513 GCGTGTGCCCGCGCAGGGAATGG + Intronic
1143200712 17:5111496-5111518 GCAGGTGCCCGCCCGGGGAGGGG + Intronic
1143443921 17:6996231-6996253 GCTGCGGCCCGCGCGGGGCGAGG + Exonic
1143830234 17:9645456-9645478 CCGGATTCCCGCGCGGGGCGGGG + Intronic
1144185075 17:12789517-12789539 CCGGGTCCCCGCGCCGGACTGGG + Exonic
1144723887 17:17491653-17491675 GCGGGAGCCAGCGCAGAGCTTGG + Exonic
1146433662 17:32822635-32822657 GGGGGTGGCCGCGCGGGCCCCGG + Intronic
1147970970 17:44219073-44219095 GCGGGGGCGCCGGCGGGGCTGGG - Intronic
1148284090 17:46372778-46372800 GCGGGGGCGCGCGCGCGGCGGGG + Intergenic
1148306311 17:46590699-46590721 GCGGGGGCGCGCGCGCGGCGGGG + Exonic
1148945762 17:51260507-51260529 GCGGCGGCCCGCGAGGGGCCTGG + Exonic
1149849343 17:60026114-60026136 GCGGGCGGCTGCGCAGGGCTGGG - Intergenic
1149860825 17:60120410-60120432 GCGGGCGGCTGCGCAGGGCTGGG + Intergenic
1150272089 17:63873205-63873227 GCTGGTGCGCGCGATGGGCTTGG + Exonic
1150275636 17:63896101-63896123 GCTGGTGCGCGCGATGGGCTTGG + Exonic
1150486346 17:65546391-65546413 CCGGGTGACCGCCCGGTGCTGGG + Intronic
1151495104 17:74454141-74454163 GCAGGGGCCGGGGCGGGGCTTGG - Intergenic
1151582407 17:74987870-74987892 CCGGGAGCCCACGCGGGGCCTGG - Exonic
1152057412 17:78040917-78040939 GCGGGCGCCCGCGGGTGGCCCGG + Intronic
1152162323 17:78676620-78676642 GCAGGTGCACGTGGGGGGCTTGG - Intronic
1152468357 17:80477705-80477727 CCGGGTTCCGGCGCCGGGCTGGG + Intronic
1152584050 17:81181344-81181366 GCGGGGGGCCGCGCCGGGCGGGG - Intergenic
1152748408 17:82051625-82051647 ACGGGGGCGCGCGCGGGGCCGGG + Exonic
1152834589 17:82520564-82520586 GCGGCTGCGCGCGCGGGTCAAGG + Intronic
1153457241 18:5295317-5295339 CCGGGTGCGCCCGCGGAGCTTGG - Intronic
1153457517 18:5296229-5296251 GCGCGCGCACGCGCGCGGCTTGG + Intronic
1153565670 18:6414926-6414948 GAGGGTGCACGCGCGGGGTGGGG + Intronic
1153906164 18:9663312-9663334 GAGGGTGGCCGGGCTGGGCTGGG + Intergenic
1154332656 18:13442497-13442519 GCTGGGGCCCGCGTGGGGCACGG + Intronic
1157222759 18:45839113-45839135 ACGGGTGGCCGCGAGGGGCCGGG + Intronic
1157529451 18:48409199-48409221 GCGGCTTCGCGCGCCGGGCTCGG - Intronic
1158718339 18:59900211-59900233 GCTGGAGCCCGCGCGGGGCTCGG - Exonic
1159241800 18:65751157-65751179 GTGTCTGCCTGCGCGGGGCTGGG + Intronic
1159586597 18:70288834-70288856 GCCGGGGGCCGCGCGGGGCGGGG - Intergenic
1160452134 18:78973450-78973472 GCGGGGACCTGCGAGGGGCTGGG + Intergenic
1160613871 18:80109483-80109505 GCGCGGGCCCGCGCCGGGCCGGG - Intronic
1160682080 19:416546-416568 CTGGGGGCCCTCGCGGGGCTGGG - Intergenic
1160725023 19:614043-614065 GCGGGTGCCCTGGCGGGGGAGGG + Intronic
1160765608 19:806233-806255 GCGGGTGGCTGTGCGGGGGTCGG + Intronic
