ID: 1121076647

View in Genome Browser
Species Human (GRCh38)
Location 14:91074551-91074573
Sequence AATTATATGGGGCAGAAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 472
Summary {0: 1, 1: 0, 2: 10, 3: 46, 4: 415}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121076647 Original CRISPR AATTATATGGGGCAGAAATT GGG (reversed) Intronic
902738753 1:18419556-18419578 AATAATGTGGGACATAAATTGGG - Intergenic
903513925 1:23897233-23897255 AATCACATGGGGCAGAAAACAGG + Intronic
904285434 1:29450550-29450572 AATTTTCTGGGTCAGGAATTTGG - Intergenic
904299491 1:29544954-29544976 GAGTATATGGGTCAGGAATTTGG + Intergenic
906868601 1:49450937-49450959 AATTCTATAGGTCAGAAATTCGG + Intronic
908025820 1:59950664-59950686 AATTCTATGGGCCAGGACTTTGG + Intergenic
908934638 1:69359820-69359842 AATTATGTGGGTCAGATACTAGG - Intergenic
911249767 1:95562002-95562024 ACTGAATTGGGGCAGAAATTTGG - Intergenic
911403348 1:97405304-97405326 AACTATATAGGCCAGAAACTTGG - Intronic
911686021 1:100778659-100778681 TATTTTATGGGGCAGAAATATGG - Intergenic
914355293 1:146879443-146879465 TATTACATGGGGCTGAAACTAGG - Intergenic
915563596 1:156701624-156701646 ATTGCTGTGGGGCAGAAATTGGG - Intronic
915954683 1:160211970-160211992 AATTTTAAGTGGCAAAAATTGGG + Intronic
916217151 1:162406870-162406892 AATTAAATGGAGTAGATATTAGG - Intronic
916800633 1:168212838-168212860 AATGATATAGGTCAGAAACTTGG + Intergenic
916879683 1:169008093-169008115 TATAATATGGTGCAGAAAATAGG - Intergenic
917364645 1:174216653-174216675 AATTATATAGGTCAAAAATGTGG - Intronic
917556754 1:176098063-176098085 AATTATATAGGTCAGATATTAGG + Intronic
918103316 1:181395423-181395445 GGTTATATGAGTCAGAAATTTGG + Intergenic
920795958 1:209136475-209136497 AATGATATAGGTCAAAAATTTGG + Intergenic
921287221 1:213620212-213620234 GATATTATGGGTCAGAAATTTGG + Intergenic
921418089 1:214913736-214913758 AATTATATTGGTCAGAACTTGGG - Intergenic
924173352 1:241364432-241364454 AATTCTGTGGAGCAGATATTGGG + Intergenic
924181501 1:241443365-241443387 GATTCTATGGGTCAGCAATTTGG + Intergenic
924249165 1:242114136-242114158 AATTTGATGAAGCAGAAATTAGG - Intronic
1063807621 10:9665050-9665072 AATTATATAGGTCAAAAATTTGG - Intergenic
1065087932 10:22198860-22198882 AATAATATAGGTCAGAAACTTGG - Intergenic
1065966155 10:30772242-30772264 AATTTTCTGGGTCAGAAACTTGG + Intergenic
1067241661 10:44500590-44500612 AATTCTTTGGGGTATAAATTTGG + Intergenic
1068412825 10:56679625-56679647 AAGTATATGAGGCTGAAACTTGG - Intergenic
1070125932 10:73621790-73621812 AATTATACACAGCAGAAATTTGG + Intronic
1071049987 10:81435854-81435876 ATATATATTTGGCAGAAATTTGG - Intergenic
1072942370 10:99777991-99778013 AATGATATAGGTCAGAAATTTGG - Intergenic
1073021280 10:100446379-100446401 GTTTATATGGGTGAGAAATTCGG + Intergenic
1073886515 10:108045627-108045649 AAATATATTGGCAAGAAATTTGG - Intergenic
1074046766 10:109846714-109846736 AATTATATTGTCCAGGAATTTGG + Intergenic
1074229049 10:111515541-111515563 AATTCTGTGGGTCAGCAATTGGG - Intergenic
1074331538 10:112516591-112516613 AATTATATTTGGGAGATATTTGG - Intronic
1074445060 10:113514819-113514841 AATTCTTTGGGGCAAATATTTGG + Intergenic
1074547958 10:114416428-114416450 AATTTCATGGGGGAGCAATTAGG + Intergenic
1077679852 11:4228663-4228685 AATTTTATGGGGAAGCGATTAGG + Intergenic
1077681635 11:4247246-4247268 AATTTTATGGGGAAGTGATTAGG - Intergenic
1077689266 11:4325238-4325260 AATTTTATGGGGAAGCGATTAGG + Intergenic
1077726961 11:4684430-4684452 AAATATATGGGACAGAACTAAGG + Intronic
1077778914 11:5303488-5303510 AATTATATGTTTCAGAATTTTGG + Intronic
1078323304 11:10356589-10356611 GATTATATGGGTCAGGAGTTTGG - Intronic
1079520960 11:21326600-21326622 AATGATATCAGACAGAAATTTGG - Intronic
1079873576 11:25830182-25830204 GATTGTGTGGGGCAGAAATTAGG - Intergenic
1079978143 11:27118481-27118503 GATTATGTGGGGCAGAGATAAGG + Intronic
1080083019 11:28243910-28243932 GATTTTGTGGGTCAGAAATTTGG + Intronic
1080531198 11:33178340-33178362 AATTATCTGTGGCAGATATAGGG + Intergenic
1080894847 11:36440558-36440580 AATAATCTGGGGAAGAAATGAGG + Intronic
1080973837 11:37311103-37311125 AATTACATGTTGCAGAGATTTGG + Intergenic
1081499286 11:43650054-43650076 GATTTTATGGGGCAGAAATTGGG - Intronic
