ID: 1121079388

View in Genome Browser
Species Human (GRCh38)
Location 14:91095480-91095502
Sequence CCCTTACCAAAGAAAGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 274}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121079388_1121079390 -7 Left 1121079388 14:91095480-91095502 CCATGTTCTTTCTTTGGTAAGGG 0: 1
1: 0
2: 2
3: 19
4: 274
Right 1121079390 14:91095496-91095518 GTAAGGGAGCTTTTTTTTCCTGG 0: 1
1: 0
2: 1
3: 22
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121079388 Original CRISPR CCCTTACCAAAGAAAGAACA TGG (reversed) Intronic
901558774 1:10052974-10052996 CCCTTATAAAAGAAAGCCCAGGG - Intronic
904048847 1:27626067-27626089 CCCATACCAGAGAAAGGACCAGG + Intronic
904950580 1:34235291-34235313 TTCTTAACAAAGAAAGAACAAGG + Intergenic
905074485 1:35257730-35257752 CCCTCACCAAAAAAAGAAAAAGG + Intergenic
909968080 1:81943230-81943252 TCTTTAACAAAGAAAGAACGAGG + Exonic
911376211 1:97055527-97055549 CCCTTGCCACAGCAAGAAGATGG - Intergenic
912549363 1:110474815-110474837 CCCATCCCAAAGCAAGAAGAAGG - Intergenic
915701034 1:157797053-157797075 CCCAGAGGAAAGAAAGAACATGG + Intronic
916855075 1:168740983-168741005 CCCTTACCTGAGAGAGAACAAGG - Intergenic
917178702 1:172268220-172268242 CCCTTAACAGGGAAAGCACAGGG - Intronic
917908839 1:179618540-179618562 CCCTGACCAAAGAAAGTCAAAGG - Intronic
919822428 1:201481710-201481732 CCCTCACCAAAGAGTGAGCAAGG - Intergenic
919917525 1:202147978-202148000 CCCAATCAAAAGAAAGAACAAGG - Exonic
923425139 1:233861380-233861402 CCCATAGCAAAGAAAGCAAAAGG + Intergenic
924597728 1:245461944-245461966 TCTTTACCAAAAAAAGAAGAAGG + Intronic
1063156249 10:3381879-3381901 TCCTTATCAAAGAATGAACTCGG + Intergenic
1063253593 10:4301852-4301874 CTATTACTAAAGAAAGAAAACGG - Intergenic
1063542602 10:6949534-6949556 TCCTTAGAAAATAAAGAACAAGG - Intergenic
1064295000 10:14071064-14071086 CCCTTACCAGGGAAAGAACCCGG + Intronic
1064830517 10:19460815-19460837 CACTTTCAAAAGAAAGCACATGG + Intronic
1065516478 10:26528933-26528955 CCCTCCCCAAAGAAAGAACAGGG + Intronic
1068484196 10:57635800-57635822 CTCACAACAAAGAAAGAACAAGG - Intergenic
1068761218 10:60711841-60711863 ACCTTACCTAAAAAGGAACACGG + Intronic
1070355789 10:75639069-75639091 CCCTTTCTTAAGAAAGAAAAGGG + Intronic
1070921900 10:80192633-80192655 ACTTTAGAAAAGAAAGAACAAGG + Intronic
1071426036 10:85553045-85553067 ACTTCACCAAAGAAAAAACATGG + Intergenic
1073158803 10:101371590-101371612 GCCTTAAAAAAGGAAGAACATGG - Intronic
1077206499 11:1347078-1347100 CCAGTACCAAAGGAAGCACAGGG + Intergenic
1077596844 11:3540034-3540056 CTGTTACCAAAGAAATAAAAAGG + Intergenic
1077931891 11:6742032-6742054 CCCACACCCAAGAATGAACAAGG - Intergenic