1160856310 19:1219410-1219432 ACGGGTGCGTGCGCGGGGCAGGG + Exonic
1160966382 19:1748663-1748685 GCGGATCCCGGAGCGGGGCTCGG - Intergenic
1160983374 19:1826846-1826868 GCGGGTGCTGGGGCTGGGCTCGG - Intronic
1162752644 19:12838366-12838388 GCGAGTGCGCGGGCGGGGCCTGG + Intronic
1162777846 19:12990443-12990465 GCGGGGCCCCGTGGGGGGCTGGG - Intergenic
1163665967 19:18604240-18604262 GCAGCTGCCCTCCCGGGGCTGGG + Intronic
1163827643 19:19532627-19532649 GCGGCTGCCTCCGCGGTGCTGGG - Exonic
1164804307 19:31104460-31104482 GTGGGTGCCCGGGCAGAGCTAGG + Intergenic
1165129392 19:33622448-33622470 GGAGGTGGGCGCGCGGGGCTCGG + Intronic
1165845671 19:38816382-38816404 GCGGCTGCCACCCCGGGGCTGGG + Intronic
1165939888 19:39409771-39409793 GCGGGGGCGGGCGCGGGGCGGGG + Intergenic
1166737259 19:45093407-45093429 GCGGGGGGCGACGCGGGGCTGGG - Exonic
1166790391 19:45395692-45395714 GCGCGGGGCCCCGCGGGGCTGGG + Exonic
1167154526 19:47730091-47730113 CCTGGTGCCCCCGCCGGGCTGGG + Intronic
1167449219 19:49557094-49557116 GCTGGTGCCCGAGAGGGCCTTGG + Exonic
1167611995 19:50512173-50512195 GCCGGTGACCGCGCCTGGCTCGG + Exonic
1168297333 19:55383815-55383837 GCGGGGGCGCGCGGGCGGCTCGG + Exonic
927207483 2:20619317-20619339 GCCAGTGCCCACACGGGGCTGGG + Intronic
929460928 2:42101616-42101638 GGGGGCGGCCACGCGGGGCTGGG - Intergenic
930411054 2:51027452-51027474 GCCGGGGCCTGGGCGGGGCTCGG - Intronic
932180716 2:69643750-69643772 GCGGGAGCGCGCGCGGGGGAGGG - Intronic
932345829 2:70994651-70994673 GCGGGAGCCCGCGCGGGCCGGGG + Intronic
933778769 2:85787456-85787478 TGGGGTGCCTGGGCGGGGCTGGG + Exonic
937956257 2:127423195-127423217 GCGGGCGGCGGGGCGGGGCTGGG + Intronic
941580808 2:167293576-167293598 GTGTGTGCGCGCGCGCGGCTTGG + Intergenic
941916589 2:170817470-170817492 GCGACTGCGCGCGCGGGGCTAGG + Intronic
943589919 2:189784498-189784520 GCGGGTGCGGGTGCGGGGTTGGG + Exonic
946312956 2:218892951-218892973 GAGGGTGCCCCCGCTGGGCCCGG - Exonic
946747497 2:222860931-222860953 GCGGTGGCGCGTGCGGGGCTGGG - Exonic
948479190 2:238239771-238239793 GCGGGAGGCCGTGCGGGGCTGGG - Intronic
1168828932 20:833822-833844 AAAGGTGCCCACGCGGGGCTGGG + Exonic
1169116926 20:3072033-3072055 GCGGGAGCCGGGGCGGCGCTGGG - Intronic
1169216309 20:3796546-3796568 GCCGGAGCCCGCGCCAGGCTCGG + Exonic
1172101191 20:32484492-32484514 TCGGGTGCCCGCGGGGGGCGGGG - Intronic
1172118430 20:32584522-32584544 GCGGGTCCCGCCGCGGGGCTTGG - Intronic
1172123218 20:32610642-32610664 GCGGGTGCCCGGAAGTGGCTCGG + Intergenic
1172951395 20:38725252-38725274 GTAGGTCCCCGCGCAGGGCTGGG - Intronic
1173808148 20:45939427-45939449 GCAGGTGCCAGCACAGGGCTGGG - Intronic