1081517314 11:43845756-43845778 AATTATATGGCAGAGAAGTTGGG - Intronic
1081695518 11:45106521-45106543 GATTCTGTGGGTCAGAAATTTGG + Intronic
1082636926 11:55607541-55607563 AATTATATTGGGAAGAAAAGAGG - Intergenic
1083026028 11:59551633-59551655 AATAATATGGGGAAAAAACTTGG - Intergenic
1083125944 11:60565607-60565629 AATTATTTGGGTCAGATATGAGG - Intergenic
1085265295 11:75234453-75234475 AATTCTGTGAGTCAGAAATTTGG + Intergenic
1085358486 11:75862985-75863007 AAGTAGATGGGGCAGATCTTAGG + Intronic
1086792637 11:91062424-91062446 AATGATTTGGGGCAAACATTAGG + Intergenic
1087471101 11:98575364-98575386 AATCATGTGGGACAGAAATCAGG + Intergenic
1087568550 11:99895007-99895029 AAATATATAAGGCAGAAATCAGG + Intronic
1087609912 11:100422032-100422054 AATGATATAGGTCAGAAACTTGG + Intergenic
1088678480 11:112219306-112219328 CATTATATGAGGGTGAAATTTGG + Intronic
1091019334 11:132085485-132085507 AATTATACGGGTCAGATACTAGG - Intronic
1091892249 12:4068265-4068287 AATGATATAGGTCAGAAACTTGG - Intergenic
1092973814 12:13724765-13724787 AATCTTAGGGAGCAGAAATTAGG - Intronic
1093036880 12:14340370-14340392 AATTATGTAGGCCAGAAACTTGG - Intergenic
1093357287 12:18181352-18181374 AATAATATAGGTCTGAAATTTGG + Intronic
1093887446 12:24478813-24478835 AATTAAATGGAGAAGGAATTGGG - Intergenic
1095160717 12:38912010-38912032 GATTCTTTGGGTCAGAAATTAGG + Intergenic
1096568798 12:52506044-52506066 AATTATATAGGTCAGAAACTCGG - Intergenic
1097456298 12:59802583-59802605 AATTATATAGATCAGAAATTTGG - Intergenic
1097980598 12:65734225-65734247 AATTTTGTGGGTCAGAAATCTGG + Intergenic
1098218294 12:68242549-68242571 TATTATAGGGGGGAGAAGTTGGG + Intergenic
1098755542 12:74358184-74358206 AATTATATAGGTTAGAAATGTGG + Intergenic
1099525588 12:83714965-83714987 AATTATATGGGTCAGAAACTTGG + Intergenic
1099579717 12:84428809-84428831 AATTATATTACCCAGAAATTTGG - Intergenic
1099918652 12:88928953-88928975 AATTATATGTGGCATATAGTTGG + Intergenic
1101764197 12:107683203-107683225 AATTCTGGGGGTCAGAAATTTGG + Intergenic
1102564758 12:113789000-113789022 AATAACATGGGGCAGAGATATGG + Intergenic
1104881037 12:132070335-132070357 AAATAAATGGGGCTGAAAATAGG - Intronic
1107026658 13:35808822-35808844 AATGATATGGGGAAGAAATATGG + Intronic
1107663758 13:42667310-42667332 AATTATATAGGTCTGAAATTTGG + Intergenic
1108777955 13:53789218-53789240 AATTCTTTAAGGCAGAAATTAGG - Intergenic
1108993283 13:56692348-56692370 AATTACATTGGGAATAAATTTGG - Intergenic
1109204378 13:59465450-59465472 AATTTTAATGTGCAGAAATTTGG - Intergenic
1109513839 13:63415255-63415277 GATTCTATGGGCCATAAATTCGG - Intergenic
1109637170 13:65136560-65136582 AATTACATGAGGCTGAACTTGGG - Intergenic
1109776277 13:67044910-67044932 GATTATCTGGTGCAAAAATTAGG + Intronic
1110311324 13:74052837-74052859 AAGTTTATGAGGCAGAAATGAGG - Intronic
1110654370 13:77979514-77979536 ATTTATAAGGGGAAGAAATATGG + Intergenic
1111194828 13:84860868-84860890 AGATATATGATGCAGAAATTTGG - Intergenic
1111203250 13:84967549-84967571 ACTAAAATGGGGCAGATATTTGG + Intergenic
1111752028 13:92344760-92344782 AACAATGTGGGGCAGAAATAGGG + Intronic
1113228213 13:108181889-108181911 AATGTTATGGTGGAGAAATTTGG - Intergenic
1114983901 14:28201406-28201428 AATTACATAGATCAGAAATTAGG - Intergenic
1115807369 14:37066081-37066103 AATTAGATGGTGGAGAAATCAGG + Intronic
1116187682 14:41618623-41618645 GATTTTATGGGTCAGCAATTTGG - Intronic
1116566619 14:46452817-46452839 AAGAATTTGAGGCAGAAATTAGG - Intergenic
1116654271 14:47631508-47631530 GATAATTTGGGGAAGAAATTTGG - Intronic
1117435286 14:55709962-55709984 ACTTTTATGGTGGAGAAATTTGG + Intergenic
1117607962 14:57451069-57451091 AATGATATAGGTCAGAAATTTGG - Intergenic
1117611521 14:57487761-57487783 AATTTTCTTTGGCAGAAATTAGG + Intronic
1118083936 14:62394164-62394186 AATTAAATGGGGCAGAAGTTTGG - Intergenic
1118409784 14:65467091-65467113 AATTATATAGATCAGAAATATGG - Intronic
1118480843 14:66163719-66163741 ATTTATATGGGGCTCAAATCAGG - Intergenic
1118551762 14:66959200-66959222 AATTATATGGGGCAGAAAAGAGG + Intronic
1119082477 14:71708684-71708706 AATTCAATGGGGAAAAAATTAGG - Intronic
1119109003 14:71953797-71953819 AATTATACAGGTCAGAAACTTGG - Intronic
1119992581 14:79215998-79216020 GATTCTGTGGGCCAGAAATTTGG + Intronic