1078360478 11:10664025-10664047 ATCTTAGCAAAGACAGAACAAGG + Intronic
1078890428 11:15551495-15551517 ACCTTACCTATGGAAGAACAAGG - Intergenic
1079773238 11:24490716-24490738 ATGTTAGCAAAGAAAGAACATGG + Intergenic
1080030422 11:27655105-27655127 TCTTTACCATAGAGAGAACAAGG + Exonic
1080406279 11:31982344-31982366 CCATCACCACAAAAAGAACATGG - Intronic
1082797412 11:57388081-57388103 CCCTAACAAAAGGTAGAACAAGG + Intronic
1083414390 11:62516065-62516087 CCCTTACAAAACACAGAAAATGG + Exonic
1084252762 11:67913988-67914010 CTGTTACCAAAGAAATAAAAAGG + Intergenic
1084820101 11:71682036-71682058 CTGTTACCAAAGAAATAAAAAGG - Intergenic
1085413420 11:76305401-76305423 TCCTTACCAAAGAAAGAAAAAGG + Intergenic
1086871877 11:92047800-92047822 CCCAAACTAAAGAAAGTACAGGG - Intergenic
1087365216 11:97209582-97209604 ACCTAACCAAAGACTGAACAAGG - Intergenic
1089514752 11:119025386-119025408 CCCCTGCCAAAGCAAGAAGAAGG + Intronic
1089664802 11:120011545-120011567 CCATTACTATAGAAAGAAAATGG + Intergenic
1093642381 12:21542432-21542454 CTCTAACCAAACAAAGCACAGGG - Intronic
1093762799 12:22929244-22929266 CCCATGCAAAAGAAAGAAAAAGG - Intergenic
1095184394 12:39184896-39184918 CCCTCACTAAAGAAAGAAACTGG + Intergenic
1095619072 12:44227482-44227504 CACTTACAAAAGCAAGAAAATGG + Intronic
1095756297 12:45770610-45770632 CTCTCACCAAAGAGAGGACACGG + Intronic
1096176519 12:49524269-49524291 GCCTTTGCAAAGAAAGAAAAAGG - Intronic
1097501170 12:60404543-60404565 CCACTACCAAAGAGATAACATGG + Intergenic
1098042453 12:66365919-66365941 CACTTACCAAAGAGGGAGCAGGG - Intronic
1102893059 12:116576358-116576380 CCCTTACCAAGGAAAAAAAAAGG + Exonic
1104236203 12:126939684-126939706 ACCTCACCAAAGAAAATACATGG + Intergenic
1104406059 12:128517756-128517778 CCTTCACCAAAGACAGGACATGG - Intronic
1106423571 13:29604483-29604505 CCCTTTCCTAACAAACAACAAGG - Intergenic
1106814492 13:33392221-33392243 CACTTAGCAAAGAACGCACATGG - Intergenic
1110005776 13:70266154-70266176 CCCTAATAAAAGAAAGAAGATGG + Intergenic
1111433485 13:88176209-88176231 CTCTCAGCAAAGAAAGAACTGGG + Intergenic
1112352413 13:98647178-98647200 CCATTACAAAAAAAATAACAAGG + Intergenic
1112492017 13:99875324-99875346 CTCTTAATAAAGAAAGAAAAAGG + Intronic
1112822212 13:103350752-103350774 CACTTACCTAAGAAAAAAAATGG - Intergenic
1112896923 13:104310818-104310840 CCCATACTATAGAAAGAGCATGG + Intergenic
1115072415 14:29340516-29340538 ACCTTAAAAAATAAAGAACAGGG + Intergenic
1117800777 14:59442625-59442647 CCATTTCCAAAGACAGAACTGGG + Intronic
1120024172 14:79563813-79563835 CCTCTACCAGAGAAAGAAAATGG + Intronic
1121079388 14:91095480-91095502 CCCTTACCAAAGAAAGAACATGG - Intronic
1121244468 14:92451980-92452002 CCCTGACCAATGACAGAACAAGG - Intronic
