ID: 1121080301

View in Genome Browser
Species Human (GRCh38)
Location 14:91102643-91102665
Sequence CTCTACAGGGCATGGATATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121080301 Original CRISPR CTCTACAGGGCATGGATATG GGG Intronic
905310754 1:37047239-37047261 CTCCACAGGGGATGGATGTTGGG - Intergenic
909368593 1:74858377-74858399 CTCTGCAGTGCATGGATTTTGGG - Intergenic
913172025 1:116241698-116241720 ACCCACAGGGCATGAATATGAGG + Intergenic
915506444 1:156359894-156359916 CTCTACAGGGAATGGAGAAATGG - Intronic
915732411 1:158063386-158063408 CTCCTGAGGGCATGGACATGGGG - Intronic
918099254 1:181359444-181359466 TTGAACATGGCATGGATATGGGG + Intergenic
1073978804 10:109130745-109130767 CTCATCAGTTCATGGATATGTGG + Intergenic
1076457216 10:130608773-130608795 CTCTAGAGGGCATGGAGACTTGG - Intergenic
1080888887 11:36391341-36391363 CACGCCAGGGCATGGAGATGGGG - Intronic
1081287514 11:41289110-41289132 TTATACAGGGCATGGATACCAGG + Intronic
1082942298 11:58719655-58719677 TTCTACAGGGCCTGAAGATGAGG + Intronic
1087613176 11:100458151-100458173 CTCCAGAGGGATTGGATATGGGG + Intergenic
1088357603 11:108960106-108960128 CTGCACAGGGCATGGAGCTGTGG + Intergenic
1089809367 11:121119098-121119120 ATCTCCAGGGCATGGCTATGTGG - Intronic
1090100476 11:123790741-123790763 TTCTACAGGGCCTGAAGATGAGG + Intergenic
1090637511 11:128700025-128700047 CTCTGCAGGGCACACATATGTGG - Intronic
1091139344 11:133222071-133222093 GACTACAGGGCATAGATTTGGGG - Intronic
1093830705 12:23753931-23753953 CTGTTCAGGGCATGGTTATTAGG - Intronic
1097703659 12:62846013-62846035 CTGGACAAGGCATGGAAATGGGG - Intronic
1098031604 12:66260592-66260614 CTATATAAGGCATGGAGATGAGG - Intergenic
1100429083 12:94514333-94514355 CTCCAATGGGCATGGATATGTGG - Intergenic
1100888470 12:99098846-99098868 CTCTACAGGCCCTGCATTTGGGG + Intronic
1101779606 12:107823773-107823795 CTATAGAGGGCTAGGATATGGGG - Intergenic
1101912115 12:108867765-108867787 CTCCACAGGGCATGAATATCAGG - Intronic
1102446511 12:113007074-113007096 CCCTACAGTGCATGAATCTGGGG - Intronic
1102446819 12:113009426-113009448 CCCTACAGTGCATGAATCTGGGG - Intronic
1104138057 12:125959230-125959252 ATCTACAGGGAATGTGTATGGGG + Intergenic
1104452102 12:128878147-128878169 CTACACAGAGCATGCATATGAGG + Intronic
1111138357 13:84081334-84081356 TTCTAAAGGGCATGGACATAGGG + Intergenic
1112413041 13:99180131-99180153 CTCCACAGGACATGGGAATGGGG - Intergenic
1118730368 14:68661722-68661744 CTCTACCGGGCATGAAAAGGAGG - Intronic
1120353796 14:83401278-83401300 GACTACAGGGCAAGGATCTGTGG + Intergenic
1120377276 14:83726188-83726210 AACTACAGGGAATGGAGATGGGG - Intergenic
1120471450 14:84930380-84930402 CTCTACAGGTCATGGAATTATGG - Intergenic
1121080301 14:91102643-91102665 CTCTACAGGGCATGGATATGGGG + Intronic
1126994574 15:54426053-54426075 CTCAACAGGACATGTAAATGTGG - Intronic
1127324543 15:57882519-57882541 CTCTGCAGGCCACAGATATGTGG - Intergenic
1127638975 15:60897411-60897433 CTCTACAGGAGAAGGATTTGAGG - Intronic
1130733551 15:86524436-86524458 CTCTACTGGGCAAGGATACCTGG - Intronic
1133443681 16:5841701-5841723 CTCTACAGGCCATGGAAGTCAGG - Intergenic
1141367855 16:83460545-83460567 ATCTCCAGGACATGCATATGTGG + Intronic
1142604554 17:1074296-1074318 CTCTGCAGGGCATGGCTGGGTGG - Intronic
1142604579 17:1074428-1074450 CTCTGCAGGGCATGGCTGGGTGG - Intronic
1143043216 17:4055153-4055175 CTCTTTAGGGCCTGGAAATGAGG + Intronic