1174736892 20:52973232-52973254 GCGGGCCCCAGCGCGCGGCTCGG + Exonic
1175345267 20:58268539-58268561 GCGGGTGCCCTCAAGGGGTTAGG + Intergenic
1175429261 20:58890968-58890990 GCGGGCGCCGCCGAGGGGCTGGG - Intronic
1176129224 20:63489204-63489226 GAGGGCGCCAGAGCGGGGCTGGG + Intronic
1176194453 20:63830941-63830963 GAGGGCGCCCCCGCGGGGCGGGG + Intronic
1176380800 21:6111331-6111353 GCGGGCGCCGGGCCGGGGCTCGG + Intronic
1179612394 21:42560666-42560688 GCTGGTGCCCACCCTGGGCTGGG - Intronic
1179742672 21:43426909-43426931 GCGGGCGCCGGGCCGGGGCTCGG - Intronic
1179950827 21:44707992-44708014 GTGTGTGCACGCGCGGGGCGGGG - Intronic
1180182873 21:46125647-46125669 GCGGGGGGCCGGGCGGGGCGTGG + Intronic
1180791760 22:18578548-18578570 GCGGGGGCCCGAGGGGCGCTGGG - Intergenic
1181229976 22:21416761-21416783 GCGGGGGCCCGAGGGGCGCTGGG + Intergenic
1181248673 22:21518105-21518127 GCGGGGGCCCGAGGGGCGCTGGG - Intergenic
1181956357 22:26590128-26590150 GGAGGTGCCCGCGCGGGGGCGGG + Exonic
1182211352 22:28679845-28679867 GCGGGGGCGCGCGCGCGGTTTGG - Exonic
1183149690 22:36028221-36028243 GCAGGTGACCGCGCGGGACGGGG - Exonic
1183461495 22:37953735-37953757 GCGGGTCTCCGCGCGGGACCGGG + Exonic
1183828481 22:40405896-40405918 GCGGGTGGCCGAGTGGGGATAGG + Intronic
1183931308 22:41237654-41237676 GCGGGCGCCCTGGCCGGGCTGGG - Exonic
1184207633 22:43015069-43015091 GCGGGAGCCCGGCCGGAGCTGGG - Exonic
1184523538 22:45009037-45009059 GCCGGAGCCTGAGCGGGGCTCGG - Intronic
1185288006 22:50010976-50010998 GCGGGTGACGGCGGGAGGCTGGG - Intronic
1185315469 22:50177117-50177139 GTACGTGCCCGCGCTGGGCTGGG + Exonic
951543857 3:23806694-23806716 GCGGGTGCCCGGGTGGGGGAAGG - Intronic
953925364 3:46979922-46979944 GCGGGTGCGGGCGCGGGGCGGGG - Intronic
954200607 3:49021292-49021314 GCTGGCCCCCGCGCGGGGTTTGG - Exonic
954382508 3:50227234-50227256 GTGGGGCCCCGCGCGGGGCAAGG + Intronic
954469026 3:50675454-50675476 GCGGGTGCGGGTGCGGGGGTGGG + Intronic
958426145 3:93980372-93980394 GCCGGTGTCCGCTCCGGGCTCGG + Exonic
961726798 3:128936087-128936109 GCGAGTGCCAGGGCAGGGCTTGG - Intronic
966390834 3:179451216-179451238 CCGGGTGACGGCGCGGGGCGGGG - Intronic
966762139 3:183428148-183428170 ACGGGAGCCCCCGCGGGGCGTGG - Exonic
967833832 3:193944274-193944296 GCGGGCGCTCGCGCGGGGCTGGG - Intergenic
969778925 4:9381128-9381150 CCGGGTGCCCCCGCTGGGCCCGG - Intergenic
972740400 4:41881884-41881906 GCGGGGGCGGGCGCTGGGCTCGG - Intergenic
976199054 4:82561684-82561706 GCGTGCGCCCGCGGAGGGCTCGG + Intronic
977809701 4:101346063-101346085 GAGGGTGGCCGCGGGGGGCGCGG - Intronic
979231582 4:118353173-118353195 GAGGGTGCCCGCGCGGAGCACGG + Intergenic
982042392 4:151409104-151409126 GCGGGGGCCGGGGCGGGGCAGGG - Intergenic