1121698250 14:95930244-95930266 AAGTTACCAAAGAAAGAACATGG - Intergenic
1121837264 14:97102945-97102967 CATTTACCAAAGAAAAATCATGG - Intergenic
1121866343 14:97366137-97366159 CCCTTCCCAGAGAAATAACTAGG + Intergenic
1122389550 14:101370827-101370849 CCCTTACACAAGAGAAAACAGGG - Intergenic
1123159873 14:106268027-106268049 AACTCTCCAAAGAAAGAACATGG + Intergenic
1124113311 15:26813939-26813961 ACCTCACCAAAGAAGAAACATGG + Intronic
1124270532 15:28276461-28276483 TCCTTACAAGAGAAAGCACATGG + Intronic
1124514145 15:30352009-30352031 CATTTACCACAGAAAGAAAAGGG + Intergenic
1124643483 15:31416599-31416621 CACTTACCAAACTAAAAACAAGG + Intronic
1124728775 15:32178755-32178777 CATTTACCACAGAAAGAAAAGGG - Intergenic
1126473462 15:49041763-49041785 ACCTTAACATAGAAAGAATATGG - Intronic
1127523413 15:59767248-59767270 CCATTACAAAAGAAAAATCAAGG + Intergenic
1127765679 15:62183842-62183864 CCATATCCAAAGACAGAACAAGG - Intergenic
1128167593 15:65480093-65480115 CTCATACTAAAGAAATAACATGG + Intronic
1133375240 16:5280748-5280770 CTGTTACCAAAGAAATAAAAAGG - Intergenic
1133663926 16:7946616-7946638 CCCCTAACAAAGAAAAAAAATGG - Intergenic
1134392863 16:13835852-13835874 CCATTAACCAAGAAACAACATGG + Intergenic
1135252204 16:20910165-20910187 CCCTAAGGCAAGAAAGAACATGG + Intronic
1136644798 16:31603837-31603859 CCCTCAGCAAAGAAAAAAAAAGG + Intergenic
1138890260 16:61134448-61134470 ACTTTACCAAAGAAAATACATGG + Intergenic
1139285686 16:65811648-65811670 CCAGTATCATAGAAAGAACATGG + Intergenic
1140513159 16:75522741-75522763 CCTTTAACAAAGAAAAAAGAAGG - Intergenic
1140796158 16:78440311-78440333 CCCTAAGGAAAGAAAGAGCATGG - Intronic
1141195282 16:81855983-81856005 TCCTTACCAAATTAAGAACAGGG - Intronic
1141960403 16:87403135-87403157 CCCTTACCAAGGAAAAAAAAGGG + Exonic
1143881824 17:10035694-10035716 TCCTTTGCAAAGAAAGAAGATGG + Intronic
1145937609 17:28724323-28724345 CCCTTGCCCAATAAAGGACAAGG + Exonic
1149128577 17:53266733-53266755 CATTTAACAAAGAAACAACATGG - Intergenic
1149256306 17:54831296-54831318 GCCTTGCCAAAGAAAGTAAAGGG + Intergenic
1149746061 17:59099575-59099597 CCCTTACCAAAGACAACATATGG + Intronic
1150190724 17:63235150-63235172 ATCTTTCCAAAGGAAGAACATGG - Intronic
1152292678 17:79449108-79449130 CCCTTACCACAGAGAGGAGAGGG + Intronic
1153031937 18:721870-721892 CCCTTACCAAAAAAGGAAGTTGG - Exonic
1153176500 18:2379610-2379632 CCTTTACCAAAGAAGATACATGG + Intergenic
1153516425 18:5906829-5906851 CCCTCACCAAAAAAAAAAAATGG - Intergenic
1158544161 18:58381662-58381684 CTCTTACCGAAGGAACAACAAGG + Intronic
1158850828 18:61494533-61494555 CCCTTTCAAAAGAAAGTAAAAGG - Intronic
1159530516 18:69650036-69650058 TCCTTTCCAAGGAAAGGACAAGG + Intronic