1120036182 14:79701333-79701355 AATTCTGTGAGACAGAAATTTGG + Intronic
1120209403 14:81620016-81620038 AATAATTGGGGGCAGTAATTGGG + Intergenic
1120469963 14:84910325-84910347 AATTTTCTGGGGCAGGAACTGGG - Intergenic
1120647836 14:87094608-87094630 GATTATATGGGGAAGCCATTAGG + Intergenic
1121076647 14:91074551-91074573 AATTATATGGGGCAGAAATTGGG - Intronic
1121261185 14:92567335-92567357 AATTCTATGGCTCAGCAATTTGG + Intronic
1121372463 14:93372082-93372104 AATAATATAGGACAGAAACTTGG + Intronic
1124472172 15:29997698-29997720 AATTCTGTGGGTCAGGAATTTGG + Intergenic
1125180236 15:36874369-36874391 TATTATAGAGGGCAGAAAATGGG + Intergenic
1125727203 15:41874152-41874174 AAATAGCTGGGGCAGAGATTTGG + Intronic
1125788666 15:42345608-42345630 AAATATATTGGGTAGAAGTTAGG - Intronic
1127025864 15:54805666-54805688 AATTATTTGGGCCTGAAATTGGG + Intergenic
1127342045 15:58056988-58057010 AACTATGTTGGACAGAAATTTGG + Intronic
1127354105 15:58181711-58181733 AAGTATTTGGGGCAGAAGTTTGG + Intronic
1128404336 15:67319744-67319766 AATTATATGACTCGGAAATTGGG - Intronic
1128801243 15:70498452-70498474 GATTCTCTGGGGCAGAATTTGGG - Intergenic
1129095586 15:73203945-73203967 AATGATATAGGTCAGAAACTTGG - Intronic
1130751670 15:86719173-86719195 AAGTCTGTGGGGGAGAAATTGGG + Intronic
1131079293 15:89521265-89521287 GATTTTGTGGGCCAGAAATTTGG - Intergenic
1131362966 15:91810718-91810740 AATAATATGGGTCAGAAGTTTGG + Intergenic
1131670679 15:94616492-94616514 GATTTTGTGGGTCAGAAATTTGG + Intergenic
1131672724 15:94637020-94637042 GATTAAATGTGGCAGAAATGTGG - Intergenic
1131737126 15:95345678-95345700 AATAATATGGGGAAGAGACTTGG - Intergenic
1137516194 16:49146737-49146759 GATTCTATGGGTCAGCAATTTGG + Intergenic
1138176531 16:54903661-54903683 ACTTATATAGGCCAGAAACTTGG + Intergenic
1139231766 16:65290255-65290277 AATTAAAGGGGGCAGATTTTAGG + Intergenic
1139639453 16:68280535-68280557 TATTTTATCGGGCAGGAATTTGG - Intronic
1139681551 16:68568463-68568485 AATTATTTTGGGGAGTAATTTGG + Intronic
1139978724 16:70836087-70836109 TATTACATGGGGCTGAAACTAGG + Intronic
1140215791 16:73006983-73007005 AAATATTTGGGGAAAAAATTGGG - Intronic
1140649700 16:77073619-77073641 AATAATATAGGTCAGAAATTTGG + Intergenic
1141189405 16:81813603-81813625 AATTCTGTGGGTCAGGAATTTGG + Intronic
1143463298 17:7117802-7117824 GATTCTCTGGGTCAGAAATTTGG - Intergenic
1144410088 17:14992334-14992356 AGAGAGATGGGGCAGAAATTGGG - Intergenic
1144470456 17:15535541-15535563 AATTGTGTGGGACAGGAATTTGG - Intronic
1144925885 17:18808131-18808153 AATTGTGTGGGACAGGAATTTGG + Intergenic
1147914770 17:43879711-43879733 AACTATATGGGGGAGCAATGAGG + Intronic
1150191850 17:63250385-63250407 CATTATATTGGGAAGATATTAGG - Intronic
1150376925 17:64689172-64689194 AATTATATGGCTCAGCAATTTGG + Intergenic
1150509857 17:65739250-65739272 AATTCTTTGGATCAGAAATTTGG - Intronic
1150961079 17:69912945-69912967 AATGATTTGGGGCAGATATTTGG - Intergenic
1152764086 17:82126431-82126453 CATTATATGTGATAGAAATTAGG - Intronic
1153138472 18:1944734-1944756 CAATAAATGTGGCAGAAATTAGG + Intergenic
1153532465 18:6062095-6062117 AATTATATGGGTCAGAAACCCGG - Intronic
1153718495 18:7876469-7876491 AATTCTATGGGTCAGCAGTTGGG + Intronic
1155428902 18:25735074-25735096 CATTATATGGCTCAAAAATTCGG + Intergenic
1155947609 18:31873841-31873863 AATTATATGGGTTAGAATTTTGG - Intronic
1156129571 18:33954281-33954303 AAATATATGGGGAAAAAATAAGG - Intronic
1156625571 18:38903513-38903535 TATGACATGGGGCAGAAATCAGG + Intergenic
1156723349 18:40097278-40097300 AATTATATTTGGAAGAGATTGGG + Intergenic
1156877755 18:42036471-42036493 AATTATATAAGACAAAAATTTGG - Intronic
1156912866 18:42431320-42431342 AATGATATGGATCTGAAATTGGG + Intergenic
1157049053 18:44138784-44138806 AATTGTATAGGTCAGAAATATGG + Intergenic
1157851256 18:51053374-51053396 AATTGTTTGGGGCACAAAATTGG - Intronic
1158256078 18:55550544-55550566 AATTACACTGGCCAGAAATTTGG + Intronic
1159500113 18:69257903-69257925 AATTTTGTGGGCCAGAAGTTCGG + Intergenic
1159524817 18:69574675-69574697 AATTGCATGGGGCAATAATTGGG + Intronic
1160064852 18:75565105-75565127 AATTATCGGTGGCAGTAATTTGG + Intergenic
1160202452 18:76806957-76806979 CATTGTATGGGTCAGAAATCAGG - Intronic
1164665767 19:30035223-30035245 AATCATATAGTTCAGAAATTCGG - Intergenic