984695011 4:182770464-182770486 GCAGGGGCCCGGGTGGGGCTGGG - Intronic
984811311 4:183798139-183798161 GGCGGTGCCCGCGGCGGGCTGGG - Intergenic
984973400 4:185209863-185209885 CCTGCGGCCCGCGCGGGGCTGGG - Intronic
985478409 5:92335-92357 GCGGGTGGGGGCGCGGGGGTAGG + Intergenic
985478438 5:92388-92410 GCGGGTGGGGGCGCGGGGGTAGG + Intergenic
985478477 5:92471-92493 GCGGGTGGGGGCGCGGGGGTAGG + Intergenic
985784467 5:1886711-1886733 GCGCGGGCCGGCGCGGGGCGGGG - Intronic
985813948 5:2112312-2112334 GCGGCTGCCTGAGCGGGGCCGGG - Intergenic
986297109 5:6448786-6448808 GCGGGCGCCAGGGCGGGGCCGGG + Exonic
990176029 5:53109680-53109702 GCGGGTGTGCGTGCGGGCCTGGG - Exonic
991351113 5:65721848-65721870 GCGGGTGCCGGTGCGGGCCCCGG + Intronic
991769185 5:70025228-70025250 GCGCGTGCGCGGCCGGGGCTGGG - Intronic
991848480 5:70900646-70900668 GCGCGTGCGCGGCCGGGGCTGGG - Intronic
993900925 5:93584131-93584153 GCGGGAGCCCTCGCCGGGCTCGG - Exonic
997635098 5:135398981-135399003 GCGGGTGCCCGGGAGCGGCCCGG - Intronic
999258339 5:150222351-150222373 GCTGGTGCCCACCAGGGGCTGGG - Intronic
1002401702 5:178994788-178994810 CCCGGTGCACGCGCGGGGCGCGG - Exonic
1002692433 5:181059580-181059602 GCGCGTGCCCCCGCGGCGCCTGG + Exonic
1003566892 6:7229805-7229827 CCGCGTGGCCGCGTGGGGCTGGG - Exonic
1004229068 6:13814559-13814581 CCGGGCGCGCGGGCGGGGCTCGG + Exonic
1005334019 6:24775273-24775295 GCGGGAGCCGGGGCGGGGTTGGG + Intronic
1006814513 6:36840827-36840849 GCGGGGGATCGCGAGGGGCTTGG - Intergenic
1007959933 6:45949338-45949360 GCGGGTGCGTGCCGGGGGCTAGG + Exonic
1010794882 6:80106943-80106965 GCAGGCGCCCGCGAGGGGCAGGG + Intronic
1011258702 6:85450146-85450168 GCGGGCGCCCGCGCGGCTCGGGG - Exonic
1013575904 6:111483319-111483341 GCGGGCGCCCGGGCGGGACACGG + Intronic
1013836664 6:114342656-114342678 GCCGGTGCCCTCGTGGGGCAAGG - Exonic
1015149433 6:130020543-130020565 CCGGGTCCCCGCGGAGGGCTGGG + Intronic
1015251869 6:131135657-131135679 GCGGAGGCCAGGGCGGGGCTCGG - Exonic
1015496659 6:133889908-133889930 GCGCGAGTGCGCGCGGGGCTGGG + Intronic
1015626258 6:135182756-135182778 GCTGGTCCCCGCGCGGCGCTGGG + Intronic
1016340915 6:143060810-143060832 GCGGGCGCGGGCGCGGGGCGGGG - Intronic
1016738552 6:147506825-147506847 GCGGCGGCCCGCGCGGGGCGGGG + Intergenic
1018686450 6:166307880-166307902 GCTGGGGCCCGCGCGCGGCTGGG + Exonic
1019198681 6:170296742-170296764 GCAGGAGCCCGCGCGGGGTGGGG + Intronic
1019366928 7:638105-638127 CTGGGTGCCCACGCGGGCCTGGG - Intronic
1019421942 7:954675-954697 GCGAGTGCCGGCGCGGGGCCCGG + Intronic
1019762037 7:2820203-2820225 GCTGGTGGCCGCCCGGGGCTGGG + Intronic
1019989507 7:4682100-4682122 GCGCGCGCCAGCGCGGGGCTGGG - Intergenic