1161208165 19:3053166-3053188 CCCTTCCCAAATAAAGATGAGGG - Exonic
1161430743 19:4230890-4230912 CAATTACAAAAGAGAGAACACGG + Intronic
1161678316 19:5665879-5665901 CCCTCAACAAAGTAAGAAAAGGG - Intronic
1163182223 19:15612567-15612589 CCCTTGCCCAATAAAGGACAAGG + Intergenic
1165589459 19:36954882-36954904 CCCTCTCCAAAAAAAGAAAAAGG - Intronic
1168134784 19:54343022-54343044 CCCTGACCAAAAAAAAAATAAGG - Intergenic
1168555707 19:57338200-57338222 CCCTCTCCAAAGACAGATCAAGG - Intergenic
926077540 2:9952711-9952733 AACTTACTAAAGAAAAAACAGGG + Intronic
927505565 2:23611383-23611405 CCCAGGCCAAAGAAAGTACAGGG - Intronic
929254326 2:39792872-39792894 CCATTACCAAAAACAGACCACGG + Intergenic
929408763 2:41672795-41672817 CCATTCCCAAAGAAAAAACTTGG + Intergenic
929453374 2:42050633-42050655 CCCTCACCAAACCAAGACCAGGG + Intronic
929860572 2:45673805-45673827 CACTCACTAAAGACAGAACAAGG - Intronic
929937989 2:46308604-46308626 CCCTTTAAAAAGAAAGAAAAAGG + Intronic
930292975 2:49518941-49518963 CTCCTCCCAAAGAAAGAGCAGGG + Intergenic
930642558 2:53868979-53869001 CCCTCTCCAAATAAAAAACAAGG + Intronic
931229194 2:60359914-60359936 CCCCTACCAAAGGAAGGCCATGG - Intergenic
931541316 2:63332523-63332545 ACATTACCAAAGAAAAAATATGG - Intronic
932175168 2:69594128-69594150 CCCTTCCCAAAGAAAAATCTGGG - Intronic
932325247 2:70855189-70855211 CCCTTACCTAAAAACAAACAAGG + Intergenic
933395074 2:81720919-81720941 CCCTTAACAAAGATATAAGATGG + Intergenic
933716536 2:85365546-85365568 CCCTGACCAACAGAAGAACACGG - Intronic
934617811 2:95785788-95785810 CCCTCACCAAAGACAGGAAAGGG + Intergenic
934643082 2:96038771-96038793 CCCTCACCAAAGACAGGAAAGGG - Intronic
934648736 2:96074545-96074567 CTGTTACCAAAGAAAGAGAATGG - Intergenic
935254734 2:101299721-101299743 CCATTACCACACAAAGAACGTGG - Intronic
935522521 2:104125175-104125197 TCCTCAGAAAAGAAAGAACAAGG - Intergenic
938753885 2:134362138-134362160 CCCTCAGGTAAGAAAGAACAGGG + Intronic
939223168 2:139329622-139329644 TCCTTAGAAAACAAAGAACAAGG - Intergenic
941912066 2:170773272-170773294 CCTATACCTAGGAAAGAACAAGG + Intergenic
941980550 2:171451432-171451454 CCTTTACCAAAGTAAAAGCAAGG - Intronic
942121506 2:172782395-172782417 CCCTTCGAAGAGAAAGAACATGG - Intronic
942277007 2:174330566-174330588 CCCTTGCAAATGAAAGAGCAAGG - Intergenic
943079416 2:183239970-183239992 CTCATACCAAAGAATGGACAGGG - Intergenic
943308125 2:186292522-186292544 TTCTTACCAAAAAAAGAAAAAGG + Intergenic
943868890 2:192966410-192966432 CCTTCACCATAGAAAGAAAAAGG - Intergenic
944364001 2:198894894-198894916 CCCTTACCAAAAAAGGAAGTTGG + Intergenic
945347059 2:208731352-208731374 CCCTTGCCAAAGCAGCAACAGGG + Intronic