1166610545 19:44190142-44190164 AATTATCTTTGGTAGAAATTAGG - Intergenic
1167858033 19:52258438-52258460 AAGCAGATGGGGCAGAATTTAGG - Intergenic
926569842 2:14517785-14517807 AAATATTTGGGGCAGTGATTGGG - Intergenic
926927134 2:17998378-17998400 AATTATGTGGGTCAGATACTAGG + Intronic
927829539 2:26337497-26337519 AATTCTGTGGGTCAGCAATTTGG - Intronic
928482153 2:31693694-31693716 AATTATCTGAGGCAGCTATTGGG - Intergenic
928737056 2:34303803-34303825 AATTATTTTGGGCAGCAACTTGG - Intergenic
929321112 2:40544442-40544464 AATCATAGGGGGTTGAAATTAGG + Intronic
930571704 2:53094339-53094361 GATTCTGTGAGGCAGAAATTCGG - Intergenic
930597812 2:53409669-53409691 ATTTTTGTGGGTCAGAAATTTGG - Intergenic
930846581 2:55912245-55912267 AATTATATGGAAGAAAAATTAGG + Intronic
932252871 2:70259398-70259420 TATTACCTGCGGCAGAAATTTGG + Exonic
933881708 2:86676144-86676166 AATTCTGTGGGTCAGCAATTTGG - Intronic
934107118 2:88705129-88705151 AATTACTTTGGGCAGTAATTTGG - Intronic
935377111 2:102410911-102410933 AATTATGTGGGTCAGATACTAGG + Intergenic
936282402 2:111153515-111153537 AAATATTGGGGGCAGAAATCTGG + Intronic
936590778 2:113801806-113801828 ATTGATATGGAGCAGAACTTTGG + Intergenic
938605574 2:132889241-132889263 AATTTTATGGGTCAGAAATTTGG - Intronic
938717923 2:134037774-134037796 AAATATATAGGTTAGAAATTTGG + Intergenic
938833435 2:135075122-135075144 AATTATATGGGGAAATATTTTGG + Intronic
939024993 2:137002000-137002022 AATTAGATGGGAAAGAAAATAGG - Intronic
939046523 2:137256770-137256792 AATTATCTGGGCAAGAAATGAGG + Intronic
939223253 2:139331145-139331167 AATGATATAGGTCAGAAACTTGG + Intergenic
939390840 2:141567948-141567970 AATAATATCAGGCACAAATTTGG - Intronic
940120777 2:150262522-150262544 AATGATATAGGTTAGAAATTTGG + Intergenic
940448898 2:153813816-153813838 AATTATATAGGTTAGGAATTTGG + Intergenic
940798197 2:158103115-158103137 ATTCATATTGGGTAGAAATTTGG + Intronic
942181412 2:173384431-173384453 GATTCTATGGGTCAGGAATTTGG - Intergenic
943415819 2:187602748-187602770 AATTCTGTGGATCAGAAATTTGG + Intergenic
943523146 2:188979729-188979751 AATCATATGGGACAGAGCTTTGG + Intronic
943968715 2:194374604-194374626 ATTTATATTGCTCAGAAATTTGG + Intergenic
945509859 2:210687503-210687525 AATTACATAGGTTAGAAATTTGG + Intergenic
945536969 2:211028985-211029007 AAATATATTGGGCAGAAATCTGG + Intergenic
945616692 2:212079217-212079239 AATTATTGGGGGGTGAAATTTGG - Intronic
946033211 2:216721510-216721532 TATTCTACGGGTCAGAAATTTGG - Intergenic
946055625 2:216899501-216899523 AATTATATAGGTCAGAAACGTGG - Intergenic
946526848 2:220529954-220529976 AATTATAGGCTCCAGAAATTAGG - Intergenic
947067515 2:226245634-226245656 AATTATATTGGGTAGATATATGG - Intergenic
947497492 2:230648725-230648747 AATTATCTTGGGTAGAATTTTGG - Intergenic
947981745 2:234416333-234416355 AATTATAAGGGGGAAAGATTTGG - Intergenic
1168994321 20:2121460-2121482 AATAAGATGGGGAAGACATTGGG + Intronic
1169002939 20:2181223-2181245 GATTCTGTGGGTCAGAAATTTGG - Intergenic
1169176372 20:3518713-3518735 AATAATATGGGGGAGAAGGTGGG - Intronic
1169503877 20:6187415-6187437 ATTTCTATGGGTCAGGAATTTGG + Intergenic
1169513574 20:6292465-6292487 AATTTTGTGGGTCAGGAATTTGG + Intergenic
1169668438 20:8066713-8066735 AATTTTATGGGGTTAAAATTGGG - Intergenic
1169795482 20:9458504-9458526 AATTCAGTGGGTCAGAAATTTGG + Intronic
1170420162 20:16184644-16184666 AATTCTGTGGGTCAGAGATTTGG - Intergenic
1170753630 20:19176057-19176079 AATTATATAGGTCAGAAGCTTGG + Intergenic
1172126955 20:32630180-32630202 ATTTAGATGGGAGAGAAATTTGG + Intergenic
1173124740 20:40326332-40326354 ATATATGTGGGGCAGAAACTTGG - Intergenic
1173313727 20:41924677-41924699 AATTATTTGGGGCAGAATGCTGG + Intergenic
1173817613 20:45999838-45999860 TATTCTGTGGGTCAGAAATTTGG - Intergenic
1175623389 20:60469699-60469721 AATGTTGTGGGTCAGAAATTTGG + Intergenic
1177012003 21:15742070-15742092 AAGTAAATTGGACAGAAATTGGG + Intronic
1177102860 21:16917393-16917415 TAATATATGAGGAAGAAATTTGG - Intergenic
1177919651 21:27135388-27135410 AATGAAATGGGCCTGAAATTGGG + Intergenic
1178180577 21:30156668-30156690 AATTTTATGAGGCAGTAATTTGG + Intergenic
1178196920 21:30356298-30356320 AATTATATGTAATAGAAATTAGG - Intronic
1178542883 21:33469887-33469909 GATTTTATGGGTCAGGAATTTGG - Intronic