1148772904 17:50077177-50077199 CTGCACAGGACATGGATATGGGG - Intronic
1154154444 18:11932847-11932869 CTACACAGGGCATGAATATCAGG + Intergenic
1155001109 18:21687571-21687593 TTCTAAAGGGCGTGTATATGAGG + Intronic
1156725675 18:40123485-40123507 CTCTAAAAGACATGGATATAGGG + Intergenic
1165809918 19:38606063-38606085 CTCTCCAGGGCAGGGAATTGGGG - Intronic
1167170379 19:47827113-47827135 CTACACAGGGCATGAATATCAGG + Intronic
1167762876 19:51460447-51460469 CTCTACTGGGCAAGGATAGGAGG - Intergenic
925219519 2:2126687-2126709 CTCTACTGGGCATGGTCATCTGG + Intronic
928921129 2:36529176-36529198 CTCTAGTGGTCAAGGATATGGGG + Intronic
929848083 2:45554080-45554102 ATCTTCAAGGTATGGATATGGGG - Intronic
942233701 2:173883696-173883718 CTCTGCAGGGTGTGGATATAGGG - Intergenic
946701025 2:222413756-222413778 TTCTACAGGGCCTGAAGATGGGG - Intergenic
948485359 2:238277529-238277551 CTCGACAGGGCCTCGTTATGAGG + Intronic
948800718 2:240432289-240432311 CTCTACAGGGCTTAGCGATGGGG - Intergenic
1169406096 20:5322439-5322461 CTGCAAAGGGCATGGATGTGGGG + Intergenic
1171311798 20:24150750-24150772 CAGGACAGGGGATGGATATGAGG - Intergenic
1172402732 20:34663850-34663872 CTCTACAGGGCACCAGTATGCGG + Intronic
1173556092 20:43966870-43966892 CTCTGCAGGGTTTGGATCTGAGG + Intronic
1174312211 20:49666273-49666295 CTCTACATGCCATGGAGATGTGG - Intronic
1176260606 20:64177649-64177671 CTCTCCAGGGCAGGGACAAGAGG + Intronic
1177057771 21:16330020-16330042 TTCTACAGGGCATTTGTATGTGG + Intergenic
1177725374 21:24960170-24960192 CTCTTTAGGGGATGGAAATGTGG + Intergenic
1180757864 22:18175592-18175614 CTCTACAGGGCAGAGTTAAGTGG - Intronic
1180768149 22:18359385-18359407 CTCTACAGGGCAGAGTTAAGTGG - Intergenic
1180778157 22:18503005-18503027 CTCTACAGGGCAGAGTTAAGTGG + Intergenic
1180810882 22:18760316-18760338 CTCTACAGGGCAGAGTTAAGTGG + Intergenic
1181197031 22:21194571-21194593 CTCTACAGGGCAGAGTTAAGTGG + Intergenic
1181283277 22:21735248-21735270 CTCAACTGGGCAAGGAAATGAGG - Intronic
1182678918 22:32063037-32063059 CTTTACTGTGCATGTATATGGGG + Intronic
1183743453 22:39680479-39680501 CACCACAGGGCAGGGATGTGGGG - Intronic
1203229769 22_KI270731v1_random:100272-100294 CTCTACAGGGCAGAGTTAAGTGG - Intergenic
952036929 3:29214031-29214053 CTCTGCAGAACATGGACATGTGG + Intergenic
954659480 3:52219323-52219345 CTCCCCAGGGCATGGCTGTGGGG - Intergenic
956475151 3:69611540-69611562 CAGTACAGGGCATGGATACAGGG - Intergenic
958071796 3:88623649-88623671 CTCTACAGTGCATTGTTCTGGGG + Intergenic
959970452 3:112403447-112403469 TTCTACAGGGCCTGAAGATGGGG + Intergenic
962072590 3:132047072-132047094 CTACAAAAGGCATGGATATGTGG - Intronic
962989248 3:140563618-140563640 CTCTACAGTGCTTGGCTCTGTGG + Intronic
963552635 3:146744280-146744302 CTCTACAGGCAGTGGATATGAGG - Intergenic
963754789 3:149223745-149223767 CTCCCCAGGGCATGGAGAAGGGG + Intergenic
966271204 3:178108126-178108148 CCAAACAGGGCATGGATTTGAGG + Intergenic
968428426 4:537970-537992 CTTTACAGGACATGCATGTGGGG + Intronic
969045623 4:4334443-4334465 CTATACAGGGCTTTGCTATGAGG - Intergenic
969078004 4:4595722-4595744 CTACACAGGGCATGAATATTGGG + Intergenic
969320506 4:6409686-6409708 GTCTCCAGGGCTGGGATATGGGG - Intronic
970810067 4:20082016-20082038 CTCTACAGGGTTTTGGTATGAGG - Intergenic
971215616 4:24659754-24659776 CAGTAAAGGGCATGGATATGGGG - Intergenic
971675116 4:29616569-29616591 CACTGCAGGTCAAGGATATGTGG - Intergenic
975814291 4:78201903-78201925 CGCAACAAGGCATGGATATGTGG - Intronic