946569980 2:221013864-221013886 CCCACACCCAAGAATGAACAAGG - Intergenic
946589503 2:221228721-221228743 CACATACCAAAAAAAGAAAAAGG - Intergenic
947280518 2:228447721-228447743 CCCATACTAGAGAGAGAACATGG + Intergenic
947352924 2:229265211-229265233 CCCTTATCAAAGTAAGAACTCGG + Intronic
947453411 2:230229909-230229931 CCCCTACCTGTGAAAGAACAAGG - Intronic
947583172 2:231334440-231334462 TCCTTACAAAAGACAGAAGAGGG - Intronic
1169015776 20:2291595-2291617 CCCTTCCCAGAGGAAGGACATGG + Intergenic
1169130167 20:3162637-3162659 CCTTTCCCAAAGAAATAAAACGG - Exonic
1169914990 20:10674789-10674811 CCCTTCCCAAAGCCTGAACAGGG - Intergenic
1169997440 20:11574366-11574388 CACTTAACATGGAAAGAACATGG + Intergenic
1170024430 20:11873449-11873471 TCCTTACCTAAGAAAGATTAGGG - Intergenic
1170147119 20:13187795-13187817 ACCTTACCTAAAGAAGAACAAGG + Intergenic
1170684682 20:18558766-18558788 GCCTCAGCAAAGAAACAACAAGG - Intronic
1173746713 20:45443107-45443129 CCCTTAGCCACCAAAGAACAGGG - Intergenic
1175457181 20:59124256-59124278 CCATTGCCAAAGAAAAATCATGG + Intergenic
1178233594 21:30815692-30815714 GGCTTATCAAAGAAAGAGCAAGG + Intergenic
1181612621 22:24028581-24028603 TCCATAACAAAGACAGAACAAGG - Intronic
1182657491 22:31902347-31902369 GGATTACCAAAGCAAGAACAAGG - Intronic
1183036735 22:35146279-35146301 CTCTTTTCAAAGAAAGAAAAGGG + Intergenic
949213159 3:1530588-1530610 CCCTTTCAAAAATAAGAACAAGG - Intergenic
952280970 3:31923046-31923068 CACTTCACAAAGAAAGAACAAGG + Intronic
952592846 3:34978316-34978338 CCATTATCAAAGAAAGACCTAGG - Intergenic
952803293 3:37318631-37318653 TCCTATCCAAAAAAAGAACAAGG + Intronic
953767615 3:45755972-45755994 CATTTAAAAAAGAAAGAACATGG - Exonic
954280817 3:49576364-49576386 CTCTTACCAAGGAAGAAACAGGG - Intronic
955101648 3:55855524-55855546 CCCCTACCAAAGAAATGTCATGG - Intronic
955283064 3:57612983-57613005 CCGTCACCAAAAAAAGAAAAAGG - Intergenic
956619972 3:71212056-71212078 TATTTAACAAAGAAAGAACATGG - Intronic
957716119 3:83931045-83931067 CCTTCACCAAGGAATGAACAGGG + Intergenic
957716867 3:83939164-83939186 CCCTTCCAAAAGAAAGAGCTAGG - Intergenic
957746235 3:84347077-84347099 CCTTTCCCAAAGGAAGAAAATGG + Intergenic
958532493 3:95351205-95351227 GCCATATCAAAGAAAGAACTTGG - Intergenic
959462206 3:106641313-106641335 TCCTTAGGAAAGAAAGAAGAGGG + Intergenic
960214153 3:115010094-115010116 CCCTTACCAGAGAAAGGTAAAGG - Intronic
960852753 3:122073305-122073327 ACCTCACCAAAGAAGGTACACGG - Intronic
961430832 3:126881808-126881830 CTCTGACAAAAGAAAGAACGAGG + Intronic
961900438 3:130205350-130205372 CTGTTACCAAAGAAATAAAAAGG + Intergenic
962186386 3:133264720-133264742 CACTTACCATAAAAAGAACAGGG + Intronic