1179823216 21:43949276-43949298 AATTCTGTGGGTCAGCAATTTGG + Intronic
1182332436 22:29560842-29560864 AATAATATGGGGCAGAAGCCAGG + Intronic
1184702808 22:46188168-46188190 AATTCTATGGGTCAGCAAATTGG - Intronic
1184888581 22:47365416-47365438 AATTATATAGGCCATATATTTGG - Intergenic
949877613 3:8636497-8636519 GATTTTATGGGTCAGGAATTAGG - Intronic
949962803 3:9328069-9328091 AATTATGCAGGGCAGATATTAGG - Intronic
951193196 3:19794441-19794463 ATATATATGGGGTAGAAACTGGG - Intergenic
951311654 3:21133598-21133620 AAGTATAAGGGGAAGAAATATGG - Intergenic
952161646 3:30699748-30699770 AATTTTATGGGTCAGAAATTTGG + Intergenic
952516416 3:34108925-34108947 GATTCTGTGGGGCATAAATTTGG + Intergenic
953315153 3:41920421-41920443 AAGTATATGGGGCACACAATGGG - Intronic
953503992 3:43465103-43465125 ATTTATATGGGGTAAAACTTAGG - Intronic
955904935 3:63796850-63796872 AATTATATGGCGCAGAAACTTGG - Intergenic
956216350 3:66853386-66853408 AATTCTGTGGGTCAGAAATTTGG + Intergenic
956485936 3:69722101-69722123 AATTATACAGGGGAGAAATCTGG + Intergenic
956545660 3:70399315-70399337 TGTTAAATGGGGTAGAAATTGGG + Intergenic
957127665 3:76182974-76182996 AATTTTATGGGTCAGAAATTTGG + Intronic
957510640 3:81183368-81183390 GAATATATGAGTCAGAAATTTGG + Intergenic
957715834 3:83928755-83928777 AATCACATGAGGCCGAAATTTGG - Intergenic
957746878 3:84355718-84355740 AATTAAATGGGCCAGAGATGAGG - Intergenic
958144773 3:89610107-89610129 TATTATATGAGCCAGAAGTTAGG - Intergenic
958899511 3:99869309-99869331 AATTTTATGGGGCAGAATTTGGG + Intronic
959269933 3:104193761-104193783 ATTCATATGAGGTAGAAATTAGG - Intergenic
959896004 3:111606893-111606915 ACTTTTTTGGGGCTGAAATTGGG + Intronic
960406126 3:117262076-117262098 AATATTATGAGGCAGAAACTGGG - Intergenic
960510653 3:118544996-118545018 AATAATGTGGAGGAGAAATTGGG - Intergenic
960517600 3:118619178-118619200 TGTTATATGGGGCAGAACTTTGG + Intergenic
961418968 3:126784604-126784626 AATTATATGGGGCATGAGTGAGG - Intronic
961478842 3:127166568-127166590 AATTTTGTGGGTCAGGAATTTGG + Intergenic
962550713 3:136488087-136488109 ATTTCTATGGGTCAGGAATTTGG - Intronic
962614457 3:137110913-137110935 AATCAAATGGGGTAGAAGTTAGG + Intergenic
962904674 3:139790895-139790917 GTTTCTATGGGTCAGAAATTTGG + Intergenic
962918442 3:139929916-139929938 GATTCTATGGGTCAGGAATTTGG + Intergenic
963922679 3:150921158-150921180 AATAAAATGGGTTAGAAATTGGG + Intronic
964174547 3:153810305-153810327 AAGAATATAAGGCAGAAATTAGG + Intergenic
964668344 3:159198140-159198162 AAGAATGTGTGGCAGAAATTGGG + Intronic
964824990 3:160815722-160815744 GATTATATGTCGCAGAAATCTGG - Intronic
964852644 3:161111634-161111656 AATAATAGAGGTCAGAAATTTGG + Intronic
965699724 3:171448053-171448075 AATAATATGGGGGAGAAGGTGGG + Intronic
965866508 3:173211468-173211490 AATTAAATGCAACAGAAATTTGG + Intergenic
966275545 3:178161559-178161581 AATGATATAGGTCAGAAATACGG + Intergenic
966380209 3:179337316-179337338 AATTATATGGTTCTGAAACTTGG - Intergenic
966463249 3:180201192-180201214 AATTATATGGTACCGAAGTTTGG + Intergenic
967693380 3:192503469-192503491 AATGGTATTGGGCAGTAATTTGG - Intronic
969888917 4:10241605-10241627 AATTTTCTGTGGAAGAAATTAGG - Intergenic
970805663 4:20028165-20028187 AATTGTGTGGGTCAGCAATTTGG + Intergenic
970959827 4:21858492-21858514 AATGAAATGAGGCAGAAATTGGG - Intronic
971193977 4:24454243-24454265 AATTATATGGGTCAGGAATATGG - Intergenic
971390538 4:26181399-26181421 CATTAGATAGGGCAGAATTTAGG - Intronic
971543576 4:27854708-27854730 AATGGTATGCTGCAGAAATTTGG + Intergenic
973088711 4:46103626-46103648 AATTATAACAGGCAAAAATTTGG - Intronic
973826733 4:54715055-54715077 AATTATATGATGCAGTGATTTGG - Intronic
974075124 4:57161611-57161633 AATCCTATGGGTCAGAAATTTGG + Intergenic
974093893 4:57340699-57340721 AATTCTGTGGGTCAGGAATTTGG + Intergenic
974138271 4:57848526-57848548 AATTTTATATGTCAGAAATTTGG + Intergenic
975412506 4:74070272-74070294 AATTATATGGGTCAGACACTAGG - Intergenic
975448271 4:74493501-74493523 TATATTATAGGGCAGAAATTGGG + Intergenic
976172047 4:82314360-82314382 AAATATATAGGTCAGAAACTTGG + Intergenic
977034627 4:91934178-91934200 AATGATACAGCGCAGAAATTTGG - Intergenic
977190973 4:94000451-94000473 AATTTTGTGGAACAGAAATTTGG + Intergenic