1021313182 7:19117164-19117186 GCGGGCGGCGGCGCGGGGCCCGG - Exonic
1022923462 7:35037821-35037843 TTCGGCGCCCGCGCGGGGCTCGG + Exonic
1025929390 7:65982146-65982168 GCGGTTGCCTGGGCGGCGCTCGG - Exonic
1026152820 7:67802623-67802645 GAGGGTACCCTGGCGGGGCTGGG + Intergenic
1026923735 7:74174543-74174565 GCGGGGGCCCGCGGAGGCCTAGG + Intronic
1027001740 7:74658509-74658531 GCGGGGGCGCGCGCGGTGCCAGG + Intronic
1027059363 7:75073465-75073487 TCGGGCGCCGGCGCGGGGCCCGG + Exonic
1027248022 7:76380206-76380228 GCGGGGAGCCGCGCGGGGCGGGG - Intergenic
1029535372 7:101154649-101154671 GCGGGTGGGCGAGCCGGGCTCGG + Intronic
1034963174 7:155374686-155374708 GCGGCTGCCCCTGCGGGGTTCGG + Intergenic
1035431880 7:158828958-158828980 GCGGGAGCCGGGGCAGGGCTGGG + Intronic
1036201413 8:6774091-6774113 GCCGCTGCCCGGGCTGGGCTGGG - Intergenic
1036664495 8:10730104-10730126 GCGGGTGCGAGCGCGGAGCCTGG - Intronic
1037769179 8:21789021-21789043 GCGGCTGGCGGCGCGGGGCGCGG + Intronic
1038540175 8:28385400-28385422 GCGGGTGCCCGGGGGGGGGGCGG - Intronic
1038644446 8:29350782-29350804 GCGGGGGACGGCGCGGGGCCCGG - Intergenic
1039903173 8:41767301-41767323 GCGGTTGCCCGGCCGGGGCCGGG - Intronic
1042962669 8:74320757-74320779 GCGGGCGCGGGCGCGGGGGTGGG + Intronic
1047203168 8:122782714-122782736 GGGGGAGTCCGCGCGGGGCGGGG + Intronic
1048299189 8:133238980-133239002 GCGGGTGCCCTCGCTGGTGTGGG + Exonic
1049418265 8:142505381-142505403 GGGGCTGCCCGAGCAGGGCTGGG + Intronic
1049673095 8:143878339-143878361 GCGGGTGCGGGCTCGGGGCCGGG - Intronic
1049694495 8:143976791-143976813 GTGGGGGCCGGGGCGGGGCTCGG - Intergenic
1049799085 8:144509507-144509529 GCTGGTGGACGCGCAGGGCTCGG + Exonic
1056992391 9:91423901-91423923 GCGGGTGCGGGCGCGGCGATTGG - Intergenic
1058176051 9:101737779-101737801 GCGGCTGGCCGCGCGGGGGGCGG + Exonic
1059123275 9:111661544-111661566 GCGGGTGCCGCCCCGGGGCGGGG - Exonic
1060552093 9:124490458-124490480 GTGGGTGGCCGGGCTGGGCTGGG + Intronic
1060996580 9:127877596-127877618 GTGCGTGCCCGCGCGTGTCTGGG - Intronic
1061084925 9:128393123-128393145 GCCGGTGCGTGCGCGGGGCTGGG - Intergenic
1061326357 9:129867165-129867187 GCGGGTGCTCGGGTGGTGCTGGG - Intronic
1061540651 9:131276627-131276649 GCGGGTGCGGGTGCGGGGCCCGG - Intergenic
1062326552 9:136015245-136015267 GCAGGTGCCCACGCGGGCCCTGG - Intronic
1062467639 9:136688031-136688053 GCGTGTGTCTGGGCGGGGCTGGG + Intergenic
1062542205 9:137046446-137046468 GCGGGTGCGGGTGAGGGGCTCGG - Intergenic
1185469336 X:373441-373463 GCGGGGGCCCACGCGGGGCCGGG + Intronic
1186107968 X:6226915-6226937 GCGGGTGCCAGCGCGGGCTGTGG + Intronic
1190984456 X:55488595-55488617 GCGGGAGCGGGCCCGGGGCTGGG + Exonic