962545657 3:136431630-136431652 CCATTACCAGAGAAACAAAAAGG - Intronic
963393809 3:144705696-144705718 TCCTTAAGAAAGAAAGAAAAAGG + Intergenic
963594682 3:147310585-147310607 CACTTATGAATGAAAGAACAAGG + Intergenic
963704932 3:148674994-148675016 CCTTTACCTTAGAAATAACATGG + Intergenic
964922553 3:161914929-161914951 CCATTACCACAGAATGAAGATGG + Intergenic
967149463 3:186635571-186635593 CCCTGACCAAAGAAGGAAAGGGG - Intergenic
967716835 3:192772229-192772251 GACTTGCCAGAGAAAGAACAGGG - Intergenic
969011419 4:4066527-4066549 CTGTTACCAAAGAAATAAAAAGG + Intergenic
969742651 4:9043360-9043382 CTGTTACCAAAGAAATAAAAAGG - Intergenic
969802031 4:9575470-9575492 CTGTTACCAAAGAAATAAAAAGG - Intergenic
969888927 4:10241720-10241742 CCCTTACCAAATAAAGATGTGGG - Intergenic
970015116 4:11504482-11504504 TCCTTACAAAAGAAAGGAGAGGG + Intergenic
970417335 4:15872344-15872366 CCATGACCAAAAAATGAACATGG + Intergenic
971953429 4:33383692-33383714 CAGTTACCAAATAAAAAACATGG + Intergenic
971956712 4:33429882-33429904 CCCTTACAAAACACAGAGCATGG + Intergenic
974540476 4:63226784-63226806 CCCTTACCAAAACACTAACAGGG - Intergenic
975355377 4:73396471-73396493 CCCTTACGGAAGAAAGGTCAAGG + Intergenic
976797026 4:88945484-88945506 CCCTTCCAAGAGAAAGAAGAAGG - Intronic
977982763 4:103344804-103344826 CTCTGACAAAAGAAAGAATATGG + Intergenic
978683089 4:111406547-111406569 CCCCTACCAAAAAAAGAAAAAGG + Intergenic
979385839 4:120064587-120064609 CCCATACCAAAGAAATACCCAGG + Intronic
979720464 4:123894134-123894156 CCCTTAAAAAAGAAGGACCATGG - Intergenic
980014176 4:127629794-127629816 ACCTTACCCAAGAAAGAATTCGG + Intronic
983508149 4:168577804-168577826 CCTTGGCCAAAGAAAGAAGAAGG + Intronic
983921043 4:173345167-173345189 CTCTAACTAAAGAAAGATCACGG + Intergenic
984012834 4:174391156-174391178 GCTATACAAAAGAAAGAACAGGG - Intergenic
984244120 4:177254134-177254156 CCTTTATAAAAGAAAGAATATGG + Intergenic
985637046 5:1041021-1041043 CACTCACACAAGAAAGAACAAGG - Intergenic
986134216 5:4959198-4959220 CCGTTACTAAAAAAACAACATGG - Intergenic
986445570 5:7818213-7818235 CCCATAGCAAAGGAAGAAAATGG - Intronic
987488035 5:18544574-18544596 CCCTCTCCAAGGAAAGAAAAGGG + Intergenic
988836481 5:35037540-35037562 CCCTTAAGAAAGAAAGAAGGAGG - Intronic
990466351 5:56075263-56075285 TCCTTAGCAAAGAAAGATCTGGG + Intergenic
991159200 5:63477033-63477055 CCCTTATGCAAGAAAGAAGAGGG + Intergenic
992073665 5:73171852-73171874 CCCTTGACAAAGAAATCACATGG - Intergenic
994675747 5:102819731-102819753 CATTTACGAAAGAAAGTACATGG + Intronic
995104455 5:108358885-108358907 CTCTTAACAAAAAAAGAAAAAGG - Intronic
995664053 5:114521494-114521516 CACTTACCAAAAAAGGACCATGG - Intergenic