977354947 4:95933613-95933635 ACAAATTTGGGGCAGAAATTTGG + Intergenic
978166835 4:105619430-105619452 AATTGTATGGGTCAACAATTGGG - Intronic
978522614 4:109632473-109632495 GTTTATGTGGGGCAGGAATTTGG + Intronic
978937204 4:114392231-114392253 AATAATATGGGACAGAAAAGTGG + Intergenic
979761538 4:124411460-124411482 AATTATATATGGAAGAAAATTGG + Intergenic
979922744 4:126522007-126522029 AATTCCATGGGTTAGAAATTTGG - Intergenic
980059041 4:128109134-128109156 AATTATTAAGGTCAGAAATTTGG - Intronic
980714616 4:136613842-136613864 TAATAGATGGGGAAGAAATTTGG - Intergenic
981528524 4:145731472-145731494 ATTAATATGGGGCACATATTTGG + Intronic
982955459 4:161759957-161759979 AATCATATGAGGAAGAAAGTTGG - Intronic
983129151 4:163993500-163993522 AAATATATGTGGCCAAAATTAGG - Intronic
984612689 4:181858348-181858370 ATTTGTGGGGGGCAGAAATTAGG + Intergenic
985404099 4:189618977-189618999 AAATAAATGGGGCTGATATTGGG + Intergenic
986153679 5:5152136-5152158 AATTATTTGGAGCAGAATGTGGG - Intronic
986818669 5:11441127-11441149 AATTATATGGGGATCATATTTGG + Intronic
987153694 5:15066304-15066326 AATTATGTAGGTCAGAAACTTGG + Intergenic
987527523 5:19072415-19072437 AATTTTATGGAGCATACATTAGG + Intergenic
987748607 5:22009465-22009487 AATTATATGTTCAAGAAATTTGG - Intronic
988491914 5:31712260-31712282 GATTATTTGGGCCAGGAATTTGG + Intronic
988875439 5:35440398-35440420 AATTATATAGGTTAGAAACTTGG + Intergenic
989502904 5:42189878-42189900 AATTATATGAGAATGAAATTAGG + Intergenic
989554400 5:42775584-42775606 AATGATATAGGCCAGAAACTTGG + Intronic
990646766 5:57854327-57854349 AATTATTTGGGCTGGAAATTTGG + Intergenic
991338305 5:65575551-65575573 AATTAGATGGGACAGAAGTCTGG + Intronic
991768789 5:70019264-70019286 AATTATATGTTGGAGAAATTTGG - Intergenic
991848027 5:70894341-70894363 AATTATATGTTGGAGAAATTTGG - Intergenic
992601378 5:78404186-78404208 AATAATATAGGTCAGAAACTTGG - Intronic
992883698 5:81136257-81136279 AATGATATAGGTCAGAAACTTGG - Intronic
993569551 5:89520092-89520114 AATTCCATGGGACAGAAATTCGG - Intergenic
995005577 5:107190644-107190666 ACTTATATAGGTCAGAAATGTGG + Intergenic
995237972 5:109851824-109851846 AAATATAAGGAGAAGAAATTGGG + Intronic
995320406 5:110827100-110827122 AATTATACAGGTCAGATATTGGG + Intergenic
995660143 5:114472670-114472692 ATGTATATGGGGTAGAAATAAGG - Intronic
995915274 5:117238070-117238092 AATTGTATTGGGGAGCAATTTGG - Intergenic
995916847 5:117257305-117257327 AATTATATGGTGGATTAATTTGG - Intergenic
996027768 5:118667869-118667891 AATGATATAGATCAGAAATTTGG - Intergenic
996164422 5:120207419-120207441 AATTATATTGGGAATAAAGTTGG + Intergenic
996263263 5:121500827-121500849 TTTTATAGGAGGCAGAAATTAGG + Intergenic
997768372 5:136527826-136527848 AATTTTCTGGGTCAGAAATTAGG + Intergenic
998013992 5:138717843-138717865 GATTCTATGGGTCAGTAATTTGG + Intronic
998961520 5:147492302-147492324 AATGATATAGGTCAGAAACTTGG + Intronic
1000225409 5:159256417-159256439 AGTTACATGGGGCAGTAATGAGG + Intergenic
1001189432 5:169614356-169614378 AATGATATAGGTCAGAAACTTGG + Intergenic
1001650507 5:173312453-173312475 AATTTTACAGGTCAGAAATTTGG - Intergenic
1002691785 5:181054993-181055015 AATTATTTGGGGAAATAATTGGG + Intronic
1003195976 6:3915339-3915361 GGTTGTATGGGGCAGATATTTGG - Intergenic
1003414166 6:5893347-5893369 AATTCTGTGGGTCAGGAATTTGG + Intergenic
1004952359 6:20687839-20687861 AATGATGTAGGTCAGAAATTTGG - Intronic
1005799022 6:29400299-29400321 GATTCTGTGGGTCAGAAATTGGG + Intronic
1007048297 6:38799548-38799570 AATAATTTGAGCCAGAAATTGGG - Intronic
1008737851 6:54569061-54569083 AAGTATATAGGTCAGAAATGAGG - Intergenic
1008896311 6:56560118-56560140 AATTATATTGTGCAGAAAATTGG - Intronic
1009735608 6:67672958-67672980 AATTATATGGGTTAGATACTAGG - Intergenic
1009750907 6:67878450-67878472 AATTATAGGGGGTTGAAGTTAGG + Intergenic
1010104030 6:72147061-72147083 AATTATACAGGTCAGATATTAGG - Intronic
1010369794 6:75094567-75094589 AGTTAAATGGGGTATAAATTGGG + Intronic
1010612686 6:77973815-77973837 AATGATAAAGGTCAGAAATTTGG + Intergenic
1011095071 6:83652713-83652735 AATTATATGGGTCATAAACTTGG - Intronic
1011097805 6:83685530-83685552 AATTCTATGGGGCAAAACTAGGG + Intronic
1012016817 6:93863079-93863101 AATTTTGTGGGTCAGGAATTTGG + Intergenic