977634241 4:99278295-99278317 CTCAAGAGCGCATGGATATATGG - Intronic
978116079 4:105022093-105022115 AGCTATAGGGCTTGGATATGGGG - Intergenic
980471602 4:133259929-133259951 TTCTACAGGGCCTGAAGATGAGG + Intergenic
980551011 4:134335333-134335355 CTCTACATGGACTGGAGATGAGG - Intergenic
981478566 4:145212693-145212715 GTTAAAAGGGCATGGATATGGGG - Intergenic
984031508 4:174610189-174610211 TTCTACAGGGCCTGCAGATGAGG - Intergenic
986025089 5:3843069-3843091 AGCAACAGGGCATGGATAGGTGG - Intergenic
986425064 5:7623105-7623127 CTCTGCAGGGCATAGAAATGGGG - Intronic
987200651 5:15573764-15573786 CTCTGCAGAGCATGAATGTGAGG + Intronic
991902652 5:71476103-71476125 CTTTACAGGGAATGGATTTAAGG - Intronic
994319466 5:98375449-98375471 CTCTTCAAGGCATTGTTATGAGG + Intergenic
994648623 5:102499629-102499651 CTCTTTAGGCCATGTATATGTGG + Intergenic
995870223 5:116736756-116736778 GTGTACAGGGCATACATATGGGG - Intergenic
997201843 5:132014673-132014695 CTCCAGAGGGTGTGGATATGGGG + Intergenic
998808212 5:145939333-145939355 CTCTTCAGAGCAGGGAGATGTGG - Intronic
999203722 5:149833691-149833713 CTCTCCAGGGCAGGGATCTGGGG - Exonic
1003260555 6:4511947-4511969 CTCTGCAGAGCATGGGTGTGAGG - Intergenic
1006897496 6:37480282-37480304 CTCTTCAGGGGATGGAGAGGAGG - Exonic
1008721596 6:54360523-54360545 TTCTAATGGGCATGGAGATGTGG - Intronic
1011939909 6:92830176-92830198 TTCTACTGGGCCTGAATATGAGG - Intergenic
1012684578 6:102229530-102229552 CACTTCAGGGCATGTATAAGAGG + Intergenic
1014575992 6:123073597-123073619 CTCAAAAGAGCATGGATAAGGGG - Intergenic
1016506007 6:144779745-144779767 CTGTACAGGGCAAAGAAATGAGG + Intronic
1017351357 6:153445829-153445851 TTCTACAGGGCCTGAAGATGAGG + Intergenic
1018145747 6:160886586-160886608 TTCTACAGGGCCTGAAGATGAGG - Intergenic
1019522880 7:1468538-1468560 CTCTCCCGGGCCTGGATGTGGGG - Intergenic
1020340753 7:7107876-7107898 TTCTACAGGGCCTGAAGATGAGG - Intergenic
1022461862 7:30616622-30616644 CTCTGCAGTGTATGGAGATGGGG + Intronic
1023424623 7:40022440-40022462 TTCTACAGGTCATGGCTTTGGGG + Intronic
1026363036 7:69620264-69620286 CTCTACTGGGCAAGGCTATCAGG + Intronic
1026575416 7:71567436-71567458 CTCTACAGGGTATTGTTGTGTGG - Intronic
1026604832 7:71806847-71806869 CTCCTCAGGGAATGGATTTGAGG + Intronic
1027216504 7:76187166-76187188 CCCTGCTGGGCATGGATGTGGGG + Intergenic
1028905726 7:96152125-96152147 CTCTAGATGGCATGGAGAAGGGG + Intronic
1032545897 7:132742197-132742219 CTACACAGGGTATGGATATCAGG - Intergenic
1037656250 8:20886804-20886826 CTCTTCAGGGCTGGGACATGGGG - Intergenic
1042294475 8:67204448-67204470 CTCTACAGCTCCTGGAGATGAGG - Intronic
1042298558 8:67249991-67250013 CTCTTCAGGGCATTCATATGAGG - Intronic
1046359151 8:113127681-113127703 CTCTACAGGGTATGGATTAAAGG - Intronic
1052438035 9:28455794-28455816 CTCTACAAGGCAGGGGGATGTGG - Intronic
1053075525 9:35130709-35130731 TTCTACAGGGCATGAAGATGAGG - Intergenic
1055180765 9:73383313-73383335 CTCTCCAGGACATTGATCTGGGG - Intergenic
1060476270 9:123989163-123989185 CTCTCCTGGGGATGGATATTTGG - Intergenic
1190228663 X:48564580-48564602 CTATACAGGGCATGAATACCAGG + Intergenic
1192932622 X:75824223-75824245 CTGTACAGAACATGGCTATGTGG - Intergenic
1196153808 X:112405368-112405390 GTCTAAAGGACAAGGATATGGGG + Intergenic
1196772959 X:119313694-119313716 CTCTACTGGGCCTGAAGATGAGG - Intergenic
1199946502 X:152673080-152673102 CTCTACAGGCCATACTTATGTGG - Intergenic