995702172 5:114948336-114948358 CCCTTACCAAGGAAGGAGGAAGG - Intergenic
998989623 5:147801466-147801488 TCCTTTTCAAAGAAAGAAAAAGG + Intergenic
1000107118 5:158070325-158070347 CCCTTAGGCAAGAAAGCACAGGG + Intergenic
1000479347 5:161752198-161752220 ACCTTACAAATGGAAGAACAAGG - Intergenic
1004051915 6:12090823-12090845 CTCTTGCCAAAGAAGTAACAAGG - Intronic
1004453428 6:15769034-15769056 CCATTCCAAAAGACAGAACAAGG - Intergenic
1008053399 6:46922655-46922677 CCCTTCCCAAGGTCAGAACACGG + Intronic
1008951662 6:57167418-57167440 CTCTTACCAAAGAAAAACAAGGG - Intronic
1009802880 6:68564510-68564532 CACTTACCAAAGACAAAACAAGG - Intergenic
1010632105 6:78209988-78210010 GCCTTACCAAAAAAGAAACAAGG - Intergenic
1014470224 6:121804023-121804045 CAGTTACCTAAGAAAGAAGAAGG - Intergenic
1014496482 6:122130169-122130191 CACTTACCAAATACAGAAAATGG - Intergenic
1014959536 6:127666018-127666040 CCTTTACTATAGAAAGAACATGG + Intergenic
1015162548 6:130169603-130169625 CCTTTGCTACAGAAAGAACAGGG - Intronic
1015279227 6:131415300-131415322 CTCTCACCAAAGAAAGAAATGGG - Intergenic
1015420043 6:132997103-132997125 CCCTTGCCCAATAAAGGACAAGG - Intergenic
1021532990 7:21670601-21670623 CTCTTACCAAAGAATGTAAATGG - Intronic
1021548979 7:21849688-21849710 ACCTTACCTATGAAGGAACAAGG - Intronic
1022890100 7:34688518-34688540 CCCTTTCCACACAAAGAACTTGG + Intronic
1023017752 7:35983872-35983894 CCCAGGCCAAAGAAAGCACAGGG - Intergenic
1023246894 7:38214806-38214828 CCATTATGAAAGAAAAAACAAGG - Intronic
1026237359 7:68538937-68538959 CTGTCACCAAAGAAAGAAGAAGG - Intergenic
1026452328 7:70540286-70540308 CCCTTCCCAAAGAGAGAGGATGG - Intronic
1027724619 7:81788505-81788527 CCCGTTACAAAGAAAGACCAGGG + Intergenic
1027914416 7:84297428-84297450 TCCTTAACAAAGAAAGCTCAAGG + Intronic
1028366759 7:90041025-90041047 CCATTCCCAAAGGAAGAAAATGG - Intergenic
1029070711 7:97894549-97894571 CTGTTACCAAAGAAATAAAAAGG + Intergenic
1029738701 7:102479243-102479265 ACGTTTCCAAAGAAAGATCAAGG - Intergenic
1029834268 7:103292706-103292728 CCCTTCCCATAAAAAGAAAAAGG + Intergenic
1032155332 7:129463225-129463247 CCCTTCCCAAAGAAGGACTAGGG - Intronic
1032276240 7:130458231-130458253 CCCATACAAAAGAAAGAAGTTGG - Intergenic
1033008136 7:137589789-137589811 CCCCTTCCAAAGAAGGAAGAAGG + Intronic
1034035047 7:147810891-147810913 CCCATACCACAGAAAGAGAAAGG - Intronic
1035407345 7:158607695-158607717 CCCTTGCCACAGAAAACACAAGG + Intergenic
1036247857 8:7135227-7135249 CTGTTACCAAAGAAATAAAAAGG - Intergenic
1036252956 8:7179146-7179168 CTGTTACCAAAGAAATAAAAAGG + Intergenic
1036364540 8:8108328-8108350 CTGTTACCAAAGAAATAAAAAGG - Intergenic
1036475073 8:9085664-9085686 CCCTTAACAGAGAAAGTTCAGGG + Intronic