1013268405 6:108522630-108522652 AATTTCATGGTGCAGAAATAAGG - Exonic
1013290924 6:108717977-108717999 ATTTATATAGTGAAGAAATTGGG + Intergenic
1013409549 6:109871914-109871936 AATTTTGTGGGCCAGGAATTTGG - Intergenic
1013661492 6:112301703-112301725 AGTTATATTTGGCAGAAAATAGG + Intergenic
1013910927 6:115274957-115274979 AATTCTGTGTGTCAGAAATTTGG - Intergenic
1015431442 6:133135189-133135211 AATAAAATTGGGCAGATATTAGG + Intergenic
1015486272 6:133773493-133773515 AATTTTATGGGCTAGGAATTTGG - Intergenic
1016708538 6:147142487-147142509 AACTATAAGGGACATAAATTGGG - Intergenic
1016856986 6:148680503-148680525 AACTATAGGGGCCAGAAAATAGG - Intergenic
1017298750 6:152831878-152831900 AATTATGTGGCACAGAAGTTTGG - Intergenic
1017348608 6:153414078-153414100 AATTATGTGGGTCAGATATTAGG - Intergenic
1017680260 6:156856831-156856853 AAATATAAGGGGAAGAAATTTGG + Intronic
1018138070 6:160797502-160797524 AATTATGTGGGTCAGATATTAGG + Intergenic
1018815764 6:167329501-167329523 ACTTATTTGGGGCAGAAGCTGGG - Intronic
1018927546 6:168217086-168217108 AATTCTATCGGGAAGAGATTCGG - Intergenic
1020629135 7:10619570-10619592 AATTAAATTGGGAAGAATTTTGG + Intergenic
1020790937 7:12627574-12627596 AAGTATATGGTCAAGAAATTAGG + Intronic
1021012434 7:15487298-15487320 CATTAAATGGGGCAAAAATAAGG + Intronic
1021168922 7:17374237-17374259 GATTCTATGGGTCAGAAACTTGG - Intergenic
1021192171 7:17633395-17633417 AGTTTTATGAGGCAGATATTAGG - Intergenic
1021915210 7:25424756-25424778 AAAAATATTGGGCACAAATTTGG + Intergenic
1022067697 7:26876812-26876834 AATTAAATGGGGTTGAAATGGGG - Intronic
1022783901 7:33616073-33616095 AATAATATAGGTTAGAAATTTGG + Intergenic
1023503064 7:40871522-40871544 ATGTATGTGGGTCAGAAATTTGG - Intergenic
1023812359 7:43921514-43921536 AATTATACGGGACAGATATTAGG + Intronic
1024082668 7:45868052-45868074 ATTTCTATGGGTCAGGAATTTGG + Intergenic
1026273582 7:68857579-68857601 AATTTTGTGGATCAGAAATTTGG + Intergenic
1027555501 7:79659739-79659761 AATTTTATGGGACTGAAATTGGG - Intergenic
1027597853 7:80198629-80198651 AAATCAATGGGGCAGAAGTTGGG - Intronic
1028866768 7:95722636-95722658 AATCATATGATGCAGAAAGTTGG - Intergenic
1029886338 7:103876328-103876350 AAAGATATGGAGCAGTAATTTGG + Intronic
1029989589 7:104950889-104950911 AATTTTATGGGTCAGGAATTTGG - Intergenic
1030746475 7:113172438-113172460 TTTTATATGGGGCAGAGGTTGGG + Intergenic
1030850620 7:114481296-114481318 AATTATATAGAGAAGTAATTTGG + Intronic
1031113092 7:117635980-117636002 AATTATACAGGTCAGAAACTTGG - Intronic
1031351092 7:120731893-120731915 AATTATAAGTGGCAGAATTGTGG + Intronic
1031536219 7:122936493-122936515 AATTCTGTGGGTCAGCAATTTGG + Intergenic
1031742753 7:125455329-125455351 AATTATGTAGGTCAGATATTAGG - Intergenic
1031992833 7:128209169-128209191 AAATAAATGGGGCAGAAAACAGG + Intergenic
1032126725 7:129200534-129200556 AATTATCTGGGGAAAAAATAAGG - Intronic
1033442276 7:141390907-141390929 AACAATATGCGGCAGGAATTAGG + Intronic
1034526634 7:151667879-151667901 AATTCTGTGGGTCAGCAATTTGG - Intronic
1035440952 7:158899504-158899526 AATAATATAGGTCAGAAACTTGG - Intronic
1035898727 8:3434681-3434703 AAGTCTATGGGGCAGGAATGAGG - Intronic
1035947590 8:3982636-3982658 AATTATGTGGGGCAAAGATAGGG + Intronic
1036967067 8:13311676-13311698 TACTATATGGTGCAGAAATTTGG + Intronic
1037600933 8:20393111-20393133 AAGTACATGTGGTAGAAATTCGG + Intergenic
1037784420 8:21894184-21894206 AATTATATGGGGAGGCATTTGGG + Intergenic
1041212086 8:55562379-55562401 AATGATATAGGTCAGAAACTGGG - Intergenic
1041830860 8:62151739-62151761 AATTTTGTGGGTCAGGAATTTGG + Intergenic
1041844404 8:62311401-62311423 ATTTATATGGTCCAGAAACTGGG + Intronic
1042693144 8:71526446-71526468 AATTTTGAGGGGCAGAAATCTGG + Intronic
1042972620 8:74427331-74427353 AATTCTATGGGTCAGGAAATTGG - Intronic
1043055542 8:75433089-75433111 GCTTCTATGGGTCAGAAATTTGG - Intronic
1043099481 8:76023121-76023143 AATTGTTTGGGGCTGAAATTTGG - Intergenic
1043583377 8:81738863-81738885 AATTATAGGGTCCAGAAATTTGG + Intronic
1043730360 8:83670665-83670687 AAATATGTGGGACAGAAAATTGG + Intergenic
1044096022 8:88065971-88065993 AAATATATGAGGCAGAAAAGAGG - Intronic
1044280533 8:90350454-90350476 ATTTAGATGGGACAGAAAATGGG - Intergenic
1044323861 8:90837931-90837953 AAATATAAAGGGCAAAAATTTGG - Intronic
1044421937 8:92006618-92006640 AATGATATAGGCCAGAAACTTGG - Intronic
1045287150 8:100801755-100801777 ATTTCTATGGGTCAGAAGTTTGG - Intergenic
1045996260 8:108365478-108365500 AATTACATAGGTCAGAAACTTGG - Intronic
1046093025 8:109525450-109525472 AATTGTGTGTGTCAGAAATTTGG + Intronic
1046260979 8:111766873-111766895 AAATATATGGGGTAGGAAGTTGG - Intergenic
1046574095 8:116003717-116003739 AATTATATAGGCCAGAAACATGG + Intergenic
1046838093 8:118825444-118825466 AATTTTGTGGGGCAGAAATTTGG + Intergenic
1047009020 8:120651115-120651137 AATTTTATTGTGCACAAATTTGG - Intronic
1047458799 8:125041924-125041946 AATTATATGGGCCAGATACAGGG - Intronic
1047980760 8:130179210-130179232 AAGTACAGGGGGCAGTAATTGGG + Intronic
1048284336 8:133130016-133130038 AAGTATATGAGCCAGAAACTGGG + Intronic
1049452995 8:142672411-142672433 GATTCTGTGGGGCAGGAATTTGG + Intronic
1051721229 9:20039507-20039529 AACTATATTGGGAAGAATTTAGG + Intergenic
1052455087 9:28686095-28686117 CCAGATATGGGGCAGAAATTGGG + Intergenic
1053641867 9:40090699-40090721 AATTATATCTGGCAGGAGTTTGG + Intergenic
1053764269 9:41374760-41374782 AATTATATCTGGCAGGAGTTTGG - Intergenic
1054322759 9:63688093-63688115 AATTATATCTGGCAGGAGTTTGG + Intergenic
1054542883 9:66285943-66285965 AATTATATCTGGCAGGAGTTTGG - Intergenic
1054845564 9:69793249-69793271 AATAATATAGGCCAGAAACTTGG - Intergenic
1055985052 9:82049926-82049948 AATTCCATGGGCCAAAAATTTGG + Intergenic
1056328776 9:85504517-85504539 AATTTTGTGGGTCAGGAATTTGG + Intergenic
1056498490 9:87184789-87184811 AATTATATTGGGAAGAGAATGGG - Intergenic
1057749966 9:97784489-97784511 AATTTTGTGGGTCAGGAATTTGG - Intergenic
1058278864 9:103085535-103085557 AATGATAGGAGTCAGAAATTTGG + Intergenic
1058515803 9:105773261-105773283 AAATATATGTGGAAAAAATTGGG + Intronic
1058532263 9:105917755-105917777 AATTCTCTGGAGCAGCAATTTGG + Intergenic
1058868247 9:109180862-109180884 AATTAGATGGAGCAGAAGTGAGG - Intronic
1059410412 9:114128431-114128453 GATTCTATGGGTCAGGAATTTGG - Intergenic
1059463287 9:114449020-114449042 AACTATATGGGGCAGTGCTTTGG - Intronic
1059530504 9:115031169-115031191 AATTATATGGGCCACATACTGGG + Intronic
1059667301 9:116460673-116460695 AACTATATGGTGCAGAGTTTAGG + Intronic
1059772475 9:117440612-117440634 GTTTATATGGGTCAGGAATTTGG - Intergenic
1059973258 9:119689421-119689443 TTTTATATGTGGCAGAAATTTGG + Intergenic
1060204293 9:121673590-121673612 AATTTTATGGAGGGGAAATTAGG + Intronic
1061556327 9:131371948-131371970 CACCATATGAGGCAGAAATTAGG - Intergenic
1186756374 X:12675800-12675822 AACTCTATGGGGAAGAAAATAGG - Intronic
1187092569 X:16112438-16112460 AATTCTGTGAGTCAGAAATTTGG + Intergenic
1187216114 X:17278320-17278342 AATTCTGTGTGGCAGCAATTTGG + Intergenic
1187321397 X:18241309-18241331 AAGTATATGGGGCTGAAGCTGGG - Exonic
1187352126 X:18529482-18529504 AATTATATAGGTAAGAAACTGGG - Intronic
1187744881 X:22398493-22398515 GATTCTATGGGTCAGGAATTGGG + Intergenic
1188539215 X:31231028-31231050 CATTATCTGGGGCAGAATTCAGG - Intronic
1189634910 X:42996829-42996851 AATAATACTGGGCAGAAAGTAGG + Intergenic
1190447755 X:50546671-50546693 CATTATGTGGGACAGAAATTTGG + Intergenic
1190579593 X:51879265-51879287 AATGATATAGGGCAGAAACTTGG - Intronic
1190898497 X:54645188-54645210 AATTAAATGAGGCACAAACTTGG - Intergenic
1192019826 X:67376342-67376364 AATTATGTTTGGGAGAAATTAGG - Intergenic
1192153115 X:68724184-68724206 AATAGCATGGGGCAGAAAGTAGG - Intronic
1192589670 X:72349486-72349508 AAACATATGGACCAGAAATTGGG - Intronic
1192791865 X:74390157-74390179 AATTATATAGGTTATAAATTTGG + Intergenic
1195628731 X:107031512-107031534 AATTATATTTGCCAGGAATTTGG - Intergenic
1195766541 X:108302160-108302182 TAATATATGGGGGAGAGATTAGG - Intronic
1195897784 X:109765082-109765104 AATTATATAGATCAGAAACTTGG + Intergenic
1196808640 X:119610813-119610835 AATTATATCCTGGAGAAATTGGG + Intergenic
1197075416 X:122346770-122346792 AAGTATGTGAGGAAGAAATTTGG - Intergenic
1201408173 Y:13670531-13670553 TATTATATGGTGTATAAATTTGG - Intergenic
1201424073 Y:13830382-13830404 AATTATATAGGACAGAAAAAGGG - Intergenic
1201589609 Y:15600577-15600599 AAACACCTGGGGCAGAAATTTGG + Intergenic
1202061683 Y:20895901-20895923 AATTATTTCAGGCAGAGATTGGG + Intergenic