1037256369 8:16959989-16960011 CCGATACCACTGAAAGAACAGGG + Intergenic
1037259623 8:16993407-16993429 GCCTTGTCAAAGAAAGAAAAAGG + Intronic
1038226875 8:25665849-25665871 CCTTTAACCAGGAAAGAACATGG - Intergenic
1040968204 8:53105572-53105594 TTCTTACAAAAGAAAGAAAATGG - Intergenic
1041165746 8:55090739-55090761 CCCTGTCCAAAGAAGGCACATGG + Intergenic
1042378645 8:68086014-68086036 AACTGACCAAAGAAAGAAAAAGG - Intronic
1042733123 8:71959223-71959245 CTCTTACAAAAGAGATAACAGGG + Intronic
1043145036 8:76642423-76642445 CCTTTACCAAAGAGAAGACAGGG + Intergenic
1045046044 8:98279524-98279546 CCCTGACCAGTGAAAGGACAGGG - Intronic
1045307948 8:100974928-100974950 CCCTAGCCAATGACAGAACAGGG - Intergenic
1045401638 8:101825012-101825034 CACTTCACAAAGAAAGAAGAGGG - Intronic
1045753737 8:105516692-105516714 CCCTCGCCAAAAAAAGAAAAGGG - Intronic
1045900293 8:107270565-107270587 CCCTTTCCACTGAAAGAACTGGG + Intronic
1046856760 8:119040965-119040987 CCCTTAGGAAAAAAAGAACAAGG + Intronic
1048268071 8:133005035-133005057 CCCTGAGGAAAGAAAGAACATGG + Intronic
1048726977 8:137397519-137397541 ACCTAAAGAAAGAAAGAACATGG - Intergenic
1049666144 8:143843741-143843763 TCCTTATCAGAGAAAGAAAAGGG + Intergenic
1050010733 9:1183404-1183426 CCCTTACCAAACATAGAGCATGG + Intergenic
1050989731 9:12134749-12134771 CTCTTATCCAAGAAGGAACATGG - Intergenic
1051559740 9:18426844-18426866 CACTAACCAAATGAAGAACAGGG + Intergenic
1052042983 9:23761472-23761494 TCCTTAACAAGGAAAGGACATGG - Intronic
1059850038 9:118327945-118327967 CCCCTACCAAAGAAATAATCTGG - Intergenic
1061206501 9:129167014-129167036 CCCTCAGCAAAGACGGAACATGG - Intergenic
1186094510 X:6085069-6085091 CCCTTAGCTGAGAAACAACAGGG + Intronic
1186637122 X:11418473-11418495 TCCTTGCCAAACAAAGAAAAAGG - Intronic
1186807310 X:13153172-13153194 CCCTACACAAAGAAAGACCATGG - Intergenic
1188294276 X:28428205-28428227 ACATTACTAAAGAAAGTACAGGG + Intergenic
1188671906 X:32890624-32890646 TTCTTACCAAAGAAACAAAAAGG - Intronic
1191213751 X:57914916-57914938 GGCTTACCAAAGCAAAAACAGGG - Intergenic
1191674685 X:63782670-63782692 ACCTTGCAAACGAAAGAACAAGG + Intronic
1195662378 X:107392823-107392845 GCCTTACCAAAGAATGTACAGGG - Intergenic
1197353644 X:125407011-125407033 ACCTTACATAAGAAAGAGCAAGG + Intergenic
1198127722 X:133662746-133662768 CCATTGCCAAAGAGAGAAAAAGG + Intronic
1198314550 X:135452622-135452644 CCCCTACCAAAGAAATAGTATGG + Intergenic
1199116598 X:143999945-143999967 CCATTCCCAAAGAAAGAAGTAGG + Intergenic
1199511378 X:148626746-148626768 CCCTTACGAGAGAAAGGAGAGGG - Intronic
1199584502 X:149399572-149399594 CCCTTACCAATCCATGAACATGG + Intergenic
1201296479 Y:12467593-12467615 CCCACACCCAGGAAAGAACAAGG - Intergenic